text
stringlengths 905
14.5k
|
|---|
BMC Nurs BMC Nurs BMC Nursing 1472-6955 BioMed Central London 36907852 1221 10.1186/s12912-023-01221-z Correction Correction to: Compliance with standard precautions and associated factors among undergraduate nursing students at governmental universities of Amhara region, Northwest Ethiopia Ayele Desalegn Getachew [email protected] 1 Tezera Zewdu Baye 2 Demissie Negesu Gizaw 3 Woretaw Ashenafi Worku 1 1 grid.59547.3a 0000 0000 8539 4635 Department of Surgical Nursing, School of Nursing, College of Medicine and Health Science, University of Gondar, Gondar, Ethiopia 2 grid.59547.3a 0000 0000 8539 4635 Department of Comprehensive Nursing, School of Nursing, College of Medicine and Health Science, University of Gondar, Gondar, Ethiopia 3 grid.59547.3a 0000 0000 8539 4635 Department Medical Nursing, School of Nursing, College of Medicine and Health Science, University of Gondar, Gondar, Ethiopia 13 3 2023 13 3 2023 2023 22 67(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction to: BMC Nursing (2022) 21:375 10.1186/s12912-022-01165-w Following publication of the original article , the authors reported errors in the second and the third author names. The original author names were: Zewdu BayeTezera2, Negesu Gizaw Demssie3 The correct author names are: Zewdu Baye Tezera2, Negesu Gizaw Demissie3 The correct author names have been provided in this Correction. The original article has been corrected. The online version of the original article can be found at 10.1186/s12912-022-01165-w Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. Ayele DG Tezera ZB Demissie NG Compliance with standard precautions and associated factors among undergraduate nursing students at governmental universities of Amhara region, Northwest Ethiopia BMC Nurs 2022 21 375 10.1186/s12912-022-01165-w 36581879 |
Child Adolesc Psychiatry Ment Health Child Adolesc Psychiatry Ment Health Child and Adolescent Psychiatry and Mental Health 1753-2000 BioMed Central London 36907862 586 10.1186/s13034-023-00586-y Editorial Artificial intelligence in pediatric behavioral health van Schalkwyk Gerrit [email protected] grid.420884.2 0000 0004 0460 774X Intermountain Health, Salt Lake City, 84102 USA 12 3 2023 12 3 2023 2023 17 3828 2 2023 28 2 2023 (c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmcAs we continue to face a growing need for mental health services for children and adolescents, innovative solutions are needed to improve the accessibility and quality of care. One promising solution is the use of technology and artificial intelligence in mental health care. One such tool is ChatGPT, a language model trained by OpenAI that can provide evidence-based information and guidance on a wide range of mental health topics. ChatGPT has the potential to support pediatric behavioral health in a number of ways. First, ChatGPT can be used as a resource for mental health professionals who are seeking guidance on evidence-based treatments, assessment tools, and best practices for treating common pediatric behavioral health conditions such as anxiety, depression, and attention-deficit/hyperactivity disorder (ADHD). Mental health professionals can use ChatGPT to access information and resources quickly and easily, which can improve their ability to provide effective care to children and adolescents. Second, ChatGPT can be used as a tool to increase access to mental health services for children and adolescents. Many children and adolescents who are in need of mental health services do not receive them due to barriers such as stigma, lack of access to care, or inadequate mental health care infrastructure. ChatGPT can provide children and adolescents with a non-judgmental and accessible resource for mental health information and guidance. Children and adolescents can use ChatGPT to learn about mental health conditions, coping strategies, and treatment options, which can help them better understand and manage their mental health. Third, ChatGPT can be used to provide parents and caregivers with guidance and support in managing their child's mental health. Parents and caregivers play a critical role in supporting their child's mental health, but they may lack the knowledge and resources to do so effectively. ChatGPT can provide parents and caregivers with evidence-based information on topics such as how to talk to their child about mental health, how to support their child's treatment, and how to promote positive mental health behaviors in their child. While ChatGPT has the potential to support pediatric behavioral health in a number of ways, there are also potential limitations to the use of this technology. One limitation is that ChatGPT is not a substitute for a trained mental health professional. While ChatGPT can provide evidence-based information and guidance, it cannot provide a diagnosis or treatment plan tailored to an individual's specific needs. Therefore, it is important for individuals to seek the advice of a mental health professional for a comprehensive evaluation and treatment plan. Another limitation is that ChatGPT may not be able to address all the complex factors that can impact a child's mental health. For example, ChatGPT may not be able to address issues related to socioeconomic status, family dynamics, or cultural factors that can impact a child's mental health. Therefore, it is important to use ChatGPT as a tool in conjunction with other resources and to take a holistic approach to treating pediatric behavioral health conditions. In conclusion, ChatGPT has the potential to support pediatric behavioral health in a number of ways. By providing mental health professionals, children and adolescents, and parents and caregivers with evidence-based information and guidance, ChatGPT can improve the accessibility and quality of care for pediatric behavioral health conditions. We encourage mental health professionals, parents, and caregivers to explore the use of ChatGPT as a tool for improving pediatric behavioral health. Acknowledgements This editorial was created with the assistance of ChatGPT, an AI language model trained by OpenAI. Author contributions GvS conceived of, wrote, read and approved the final version of the manuscript. Declarations Competing interests The authors declare they have no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
Implement Sci Commun Implement Sci Commun Implementation Science Communications 2662-2211 BioMed Central London 412 10.1186/s43058-023-00412-8 Correction Correction: Implementing an electronic health record dashboard for safe anticoagulant management: learning from qualitative interviews with existing and potential users to develop an implementation process Barnes Geoffrey D. [email protected] 123 Sippola Emily 2 Ranusch Allison 4 Takamine Linda 4 Lanham Michael 5 Dorsch Michael 36 Sales Anne 345 Sussman Jeremy 347 1 grid.214458.e 0000000086837370 Frankel Cardiovascular Center, Department of Internal Medicine, University of Michigan, 2800 Plymouth Rd, B14 G214, Ann Arbor, MI 48109-2800 USA 2 grid.214458.e 0000000086837370 Center for Behavioral and Social Sciences in Medicine, University of Michigan, Ann Arbor, USA 3 grid.214458.e 0000000086837370 Institute for Healthcare Policy and Innovation, University of Michigan, Ann Arbor, USA 4 Center for Clinical Management Research, Ann Arbor Veterans Health Affairs, Ann Arbor, USA 5 grid.214458.e 0000000086837370 Department of Learning Health Sciences, University of Michigan, Ann Arbor, USA 6 grid.214458.e 0000000086837370 College of Pharmacy, University of Michigan, Ann Arbor, USA 7 grid.214458.e 0000000086837370 Division of General Medicine, Department of Internal Medicine, University of Michigan, Ann Arbor, USA 13 3 2023 13 3 2023 2023 4 25(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction: Implement Sci Commun 3, 10 (2022) Following the publication of the original article the authors requested to update the "Competing interests" section as follows: "The authors declare that Anne Sales is co-Editor-in-Chief of the journal." Reference 1. Barnes GD Implementing an electronic health record dashboard for safe anticoagulant management: learning from qualitative interviews with existing and potential users to develop an implementation process Implement Sci Commun 2022 3 10 10.1186/s43058-022-00262-w 35109916 |
Mol Brain Mol Brain Molecular Brain 1756-6606 BioMed Central London 1016 10.1186/s13041-023-01016-y Correction Correction: Requirement for hippocampal CA3 NMDA receptors in artificial association of memory events stored in CA3 cell ensembles Nomoto Masanori [email protected] 123 Ohkawa Noriaki 4 Inokuchi Kaoru [email protected] 123 Oishi Naoya 1235 1 grid.267346.2 0000 0001 2171 836X Research Centre for Idling Brain Science, University of Toyama, Toyama, 930-0194 Japan 2 grid.267346.2 0000 0001 2171 836X Department of Biochemistry, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama, 930-0194 Japan 3 grid.267346.2 0000 0001 2171 836X CREST, JST, University of Toyama, Toyama, 930-0194 Japan 4 grid.255137.7 0000 0001 0702 8004 Division for Memory and Cognitive Function, Research Center for Advanced Medical Science, Comprehensive Research Facilities for Advanced Medical Science, Dokkyo Medical University, Shimotsuga-Gun, Tochigi 321-0293 Japan 5 Present Address: Pharmaceutical Division, Pharmaceutical Research Laboratory, Drug Discovery and Pharmacology Group, Ube Corporation, 1978-5, Kogushi, Ube, Yamaguchi 755-8633 Japan 13 3 2023 13 3 2023 2023 16 29(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction : Molecular Brain (2023) 16:12. Following publication of the original article , the authors identified a typesetting mistake in Fig. 1 (panel B). The correct Fig. 1 is included in this Correction and the original article has been corrected.Fig. 1 Deficit of CA3 NRs impaired in artificial association of memory events by CA3 ensemble activation. a CA3-specific cell ensemble labeling for CA3-NR1 KO mutant and control animals. Mice were injected with the AAV vector and implanted with guide cannulas targeting bilateral CA3 regions. In the absence of doxycycline (Dox), tetracycline transactivator (tTA) binds to the tetracycline-responsive element (TRE) to drive the expression of the target gene specifically in the CA3 region of the hippocampus. Therefore, the subpopulation of cells that expressed Cre recombinase in CA3 and activated during learning will express ChR2-mCherry. AAV injection coordinate and cannula placement targeting CA3 are shown. Gray and white triangles represent loxP and lox2272 sequences, respectively. b Experimental schedule. After bilateral CA3 infection with the AAV, the control or mutant mice were exposed to two events in OFF Dox condition. One day after CFC, the CA3 regions of the control group (n = 12) and mutant group (n = 9) were optically stimulated. Mice were tested for their freezing responses in contexts A and B on 1 and 2 days after the optical stimulation, respectively. c-g Columns showing freezing responses during c pre-exposure session in context A (two-sided unpaired Student's t test: t19 = 1.359, p = 0.1901), d pre-foot shock session during CFC in context B (unpaired Student's t test: t19 = 0.1939, p = 0.8483), e CFC foot shock session in context B (unpaired Student's t test: t19 = 0.09743, p = 0.9234), f test session in context A (unpaired Student's t test: t19 = 2.453, p = 0.024), g test session in context B (unpaired Student's t test: t19 = 1.441, p = 0.1659). h Averaged numbers of ChR2-mCherry-positive cells per section in the CA3 region from control (n = 6) and mutant mice (n = 4) (counted from both left and right CA3 area, two sections/animal, unpaired Student's t test: t8 = 0.2532, p = 0.8065). i, j Representative ChR2-mCherry expression images in CA3 of (i) control and (j) mutant animal. Left, x4 magnification images. Right, x10 magnification images. scale bar, 200 mm. Mice were exposed to the two events for ensembles labeling in the OFF Dox condition. *p < 0.05; n.s., no significant difference between the two groups; error bars are the means +- SEMs The publisher apologises to the authors and readers for the inconvenience caused by the error. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Masanori Nomoto and Naoya Oishi contributed equally Reference 1. Nomoto M Ohkawa N Inokuchi K Oishi N Requirement for hippocampal CA3 NMDA receptors in artificial association of memory events stored in CA3 cell ensembles Mol Brain 2023 16 12 10.1186/s13041-023-01004-2 36670484 |
Microb Cell Fact Microb Cell Fact Microbial Cell Factories 1475-2859 BioMed Central London 2048 10.1186/s12934-023-02048-8 Correction Correction: Medium development and production of carotenoids and exopolysaccharides by the extremophile Rhodothermus marinus DSM16675 in glucose-based defined media Mukti Israt Jahan 1 Sardari Roya R. R. [email protected] 1 Kristjansdottir Thordis 23 Hreggvidsson Gudmundur O. 23 Karlsson Eva Nordberg 1 1 grid.4514.4 0000 0001 0930 2361 Division of Biotechnology, Department of Chemistry, Lund University, Naturvetarvgen 14, 22100 Lund, Sweden 2 grid.425499.7 0000 0004 0442 8784 Matis Ohf, Vinlandsleid 12, 113 Reykjavik, Iceland 3 grid.14013.37 0000 0004 0640 0021 Department of Biology, School of Engineering and Natural Sciences, University of Iceland, Sturlugata 7, 102 Reykjavik, Iceland 13 3 2023 13 3 2023 2023 22 49 The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement The Author(s) 2023 pmc Correction to: Microbial Cell Factories (2022) 21:220 In the original publication of the article , Table 6 has been processed which was already available in the additional file. Hence, the Table 6 has been removed and the Table 7 has been renumbered to Table 6. The original article has been corrected. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Reference 1. Mukti IJ Sardari RRR Kristjansdottir T Hreggvidsson GO Karlsson EN Medium development and production of carotenoids and exopolysaccharides by the extremop Microb Cell Fact 2022 21 220 10.1186/s12934-022-01946-7 36274123 |
World J Surg Oncol World J Surg Oncol World Journal of Surgical Oncology 1477-7819 BioMed Central London 36907886 2980 10.1186/s12957-023-02980-4 Correction Correction: Diagnostic value of an enhanced MRI combined with serum CEA, CA19-9, CA125 and CA72-4 in the liver metastasis of colorectal cancer Zhu Hua-qiang [email protected] 1 Wang Dong-ye 2 Xu Lin-shen 1 Chen Jian-le 1 Chu Er-wei 1 Zhou Cai-jin 1 1 grid.410726.6 0000 0004 1797 8419 Department of Medical Imaging, University of Chinese Academy of Sciences, Shenzhen Hospital (Guangming), No. 4253 of Pine White Rd, Guangming District, Shenzhen, 518106 Guangdong Province China 2 grid.412536.7 0000 0004 1791 7851 Department of Radiology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, 510120 Guangdong Province China 13 3 2023 13 3 2023 2023 21 92 The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement The Author(s) 2023 pmc Correction: World J Surg Onc 20, 401 (2022) Following publication of the original article , the authors identified an error in the maintext of the article. Please see below for the changes in bold.From To A retrospective study was conducted to select patients with colorectal cancer diagnosed by surgery and pathology in the University of Chinese Academy of Sciences Shenzhen Hospital (Guangming) from January 2016 to December 2020 by convenient sampling. A retrospective study was conducted to select patients with colorectal cancer diagnosed by surgery and pathology in the University of Chinese Academy of Sciences Shenzhen Hospital (Guangming) and Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2016 to December 2020 by convenient sampling. The patients with liver metastasis diagnosed by positron emission tomography (PET CT) within 3 months after the frst operation were selected as the liver metastasis group (n=167). The patients with liver metastasis diagnosed by Spiral computer tomography ( CT ) within 3 months after the frst operation were selected as the liver metastasis group (n=167). During the examination, the patients were placed in the supine position and scanned using a 3.0T super conducting magnetic resonance scanner (Germany Siemens). During the examination, the patients were placed in the supine position and scanned using a 1.5T and 3.0T superconducting magnetic resonance scanner (Germany Siemens). The original article has been updated. Reference 1. Zhu HQ Wang DY Xu LS Diagnostic value of an enhanced MRI combined with serum CEA, CA19-9, CA125 and CA72-4 in the liver metastasis of colorectal cancer World J Surg Onc 2022 20 401 10.1186/s12957-022-02874-x |
Am J Clin Pathol Am J Clin Pathol ajcp American Journal of Clinical Pathology 0002-9173 1943-7722 Oxford University Press US 36622333 10.1093/ajcp/aqac156 aqac156 Editorials AcademicSubjects/MED00690 Let's Modernize Public Health Care Data Kaufman Harvey W MD, MBA From Quest Diagnostics, Secaucus, NJ, USA Corresponding author: Harvey W. Kaufman; [email protected]. 3 2023 09 1 2023 09 1 2023 159 3 207208 (c) American Society for Clinical Pathology, 2023. 2022 This is an Open Access article distributed under the terms of the Creative Commons Attribution License ), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDr Rochelle P. Walensky, Director of the Centers for Disease Control and Prevention (CDC), has challenged the CDC to be reestablished as the premier public health agency charged with protecting the United States from health, safety, and security threats.1 Part of the CDC challenge is to modernize the approach to collect and analyze health care data, including clinical laboratory results. Dr Walensky succinctly stated the need for the CDC to "share scientific findings and data faster."1 The coronavirus disease 2019 (COVID-19) pandemic taught us the value of daily collecting and sharing such data more quickly (ie, information from the prior day's laboratory testing, reported cases, hospitalizations, deaths, and vaccinations). National severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) seroprevalence studies of communities, supported by the CDC, provided timely insights that seropositivity was far higher than case report data suggested.2 Weekly SARS-CoV-2 genotyping data, supported by the CDC, provided national and regional trends in the prevalence of viral variants.3,4 Likewise, the CDC provided timely weekly data updates on monkeypox that are valuable in tracking disease spread and control.5 Often stated, 70% of health care decisions involve clinical laboratory testing. Clinical laboratory data are vital to gain a better epidemiologic understanding of clinically significant conditions from a public health perspective (eg, COVID-19, emerging infections, sexually transmitted infections, pediatric lead poisoning, and numerous other health conditions). The core source of many CDC epidemiologic reports remains the National Health and Nutrition Examination Survey (NHANES), which has provided crucial insights into the health status of the US population since its first survey in 1971.6 Over time, NHANES expanded into an examination of a multitude of health conditions. Unfortunately, the NHANES survey process has failed to meet our current needs of timely, large-scale integrated health care data. The NHANES survey process relies on data from several thousand volunteers selected annually from 15 of the more than 3,000 counties in the United States. The five major components include a household questionnaire, a medical history questionnaire, dietary questionnaires, a physical examination by a physician, and special clinical procedures and tests, including x-rays and clinical laboratory testing. In addition, the CDC also regularly collates data provided by public health agencies, generally of varying quality and completeness and with sometimes long delays (years) prior to report release. Despite improvements, NHANES fails to meet our current needs for timely, large-scale, integrated health care data. The burden for participant selection and the onus of participation tend to bias the sample and the observations. The nutritional assessments have long been criticized as imperfect.7 Timeliness is a vital consideration. Presentation of NHANES data years after their generation does not support the goals of the CDC revitalization. For illustrative examples, publication of pediatric lead poisoning by the CDC exemplifies the deficiencies with the current CDC and NHANES reporting processes. The CDC compiles pediatric blood lead reports from state and territorial health departments that may be incomplete and delayed. The most recent state data presented by the CDC cover only 28 states and the District of Columbia from 2012 to 2018 and 10 additional states with 2018 data.8 The CDC 2021 recommended blood lead reference level is based on the 97.5th percentile of the blood lead values among US children aged 1 through 5 years from the 2015 to 2016 and 2017 to 2018 NHANES cycles. Yet the most recent publication of NHANES pediatric lead (2021) data extends only through 2016.9 The 2011 to 2016 NHANES data included only 2,321 valid blood lead level results or fewer than 400 per year. Thus, the current CDC blood lead reference value is based on the equivalent of just 58 children, with results above this value including children tested as early as 2015. A better system for collection and timely publication of such blood lead data would be to use clinical data sets produced by our clinical laboratories. As an example, a study of pediatric lead included more than 1 million results from all 50 states and the District of Columbia and overlaid several social determinants of health such as old housing stock, poverty rates, and race/ethnicity.10 Although only the shortcoming for timely blood lead result reporting by national public health agencies is highlighted here, additional examples abound that shine light on the flaws in continuing to employ historical NHANES processes as a keystone for public health reporting and policy recommendations. Large health care organizations, including Aetna CVS Health, Cerner, Epic, HealthVerity, IQIVA, Kaiser Permanente, LabCorp, Optum, and Quest Diagnostics, have access to many billions of health care datapoints annually from most Americans. The data are current and can be integrated with a vast amount of health care and non-health care information to allow for timely and effective reporting. Early deviations from expected patterns may offer the canaries in the coal mine, timely signals of improvements or deterioration in health or of emerging infections. Key performance metrics may be used to quickly allocate funds where most needed. Extensive efforts such as the Systemic Harmonization and Interoperability Enhancement for Laboratory Data collaborative, led by the US Food and Drug Administration and involving many other parties, are needed to normalize the data for use.11 Indeed, all clinical laboratories generate useful data that could be transmitted securely and efficiently to provide insights reflecting patterns of disease and disease risk for every community in the country. The core of such a system exists. Public health reporting through the Association of Public Health Laboratories AIMS (APHL Informatics Messaging System) facilitates the secure and efficient exchange of public health data from clinical laboratories to public health agencies and among public health agencies.12 Among its achievements is aggregating influenza test results from public health laboratories to the CDC and biological threat data from laboratories within the laboratory response network to the CDC. This platform can be expanded to enable all clinical laboratories to provide timely data to public health agencies and, where permitted, to academics for research of public health issues. In summary, the CDC should develop partnerships with large health care organizations with enormous coverage of health care data and other complementary non-health care data sources. And ultimately, all clinical laboratories should participate. With appropriate privacy protections, integrating these data with data such as on living conditions, in near real time, can provide timely insights into emerging infections, pockets of disease and modifiable disease risks (including insufficient vaccination rates), trends in our health, and evaluations of the effectiveness of interventions to improve population health. The CDC's mission is "serving the public through timely action and impact."1 Let's modernize public health care data. Disclosure: Harvey W. Kaufman is an employee of and owns stock in Quest Diagnostics. References 1. Centers for Disease Control and Prevention. Mission, role and pledge: about CDC. Accessed September 14, 2022. 2. Bajema KL , DahlgrenFS, LimTW, et al . Comparison of estimated severe acute respiratory syndrome coronavirus 2 seroprevalence through commercial laboratory residual sera testing and a community survey. Clin Infect Dis. 2021;73 :e3120-e3123.33300579 3. Centers for Disease Control and Prevention. SARS-CoV-2 Sequencing for Public Health Emergency Response, Epidemiology, and Surveillance: SPHERES. Accessed October 22, 2022. 4. Centers for Disease Control and Prevention. CDC COVID data tracker: summary of variant surveillance. Accessed October 22, 2022. 5. Centers for Disease Control and Prevention. 2022 U.S. map & case count: monkeypox | poxvirus | CDC. Accessed September 14, 2022. 6. Centers for Disease Control and Prevention. NHANES National Health and Nutrition Examination Survey homepage (cdc.gov). Accessed October 22, 2022. 7. Archer E , HandGA, BlairSN. Validity of U.S. nutritional surveillance: National Health and Nutrition Examination Survey caloric energy intake data, 1971-2010. PLoS One. 2013;8 :e76632.24130784 8. Centers for Disease Control and Prevention. CDC national childhood blood lead surveillance data. Accessed September 14, 2022. 9. Egan KB , CornwellCR, CourtneyJG, et al . Blood lead levels in U.S. children ages 1-11 years, 1976-2016. Environ Health Perspect. 2021;129 :37003.33730866 10. Hauptman M , NilesJK, GudinJ, et al . community-level factors associated with detectable and elevated blood lead levels in US children: results from a national clinical laboratory. JAMA Pediatr. 2021;175 :1252-1260.34570188 11. US Department of Health and Human Services. SHIELD Standardization of Lab Data to Enhance Patient-Centered Outcomes Research and Value-Based Care: ASPE (hhs.gov). Accessed September 14, 2022. 12. Association of Public Health Laboratories. AIMS platform (aphl.org). Accessed October 22, 2022. |
Front Oncol Front Oncol Front. Oncol. Frontiers in Oncology 2234-943X Frontiers Media S.A. 10.3389/fonc.2023.1153803 Oncology Editorial Editorial: GBM stem cells and the brain tumor microenvironment Li Yunqing 1 2 * Abounader Roger 3 4 5 1 Hugo W. Moser Research Institute at Kennedy Krieger, Baltimore, MD, United States 2 Department of Neurology, The Johns Hopkins University School of Medicine, Baltimore, MD, United States 3 Department of Microbiology, Immunology and Cancer Biology, University of Virginia, Charlottesville, VA, United States 4 Department of Neurology, University of Virginia, Charlottesville, VA, United States 5 University of Virginia National Cancer Institute (NCI)-Designated Comprehensive Cancer Center, Charlottesville, VA, United States Edited and Reviewed by: David D. Eisenstat, Royal Children's Hospital, Australia *Correspondence: Yunqing Li, [email protected] This article was submitted to Neuro-Oncology and Neurosurgical Oncology, a section of the journal Frontiers in Oncology 24 2 2023 2023 13 115380330 1 2023 07 2 2023 Copyright (c) 2023 Li and Abounader 2023 Li and Abounader This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic GBM stem cells and the brain tumor microenvironment GSC intrinsic mechanisms GBM TME GBM stem-like cells GBM heterogeneity interactions between GSCs and the GBM TME This article was supported by NIH UO1 CA220841, the NCI Cancer Center Support Grant 5P30CA044579, and NIH NINDS 1R21NS122136-01 (all to RA). And NIH grants NS096754 (John Laterra) and NS110087 (John Laterra). pmcA small subset of tumor cells has been identified in glioblastoma (GBM). These cells have the capacity for unlimited self-renewal, multi-lineage differentiation, chemotherapy/radiation resistance, and efficiently propagating tumors in xenograft models. An increasing number of genomic, epigenomic, transcriptomic profiling, and experimental studies have demonstrated that these stem-like tumor-propagating GBM cells (GBM stem cells, GSCs) are associated with the GBM heterogeneity and GBM immunosuppressive microenvironment (TME) leading to maintaining GBM growth, therapeutic resistance, and GBM recurrence. Understanding the interactions of GSCs and GBM heterogeneity and the GBM TME and targeting these interactions could have a tremendous impact on GBM treatment. However, our current understanding of how GSCs modulate GBM heterogeneity and GBM TME and their interactions is limited and inadequate. This Research Topic of Frontiers in Oncology focuses on understanding and targeting the interactions between GSCs and GBM cellular heterogeneity and GBM microenvironment. We collected six interesting articles including 2 original research papers and 4 review papers. Two review articles and two original research articles focused on understanding GSC intrinsic genetic mechanisms contributing to the induction of GBM heterogeneity and GBM immunosuppressive microenvironment. They show and discuss GSCs as key contributors in recruiting pro-tumor immune cells, leading to the formation a GBM immunosuppressive microenvironment. The paper from Johnson et. al. comprehensively summarized recent advances in our understanding of how the drivers of GSC plasticity and heterogeneity (e.g., transcription factors, histone modifications, DNA and RNA methylation, metabolic reprogramming) modulate the GBM tumor immunosuppressive microenvironment (TIME). The paper also discussed recent advances in our understanding of GSC-intrinsic mechanisms that modulate GSC-TIME interactions and presented cutting-edge techniques and bioinformatics platforms that are available to study immune modulation at high cellular resolution for the exploration of both malignant (i.e., GSC) and non-malignant (i.e., immune) cell fractions. The article highlighted GSC-intrinsic mechanisms, including functional mimicry of immune suppressive cell types as determinants of anti-tumor immune escape and therapeutic approaches for targeting immunomodulatory GSC-intrinsic mechanisms to potentiate immunotherapy responses in gliomas. A similarly interesting paper from Silver et al. discussed the diversity of GSCs with distinct characteristics presented in GBM and how GSC diversity drives global intratumoral heterogeneity constituted by complex and spatially distinct local microenvironments. It also discussed how to map this intricate GBM ecosystem through the lens of metabolism and immunology to find vulnerabilities and new ways to disrupt the equilibrium of the system to achieve improved disease outcomes. Two original research articles from Ren et al. and Yang et al., separately show that dysregulated gene expression in GSCs regulates immune cell infiltration and alters the GBM TME. Ren et al.'s paper showed that non-SMC condensin II complex subunit G2 (NCAPG2) was highly expressed in GSCs and knockdown of NCAPG2 significantly inhibited the self-renewal ability of GSC. The functional annotation showed that NCAPG2 was mainly involved in the immune response and the Wnt signaling pathway. Increased expression of NCAPG2 was correlated with infiltration levels of various immune cells and immune checkpoint in glioma. Yang et al.'s paper studied the biological function and clinical characterization of nine minichromosome maintenance protein members (MCM) in low-grade glioma using diverse public databases. The data showed that MCM family members were consistently up-regulated in glioma tissues and glioma cell lines and higher expression of MCM2-MCM8 and MCM10 was linked with poor overall survival (OS) and shorter disease-specific survival (DSS) in glioma patients. Functional enrichment analysis indicated that MCMs mainly participated in regulating cell cycle and DNA replication. DNA copy number variation (CNV) and DNA methylation significantly affect the expression of MCMs. Importantly, MCMs expression was highly correlated with immune cell infiltration, immune modulator, tumor mutational burden (TMB), and drug sensitivity. Two other interesting review articles focus on understanding GSC non-genetic factors contributing to the regulation of GBM heterogeneity and GBM TME. The review paper by Wang et al. discussed a subpopulation of GBM cells with tumor microtubes (TMs) identified in GBM. This TM-positive GBM subpopulation expresses neural stem cell markers and shares many features with both immature neurons and cancer stem cells. The authors discussed the common features between TM and sprouting axons in morphology, formation, and function. This review article provides a new angle to understand the roles of TM-positive GBM cell subsets in resistance and recurrence mechanisms, the incurability and heterogeneity of gliomas, and current potential therapeutic strategies for targeting TM. Another review article by Akindona et al. discussed the relationship between the nonmalignant neural and hematopoietic stem cell niches and cancer stem cell niche, and hypothesized that the signaling pathways involved in the development and maintenance of the NSC and HSC niches may provide the development of the GSC niche. They discussed the role of angiogenesis as a potential component of GSC niche development and provide a hypothesis for its development in GBM. Targeting vessel co-option mechanisms may prove to be an effective strategy for targeting tumor vascularization, perhaps in conjunction with anti-VEGF therapy. The authors point out that a better understanding of the mechanisms of development of the tumor stem-like cell niche may provide new insights that could be amenable to therapeutic exploitation. Altogether, this Research Topic of Frontiers in Oncology emphasizes GSC intrinsic mechanisms including genetic alterations (e.g. gene mutation, gene copy number alteration, gene translocation, and epigenetic modification, etc.) and non-genetic factors (e.g., tumor microtubes) that contribute to the induction of GBM heterogeneity and regulation of the GBM microenvironment including cellular and non-cellular components. The issue also describes advanced technologic platforms that are available to study dynamic interactions between GSCs and the GBM TME. The overall findings suggest new avenues for the therapeutic exploitation and targeting of the above interactions with new potential GBM therapies. Author contributions Writing, Review, and Editing: YL and RA. All authors contributed to the article and approved the submitted version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Plant Sci Front Plant Sci Front. Plant Sci. Frontiers in Plant Science 1664-462X Frontiers Media S.A. 10.3389/fpls.2023.1163471 Plant Science Correction Corrigendum: Integrated transcriptomics and miRNAomics provide insights into the complex multi-tiered regulatory networks associated with coleoptile senescence in rice Sasi Jyothish Madambikattil 1 VijayaKumar Cheeni 1 Kukreja Bharti 2 Budhwar Roli 3 Shukla Rohit Nandan 3 Agarwal Manu 2 Katiyar-Agarwal Surekha 1 * 1Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India 2Department of Botany, University of Delhi, Delhi, India 3Bionivid Technology Pvt. Limited, Bengaluru, Karnataka, India Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Surekha Katiyar-Agarwal, [email protected]; [email protected] This article was submitted to Plant Physiology, a section of the journal Frontiers in Plant Science 27 2 2023 2023 27 2 2023 14 116347110 2 2023 17 2 2023 Copyright (c) 2023 Sasi, VijayaKumar, Kukreja, Budhwar, Shukla, Agarwal and Katiyar-Agarwal 2023 Sasi, VijayaKumar, Kukreja, Budhwar, Shukla, Agarwal and Katiyar-Agarwal This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A Corrigendum on Integrated transcriptomics and miRNAomics provide insights into the complex multi-tiered regulatory networks associated with coleoptile senescence in rice. by Sasi JM, VijayaKumar C, Kukreja B, Budhwar R, Shukla RN, Agarwal M and Katiyar-Agarwal S (2022) Front. Plant Sci. 13:985402. doi: 10.3389/fpls.2022.985402 rice coleoptile senescence transcriptome miRNAs regulation pmcIn the published article, there was an error in the Funding statement. The Funding statement previously said: "The financial support from University Grants Commission (sanction order # 41-512/2012), Government of India; Department of Biotechnology, Government of India and Faculty Research Programme (Institute of Eminence), University of Delhi (sanction order # IOE/FRP/LS/2020/27) are acknowledged. JMS and CV are thankful to UGC for Basic Science Research (BSR) fellowships.". The corrected Funding statement appears below: The financial support from University Grants Commission (sanction order # 41-512/2012), Government of India; Department of Biotechnology, Government of India and Faculty Research Programme (Institute of Eminence), University of Delhi (sanction orders # IoE/FRP/2020/27 and IoE/2021/12/FRP) are acknowledged. JMS and CV are thankful to UGC for Basic Science Research (BSR) fellowships. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Aging Neurosci Front Aging Neurosci Front. Aging Neurosci. Frontiers in Aging Neuroscience 1663-4365 Frontiers Media S.A. 10.3389/fnagi.2023.1073356 Aging Neuroscience Correction Corrigendum: PMCA-based detection of prions in the olfactory mucosa of patients with sporadic Creutzfeldt-Jakob disease Cazzaniga Federico Angelo 1 Bistaffa Edoardo 1 De Luca Chiara Maria Giulia 1 2 Portaleone Sara Maria 3 Catania Marcella 1 Redaelli Veronica 1 Tramacere Irene 4 Bufano Giuseppe 1 Rossi Martina 2 + Caroppo Paola 1 Giovagnoli Anna Rita 1 Tiraboschi Pietro 1 Di Fede Giuseppe 1 Eleopra Roberto 5 Devigili Grazia 5 Elia Antonio Emanuele 5 Cilia Roberto 5 Fiorini Michele 6 Bongianni Matilde 6 Salzano Giulia 2 + Celauro Luigi 2 Quarta Federico Giuseppe 3 Mammana Angela 7 Legname Giuseppe 2 Tagliavini Fabrizio 8 Parchi Piero 7 9 Zanusso Gianluigi 6 Giaccone Giorgio 1 Moda Fabio 1 * 1Unit of Neurology 5 and Neuropathology, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 2Department of Neuroscience, Scuola Internazionale Superiore di Studi Avanzati (SISSA), Trieste, Italy 3Department of Health Sciences, Otolaryngology Unit, ASST Santi Paolo e Carlo Hospital, Universita degli Studi di Milano, Milan, Italy 4Department of Research and Clinical Development, Scientific Directorate, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 5Unit of Neurology 1 - Parkinson's and Movement Disorders Unit, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 6Department of Neurosciences, Biomedicine and Movement Sciences, University of Verona, Verona, Italy 7IRCCS, Istituto delle Scienze Neurologiche di Bologna (ISNB), Bologna, Italy 8Scientific Directorate, Fondazione IRCCS Istituto Neurologico Carlo Besta, Milan, Italy 9Department of Diagnostic Experimental and Specialty Medicine (DIMES), University of Bologna, Bologna, Italy Edited and reviewed by: Rodrigo Morales, University of Texas Health Science Center at Houston, United States *Correspondence: Fabio Moda [email protected] This article was submitted to Alzheimer's Disease and Related Dementias, a section of the journal Frontiers in Aging Neuroscience +Present addresses: Martina Rossi, Department of Biotechnology, Chemistry and Pharmacy, University of Siena, Siena, Italy Giulia Salzano, Institute of Molecular, Cell and Systems Biology, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, United Kingdom 27 2 2023 2023 27 2 2023 15 107335618 10 2022 13 2 2023 Copyright (c) 2023 Cazzaniga, Bistaffa, De Luca, Portaleone, Catania, Redaelli, Tramacere, Bufano, Rossi, Caroppo, Giovagnoli, Tiraboschi, Di Fede, Eleopra, Devigili, Elia, Cilia, Fiorini, Bongianni, Salzano, Celauro, Quarta, Mammana, Legname, Tagliavini, Parchi, Zanusso, Giaccone and Moda. 2023 Cazzaniga, Bistaffa, De Luca, Portaleone, Catania, Redaelli, Tramacere, Bufano, Rossi, Caroppo, Giovagnoli, Tiraboschi, Di Fede, Eleopra, Devigili, Elia, Cilia, Fiorini, Bongianni, Salzano, Celauro, Quarta, Mammana, Legname, Tagliavini, Parchi, Zanusso, Giaccone and Moda This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on PMCA-based detection of prions in the olfactory mucosa of patients with sporadic Creutzfeldt-Jakob disease by Cazzaniga, F. A., Bistaffa, E., De Luca, C. M. G., Portaleone, S. M., Catania, M., Redaelli, V., Tramacere, I., Bufano, G., Rossi, M., Caroppo, P., Giovagnoli, A. R., Tiraboschi, P., Di Fede, G., Eleopra, R., Devigili, G., Elia, A. E., Cilia, R., Fiorini, M., Bongianni, M., Salzano, G., Celauro, L., Quarta, F. G., Mammana, A., Legname, G., Tagliavini, F., Parchi, P., Zanusso, G., Giaccone, G., and Moda, F. (2022). Front. Aging Neurosci. 14:848991. doi: 10.3389/fnagi.2022.848991 Creutzfeldt-Jakob disease olfactory mucosa protein misfolding cyclic amplification neurodegeneration prion peripheral biomarker pmcIn the published article, there was an error in Figure 5 as published. In particular, the Western blot showed in the original Figure 5D related to the 1st round of PMCA of patient 19 (19_BH) was mistakenly selected and has now been replaced with the correct one. The corrected Figure 5D and its caption appear below. Figure 5 Quantitative PMCA (qPMCA) for estimating PrPres concentration in OM samples of sCJD patients. (A) Serial dilutions of recombinant full-length human PrP (recHuPrP23 - 231) were used to estimate prion concentration in the brain of sCJD patients. (B) Serial dilutions of sCJD brain homogenates subjected to PK and PNGase treatments before Wb analysis. Quantitative PMCA to estimate PrPres concentration in OM of (C) MM1, (D) MV2, and (E) VV2 patients. Specific rounds at which every OM PrPres was detected (3rd for the MM1 and one VV2, 5th for one MV2 and one VV2, and 6th for one MV2) are shown. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Neurol Front Neurol Front. Neurol. Frontiers in Neurology 1664-2295 Frontiers Media S.A. 10.3389/fneur.2023.1156059 Neurology Correction Corrigendum: Lumboperitoneal shunt surgery via continuous two-stage procedure: Technique notes and outcomes Li Zhao 1 + Wang Hao 2 + Zhang Han 3 Yang Jiqi 2 Yang Xiaofeng 2 * Wen Liang 2 * 1Shengzhou Hospital of Traditional Chinese Medicine, Shengzhou, China 2First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, China 3Shengzhou People's Hospital, First Affiliated Hospital, School of Medicine, Zhejiang University, Shengzhou, China Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Liang Wen [email protected] Xiaofeng Yang [email protected] This article was submitted to Neurotrauma, a section of the journal Frontiers in Neurology +These authors have contributed equally to this work 27 2 2023 2023 27 2 2023 14 115605901 2 2023 09 2 2023 Copyright (c) 2023 Li, Wang, Zhang, Yang, Yang and Wen. 2023 Li, Wang, Zhang, Yang, Yang and Wen This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on Lumboperitoneal shunt surgery via continuous two-stage procedure: Technique notes and outcomes by Li, Z., Wang, H., Zhang, H., Yang, J. Q., Yang, X. F., and Wen, L. (2022). Front. Neurol. 13:1059316. doi: 10.3389/fneur.2022.1059316 hydrocephalus lumboperitoneal shunt rehabilitation shunt implantation cerebrospinal fluid This work was supported by Medical Health Science and Technology Project of Zhejiang Provincial Health Commission (2021KY1169), the Basic Public Welfare Research Program of Zhejiang Province (LGF21H090010), and the National Natural Science Foundation of China (NFSC No. 81971159).The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. pmcIn the published article, there was an error in the Funding statement. The incorrect funding number was used for the Medical Health Science and Technology Project of Zhejiang Provincial Health Commission. The correct Funding statement appears below. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
J Vasc Bras J Vasc Bras jvb Jornal Vascular Brasileiro 1677-5449 1677-7301 Sociedade Brasileira de Angiologia e de Cirurgia Vascular (SBACV) jvbCE20220101_EN 00901 10.1590/1677-5449.202201012 Letter to the Editor Double-edged sword effect of platelets in COVID-19 Efeito "faca de dois gumes" das plaquetas na COVID-19 Jadali Zohreh 1 1 Tehran University of Medical Sciences, School of Public Health, Department of Immunology, Tehran, Iran. Conflicts of interest: No conflicts of interest declared concerning the publication of this article. Correspondence Zohreh Jadali Tehran University of Medical Sciences, School of Public Health, Department of Immunology P.O. Box 6446 - Tehran 14155, Iran Tel.: +98 21 6462268-6465404 E-mail: [email protected]; [email protected] Author information ZJ - PhD in Immunology, Tehran University of Medical Sciences. 06 3 2023 2023 22 e20220101Copyright(c) 2023 The authors 2023 The authors. Copyright(c) 2023 The authors. This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDear Editor, With interest we read the article by Sobreira et al. about the thromboembolic complications of COVID-19 vaccines.1 This study has important implications, but no mention is made regarding these complications in COVID-19 patients. It is therefore necessary to discuss this topic and possible pathogenic mechanisms. Coagulopathy is a common feature of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and its incidence increases in severe cases.2 The mechanisms of thrombotic events are multifactorial and platelets play a major role in this phenomenon. Beyond hemostasis and thrombosis, platelets are also capable of sensing and responding to invading pathogen and immune signals.3 Virus-platelet interactions may serve as part of the immune response or of viral counterdefense strategies. Platelets can interact with and respond to viruses via different mechanisms including phagocytosis and production of antiviral molecules. Conversely, they can also shelter several viruses and increase their transport ability throughout the circulation. Virus-mediated activation of platelets may also activate release of various pro-inflammatory mediators which lead to development of virus-induced immunopathology.4 Both positive and negative effects depend on the interaction between viral proteins and host cell receptors. Interactions can occur directly via various immune receptors in platelets or indirectly through plasma proteins. Platelets also express angiotensin-converting enzyme 2 (ACE2) which serves as the primary receptor for SARS-CoV-2 and facilitates virus entry into host cells.5 COVID-19 thrombotic complications may be the result of direct or indirect impacts of viral infection. SARS-CoV-2 can directly activate ACE2 and potentiates platelet activation. Moreover, the SARS-CoV-2 spike protein enhances the potential of thrombosis and recombinant human ACE-2 protein can suppress virus-induced platelet activation. The virus can also directly induce platelet releasing coagulation factors and inflammatory cytokines and increases formation of leukocyte-platelet aggregates. Platelets may also be activated indirectly, through sensing of an inflammatory microenvironment and subsequent dysfunction of vascular endothelium, which are induced by viral infection. The inflammatory milieu may cause uncontrolled platelet activation which consecutively may lead to pathophysiological effector activities. Moreover, immune complex containing viral particles may impact on the platelet hyperactivity in COVID19 patients.6 Altogether, platelets may be affected by SARS-CoV-2. Therefore, understanding of the underlying mechanisms can be beneficial in promoting assessment and treatment of COVID-19 patients. Response Letter Covid-19 vaccines and thromboembolic complications Sobreira Marcone Lima 1 Ramacciotti Eduardo 2 Paschoa Adilson Ferraz 3 Matielo Marcelo Fernando 4 Casella Ivan Benaduce 4 Yazbek Guilherme 4 Soares Raphael de Athayde 5 van Bellen Bonno 6 Marques Marcos Areas 7 8 1 Universidade Estadual Paulista "Julio de Mesquita Filho" - UNESP, Botucatu, SP, Brasil. 2 Loyola University Chicago, Chicago, IL, EUA. 3 Universidade Estadual de Campinas - UNICAMP, Campinas, SP, Brasil. 4 Universidade de Sao Paulo - USP, Sao Paulo, SP, Brasil. 5 Hospital do Servidor Publico Estadual de Sao Paulo, Sao Paulo, SP, Brasil. 6 Real e Benemerita Associacao Portuguesa de Beneficencia de Sao Paulo, Sao Paulo, SP, Brasil. 7 Universidade Federal do Estado do Rio de Janeiro - UNIRIO, Rio de Janeiro, RJ, Brasil. 8 Universidade do Estado do Rio de Janeiro - UERJ, Rio de Janeiro, RJ, Brasil. Correspondence Marcos Areas Marques Universidade do Estado do Rio de Janeiro - UERJ Rua Assuncao, 217/704 - Botafogo CEP 22251-030 - Rio de Janeiro (RJ), Brasil Tel.: +55 (21) 99859-0160 E-mail: [email protected] Dear Editor, We would like to thank you for the important points on the topic of our article about thromboembolic complications of COVID-19 vaccines, which are quite relevant and help update knowledge on the issue. The interactions described in relation to the pathophysiological role of platelets in activating the alleged potential thrombotic trigger are initiated by vaccine-induced thrombocytopenia, as occurs with thrombotic predisposition accompanying infection caused by COVID19. Much remains to be discovered about the pathophysiology of COVID-19 infection, particularly the potential predisposition to thrombotic events. Thank you for sharing this data about complex platelet mechanisms and interactions that enhances the content of our article and helps us to understand and clarify the best assessment and treatment of COVID-19 patients. Covid-19 vaccines and thromboembolic complications How to cite: Jadali Z. Double-edged sword effect of platelets in COVID-19. J Vasc Bras. 2023;22:e20220101. Financial support: None. Author information MLS - Tenured professor, Cirurgia Vascular e Endovascular, Universidade Estadual Paulista "Julio de Mesquita Filho" (UNESP). ER - Invited professor of Trombose e Hemostasia, Universidade de Loyola. AFP - PhD in Ciencias Medicas, Universidade Estadual de Campinas (UNICAMP). MFM and GY - PhD in Medicina, Universidade de Sao Paulo (USP). IBC - Tenured professor of Cirurgia Vascular, Faculdade de Medicina, Universidade de Sao Paulo (USP). RAS - Preceptor, Servico de Residencia Medica em Cirurgia Vascular e Endovascular, Hospital do Servidor Publico Estadual de Sao Paulo. BVB - Chief, Servico de Cirurgia Vascular e Angiologia, Real e Benemerita Associacao Portuguesa de Beneficencia de Sao Paulo. MAM - Physician, Unidade Docente Assistencial de Angiologia do HUPE - UERJ and Servico de Cirurgia Vascular, Hospital Universitario Gaffree e Guinle, Universidade Federal do Estado do Rio de Janeiro (UNIRIO). REFERENCES 1 Sobreira ML Ramacciotti E Paschoa AF et al Covid-19 vaccines and thromboembolic complications J Vasc Bras 2021 20 e20210167 10.1590/1677-5449.210167 34925476 2 Wool GD Miller JL The impact of COVID-19 disease on platelets and coagulation Pathobiology 2021 88 1 15 27 10.1159/000512007 33049751 3 Middleton EA Weyrich AS Zimmerman GA Platelets in pulmonary immune responses and inflammatory lung diseases Physiol Rev 2016 96 4 1211 1259 10.1152/physrev.00038.2015 27489307 4 Assinger A Platelets and infection: an emerging role of platelets in viral infection Front Immunol 2014 5 649 10.3389/fimmu.2014.00649 25566260 5 Zhang S Liu Y Wang X et al SARS-CoV-2 binds platelet ACE2 to enhance thrombosis in COVID-19 J Hematol Oncol 2020 13 1 120 10.1186/s13045-020-00954-7 32887634 6 Ahmadi E Bagherpour Z Zarei E Omidkhoda A Pathological effects of SARS-CoV-2 on hematological and immunological cells: Alterations in count, morphology, and function Pathol Res Pract 2022 231 153782 10.1016/j.prp.2022.153782 35121363 |
Codas Codas codas CoDAS 2317-1782 Sociedade Brasileira de Fonoaudiologia codasER20200324_PT 00901 10.1590/2317-1782/20212022159en Erratum ERRATUM: MMBGR Protocol - infants and preschoolers: instructive and orofacial myofunctional clinical history 06 1 2023 2023 06 1 2023 35 1 e20220159 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDue to author's honest mistake the article "MMBGR Protocol - infants and preschoolers: instructive and orofacial myofunctional clinical history" (DOI ), published in CoDAS 2022;34(2):e20200324, was published with errors. On Portuguese title, where the text reads: Protocolo MMBRG - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial It should read: Protocolo MMBGR - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial On English version on pages 4, 8, 9 and 12, where the text reads: Pasty It should read: Pudding The authors apologize for the errors. codasER20200324_EN 10.1590/2317-1782/20212022159pt Errata ERRATA: Protocolo MMBGR - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial Este e um artigo publicado em acesso aberto (Open Access) sob a licenca Creative Commons Attribution , que permite uso, distribuicao e reproducao em qualquer meio, sem restricoes desde que o trabalho original seja corretamente citado. Devido ao erro honesto dos autores, o artigo "Protocolo MMBRG - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial" (DOI ), publicado em CoDAS 2022;34(2):e20200324, foi publicado com erros. No titulo em portugues, onde se le: Protocolo MMBRG - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial Leia-se: Protocolo MMBGR - lactentes e pre-escolares: instrutivo e historia clinica miofuncional orofacial Na versao em ingles, nas paginas 4, 8, 9 e 12, onde se le: Pasty Leia-se: Pudding Os autores pedem desculpas pelos erros. |
Codas Codas codas CoDAS 2317-1782 Sociedade Brasileira de Fonoaudiologia codasER20200325_PT 00902 10.1590/2317-1782/20212022190en Erratum ERRATUM: MMBGR Protocol - infants and preschoolers: myofunctional orofacial clinic examination 06 1 2023 2023 06 1 2023 35 1 e20220190 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDue to author's honest mistake the article "MMBRG Protocol - infants and preschoolers: myofunctional orofacial clinic examination" (DOI ), published in CoDAS 2022;34(5):e20200325, was published with errors. On Portuguese title, where the text reads: Protocolo MMBRG - lactentes e pre-escolares: exame clinico miofuncional orofacial It should read: Protocolo MMBGR - lactentes e pre-escolares: exame clinico miofuncional orofacial On English title, where the text reads: MMBRG Protocol - infants and preschoolers: myofunctional orofacial clinic examination It should read: MMBGR Protocol - infants and preschoolers: myofunctional orofacial clinic examination On English version on pages 3, 4, 10, 11, 13 and 15, where the text reads: Pasty It should read: Pudding On English version on page 11, in the first chart "Pasty swallowing" where the text reads: Lip movement: (0) adequate (move upper lip to remove food from spoon) (1) few (exaggerated) (1) exaggerated It should read: Lip movement: (0) adequate (move upper lip to remove food from spoon) (1) few (1) exaggerated On English version on page 11, in the second chart where the text reads: Pasty swallowing (do not use a bottle to assess) It should read: Liquid swallowing (do not use a bottle to assess) The authors apologize for the errors. codasER20200325_EN 10.1590/2317-1782/20212022190pt Errata ERRATA: Protocolo MMBGR - lactentes e pre-escolares: exame clinico miofuncional orofacial Este e um artigo publicado em acesso aberto (Open Access) sob a licenca Creative Commons Attribution , que permite uso, distribuicao e reproducao em qualquer meio, sem restricoes desde que o trabalho original seja corretamente citado. Devido ao erro honesto dos autores o artigo "Protocolo MMBRG - lactentes e pre-escolares: exame clinico miofuncional orofacial" (DOI ), publicado em CoDAS 2022;34(5):e20200325, foi publicado com erros. No titulo em portugues, onde se le: Protocolo MMBRG - lactentes e pre-escolares: exame clinico miofuncional orofacial Leia-se: Protocolo MMBGR - lactentes e pre-escolares: exame clinico miofuncional orofacial No titulo em ingles, onde se le: MMBRG Protocol - infants and preschoolers: myofunctional orofacial clinic examination Leia-se: MMBGR Protocol - infants and preschoolers: myofunctional orofacial clinic examination Na versao em ingles, nas paginas 3, 4, 10, 11, 13 e 15, onde se le: Pasty Leia-se: Pudding Na versao em portugues, pagina 11, no primeiro quadro "Degluticao de pastoso" , onde se le: Movimento dos labios: (0) adequado (move labio superior para remover alimento da colher) (1) pouco (exagerado) (1) exagerado Leia-se: Movimento dos labios: (0) adequado (move labio superior para remover alimento da colher) (1) pouco (1) exagerado Na versao em portugues, pagina 11, no segundo quadro, onde se le: Degluticao de pastoso (nao utilizar mamadeira para avaliar) Leia-se: Degluticao de liquido (nao utilizar mamadeira para avaliar) Os autores pedem desculpas pelos erros. |
Codas Codas codas CoDAS 2317-1782 Sociedade Brasileira de Fonoaudiologia codasER20200264_PT 00903 10.1590/2317-1782/20212022208en Erratum ERRATUM: Treatment clinical trial - three types - for children with fluency disorders and stuttering 10 2 2023 2023 10 2 2023 35 1 e20220208 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDue to technical problems during the editorial production of the article "Treatment clinical trial - three types - for children with fluency disorders and stuttering" (DOI ), published in CoDAS 2022;34(2):e20200264, the English version of this article was published with an error. On page 8 of English version of the article, there should be an acknowledgements section with the following statement: ACKNOWLEDGEMENTS To CAPES, for promoting this research in the form of a Master's Scholarship. codasER20200264_EN 10.1590/2317-1782/20212022208pt Errata ERRATA: Ensaio clinico de tratamento - em tres modalidades - para criancas com disturbios da fluencia e gagueira Este e um artigo publicado em acesso aberto (Open Access) sob a licenca Creative Commons Attribution , que permite uso, distribuicao e reproducao em qualquer meio, sem restricoes desde que o trabalho original seja corretamente citado. Devido a problemas tecnicos durante a producao editorial do artigo "Ensaio clinico de tratamento - em tres modalidades - para criancas com disturbios da fluencia e gagueira" (DOI ), publicado no periodico CoDAS 2022;34(2):e20200264, a versao em ingles deste artigo foi publicada com um erro. Na pagina 8 da versao em ingles do artigo, deve haver uma secao de agradecimentos com a seguinte declaracao: ACKNOWLEDGEMENTS To CAPES, for promoting this research in the form of a Master's Scholarship. |
Front Pharmacol Front Pharmacol Front. Pharmacol. Frontiers in Pharmacology 1663-9812 Frontiers Media S.A. 1166591 10.3389/fphar.2023.1166591 Pharmacology Correction Corrigendum: MicroRNAs: Potential mediators between particulate matter 2.5 and Th17/Treg immune disorder in primary membranous nephropathy Zhou et al. 10.3389/fphar.2023.1166591 Zhou Xiaoshan 1 2 Dai Haoran 3 Jiang Hanxue 2 Rui Hongliang 2 4 Liu Wenbin 5 Dong Zhaocheng 1 Zhang Na 6 Zhao Qihan 2 6 Feng Zhendong 7 Hu Yuehong 2 6 Hou Fanyu 8 Zheng Yang 2 * Liu Baoli 2 * 1 Beijing University of Chinese Medicine, Beijing, China 2 Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, Beijing, China 3 Shunyi Branch, Beijing Hospital of Traditional Chinese Medicine, Beijing, China 4 Beijing Institute of Chinese Medicine, Beijing, China 5 School of Life Sciences, Beijing University of Chinese Medicine, Beijing, China 6 School of Traditional Chinese Medicine, Capital Medical University, Beijing, China 7 Pinggu Hospital, Beijing Hospital of Traditional Chinese Medicine, Beijing, China 8 School of Traditional Chinese Medicine, Changchun University of Chinese Medicine, Changchun, China Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Yang Zheng, [email protected]; Baoli Liu, [email protected] This article was submitted to Renal Pharmacology, a section of the journal Frontiers in Pharmacology 27 2 2023 2023 27 2 2023 14 116659115 2 2023 16 2 2023 Copyright (c) 2023 Zhou, Dai, Jiang, Rui, Liu, Dong, Zhang, Zhao, Feng, Hu, Hou, Zheng and Liu. 2023 Zhou, Dai, Jiang, Rui, Liu, Dong, Zhang, Zhao, Feng, Hu, Hou, Zheng and Liu This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A Corrigendum on MicroRNAs: Potential mediators between particulate matter 2.5 and Th17/Treg immune disorder in primary membranous nephropathy by Zhou X, Dai H, Jiang H, Rui H, Liu W, Dong Z, Zhang N, Zhao Q, Feng Z, Hu Y, Hou F, Zheng Y, Liu B (2022). Front Pharmacol. 13:968256. doi: 10.3389/fphar.2022.968256 PM2.5 PLA2R1 microRNA Th17/Treg primary membranous nephropathy (PMN) This work is supported by grants from Capital's Funds for Health Improvement and Research (No. 2020-2-2234 to BL), the National Key Research and Development Project of China (No. 2019YFC1709402 to BL), the General project of the National Natural Science Foundation of China (No. 81973793 to BL), and Youth Foundation of National Natural Science Foundation of China (No. 82004269 to HD).The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. pmcIn the published article, there was an error in Affiliations . Instead of "1Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, Beijing, China, 2School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing, China," it should be "1Beijing University of Chinese Medicine, Beijing, China, 2Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, Beijing, China." In the published article, there was an error in the Funding statement. The number of the first fund was incorrect. The correct Funding statement appears below. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
- reconsider use of term 'narrative review' as a systematic review can include narrative synthesis. The use of a narrative approach does not in itself obviate systematicity. - RQ in abstract: what are the associated factors with gender incongruence and its levels of evidence in the scientific literature? It's not clear to me what 'its' refers to and 'levels of evidence' seems to need definition. See my below comment in Methods for suggested rephrasing. - You have made no mention of planned analysis method. I think some indication should be given here. - Overall I don't think the abstract goes far enough to describe methods or even make a case for how it could be useful. It is just too vaguely stated at present. Introduction - p8, para 3: 'In the review prior to the development of this protocol' - not clear what this refers to. Is this your own lit search in planning the present study? In which case, make that more clear. - Overall very clear and well written. Method - p9, para 2 - couple of grammatical tweaks. Point (III) should read 'chart' not 'charting', and the last clause, 'as will be depicted as follows' doesn't make sense. - I RQ - re-phrase first sentence - 'The question that arises from the above is the next:...'. - I RQ - RQ itself also needs to be rephrased. Currently: What are the factors associated with gender incongruence and its levels of evidence in the scientific literature? Suggest changing to 'What are the factors associated with gender incongruence and what level of evidence is there for each factor in the scientific literature? - Pubmed and Scopus, although large, are not likely to generate all the relevant literature. What about PsycINFO and CINAHL? You may be interested in two of my papers published in PLOS Global Public Health, which is currently too new to be indexed. (Thompson et al 'A PRISMA systematic review of adolescent gender dysphoria literature' - parts 1 and 2 published, part 3 under review.) Please don't take this to mean I expect you to cite these - this is not the point. I just want to say there may be relevant papers outwith Pubmed and Scopus so I would seriously consider casting a wider net. - 'In addition, the cited sources will be reviewed to capture gray literature and find keywords that guide the final literature search.' I am not sure this would be sufficient. For grey literature, authors should consider also using databases especially designed around this literature, e.g., OpenDOAR, PsycEXTRA. - p9 - explicate PCC in reference to mnemonic criteria - search strategy (appendix 1) - should you include the alternative spelling 'aetiology' as well? - Search strategy (appendix 1) - I appreciate this will be a preliminary search, but I suggest including terms such as 'gender nonconforming' 'gender reassignment' 'sex reassignment' and 'transsexual'. - 'of examining the reference lists before carrying out an intensive search in both repositories' - suggest change to 'hand search' and it's not clear what is meant by an intensive search of both repositories. Does it mean your search terms may be further augmented? - Resolving disagreement by discussion - is there a third person who could be brought in where it's difficult to reach agreement? - Fig 1 image quality is poor. - p11 - levels of evidence. This hierarchy seems reasonable, but I wonder if you will be using a systematic quality assessment tool as well. That is, you could have a paper that reports an RCT (so rated 2 on level of evidence) but the quality of the study / paper is not very good. How will this be dealt with? There are good tools for assessing the quality of studies of diverse designs, such as the Crowe Critical Appraisal Tool (CCAT) or the Quality Assessment Tool for Studies of Diverse Designs (QATSDD). Results - I appreciate the need to be vague without knowing the nature of the findings. But I think you could say that the study characteristics will be given in a table (you could even provide headings), and that you will endeavour to find a way to present the factors identified cross-referenced with their level of evidence AND an assessment of the quality of the literature (see my previous comment). Contributions statement - I'm not sure 'redacted' is the term you want here. Drafted and edited? Reviewer #2: General comments: - Figure 1 is quite blurry at the current uploaded resolution - etiology is almost certainly multifactorial, though I agree a scoping review could summarize potential contributors Research question: - Regarding this sentence, "Finally, it is hoped that the results of this research (4) may be useful for therapists...," WPATH SOC version 8 has removed the requirement that therapists are the only providers who have to evaluate and provide treatment recommendations for gender incongruence. It may be more accurate to change "therapists" to "clinicians evaluating gender incongruence" Methods: - With regards to the data extraction from included studies, it's unclear to me how the "methodological design" will be different from the "levels of evidence" since you are essentially substituting the method design for levels of evidence anyways. Discussion: - Regarding this sentence in your discussion: "One of its key points states: "There is lack of consensus and open discussion about the nature of gender dysphoria and therefore about the appropriate clinical response" ." I disagree that there is lack of consensus around the appropriate clinical response - the appropriate clinical response is to support trans/gender diverse individuals and there is evidence base for gender-affirming treatments in reducing mental health symptoms, improving quality of life, etc. - With regards to this sentence in your discussion: "Understanding the etiology of gender dysphoria, would help clinicians decide which type of intervention will be helpful in each case, and might also help to prevent regret and detransition, which appears to be becoming increasingly common ," your included references do not state that regret and/or detransition are becoming more common and they do not even speak to the incidence/prevalence. Rather those two cited studies seek to understand the phenomena of detransition. The last part of this sentence should be changed - as written, it is not supported by references and seems provocative. - I also wonder if you could speak to how interventions might differ due to the potential etiology of gender incongruence? ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose "no", your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Lucy Thompson Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at [email protected]. Please note that Supporting Information files do not need this step. 10.1371/journal.pone.0283011.r002 Author response to Decision Letter 0 Submission Version1 13 Feb 2023 The requested information can be found in the file "Response to Reviewers". Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0283011.r003 Decision Letter 1 Honekopp Johannes Academic Editor (c) 2023 Johannes Honekopp 2023 Johannes Honekopp This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 1 Mar 2023 Etiology of Gender Incongruence and its levels of evidence: a scoping review protocol PONE-D-22-26911R1 Dear Dr. Rojas Saffie, We're pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you'll receive an e-mail detailing the required amendments. When these have been addressed, you'll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at [email protected]. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they'll be preparing press materials, please inform our press team as soon as possible no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact [email protected]. Kind regards, Johannes Honekopp Academic Editor PLOS ONE 10.1371/journal.pone.0283011.r004 Acceptance letter Honekopp Johannes Academic Editor (c) 2023 Johannes Honekopp 2023 Johannes Honekopp This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 3 Mar 2023 PONE-D-22-26911R1 Etiology of Gender Incongruence and its levels of evidence: a scoping review protocol Dear Dr. Rojas Saffie: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact [email protected]. If we can help with anything else, please email us at [email protected]. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Johannes Honekopp Academic Editor PLOS ONE |
PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0283262 PONE-D-23-06623 Correction Correction: Parallel pitch processing in speech and melody: A study of the interference of musical melody on lexical pitch perception in speakers of Mandarin Sadakata Makiko Weidema Joey L. Roncaglia-Denissen M. Paula M. Honing Henkjan 13 3 2023 2023 13 3 2023 18 3 e0283262(c) 2023 Sadakata et al 2023 Sadakata et al This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Parallel pitch processing in speech and melody: A study of the interference of musical melody on lexical pitch perception in speakers of Mandarin pmcPaula M. Roncaglia-Denissen should be included in the author byline instead of the Acknowledgments. Paula M. Roncaglia-Denissen should be listed as the third author, and their affiliation is 3: Department of Cognitive Science and Artificial Intelligence, Tilburg School of Humanities and Digital Sciences, Tilburg University, Tilburg, The Netherlands. The contributions of this author are as follows: Conceptualization, Writing-Review & Editing. The correct citation is: Sadakata M, Weidema JL, Roncaglia-Denissen MPM, Honing H (2020) Parallel pitch processing in speech and melody: A study of the interference of musical melody on lexical pitch perception in speakers of Mandarin. PLoS ONE 15(3): e0229109. The correct Funding statement is as follows: JW, MPRD and HH were supported by a Horizon grant (317-70-010) of the Netherlands Organization for Scientific Research (NWO). HH was supported by a Distinguished Lorentz fellowship granted by the Lorentz Center for the Sciences and the Netherlands Institute for Advanced Study in the Humanities and Social Sciences (NIAS). The correct Acknowledgements statement is as follows: The authors are very grateful to Loy Clements and Carlos Vaquero for their help in creating the code to generate the auditory stimuli. Additional appreciation to Loy Clements for his assistance in creating additional code for stimulus creation, EEG processing, and statistical analyses; and to Ya-Ping Hsiao and Yuan Yan for their assistance in recording and translating the Mandarin stimuli. The authors also express valued appreciation to Johan Tangerman for his help with data collection. Reference 1 Sadakata M , Weidema JL , Honing H (2020) Parallel pitch processing in speech and melody: A study of the interference of musical melody on lexical pitch perception in speakers of Mandarin. PLoS ONE 15 (3 ): e0229109. 10.1371/journal.pone.0229109 32130244 |
Front Mol Biosci Front Mol Biosci Front. Mol. Biosci. Frontiers in Molecular Biosciences 2296-889X Frontiers Media S.A. 1157440 10.3389/fmolb.2023.1157440 Molecular Biosciences Editorial Editorial: RNAs at the crossroads between effectors and targets; discovery and development of new drugs Chiappori and Mollica 10.3389/fmolb.2023.1157440 Chiappori Federica 1 * + Mollica Luca 2 * + 1 National Research Council Institute for Biomedical Technologies, Milan, Italy 2 L.I.T.A, Department of Medical Biotechnologies and Translational Medicine, University of Milan, Milan, Italy Edited by: William C. Cho, QEH, Hong Kong SAR, China Reviewed by: Chiara Giacomelli, University of Pisa, Italy *Correspondence: Federica Chiappori, [email protected]; Luca Mollica, [email protected] + These authors have contributed equally to this work This article was submitted to Molecular Diagnostics and Therapeutics, a section of the journal Frontiers in Molecular Biosciences 27 2 2023 2023 10 115744002 2 2023 13 2 2023 Copyright (c) 2023 Chiappori and Mollica. 2023 Chiappori and Mollica This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic RNAs at the crossroads between effectors and targets; discovery and development of new drugs RNA drug target RNA as drug cancer miRNA aptamer RNA structure pmcIn recent years, several functions of different RNA molecules have been identified, as well as the ability of these molecules to regulate multiple processes in the cell, allowing the identification of RNA molecules as a large class of promising novel drug targets. Moreover, some small RNA molecules were recently approved in therapy or are being developed, because of their efficacy in treating diseases untreatable with classic drugs that target proteins; such as diseases caused by alternative spicing. Besides, small RNAs have the possibility to rapidly personalize treatments. Since 1998, eight Antisense oligonucleotides (ASO), four small interfering RNA (siRNA), one aptamer, and two messenger RNA (mRNA) vaccines were approved by the U.S. Food and Drug Administration (FDA) (Kim, 2022). These demonstrate their efficacy in treating several diseases such as Duchene Molecular Dystrophy, amyloidosis, and hypercholesterolemia. To analyse available experimental and computational methods and recent developments in the therapeutic RNA field, we have collected five contributions to the present Research Topic: Three original research articles and two review articles. Despite great advances, ranging from surgery to pharmaceutical sciences, it remains a challenge both to understand the development mechanisms of cancer and to identify specific and successful treatments for the disease. Four out of the five contributions to this Research Topic explore cancer from different perspectives, all of them focussing on the crucial role of RNA interactions at several levels. The review proposed by Yi and Yu discusses the regulation of Solute Carrier (SLC) superfamily transporters expression by microRNA molecules (miRNAs). This transporter family is responsible for nutrients and drug-dysregulated transport in cancer cells. Moreover, several miRNAs were found to regulate SLC expression. For these reasons, miRNA-mediated regulation of SLC transporters in cancer therapy can override chemoresistance and/or help therapies to prevent cancer cells from "feeding." Yu et al. report the development of the Prediction of SM-miRNA Regulation pairs (PSRR) web server. The inhibition of miRNA by small molecules can be useful to regulate cellular processes acting on a single target. miRNAs can be targeted by small molecules. To identify miRNA targets for cancer therapies, the authors implement a web server that predicts the regulation relations between miRNAs and small molecules. Different predicting algorithms were implemented, but the random forest returns the best performances. The work of Esposito et al. group describes a modified cell-SELEX approach for the isolation of RNA aptamers specific for hypoxia-related epitopes expressed on breast cancer cell surfaces. Owing to the central role of hypoxia in tumor progression, treatment failure, and negative prognosis, the authors developed a "Hypoxic cell-SELEX" methodology that relies on a simple and rapid system to reproduce in vitro the hypoxic conditions present in the tumor micro-environment. In this context, they report the identification and the biophysical characterization of the most represented aptamer with improved binding affinity for the hypoxic phenotype. Cheng et al. propose an innovative nanobubble complex to be used in the sonodynamic treatment of Hepatocellular carcinoma. The treatment induces cellular apoptosis. The authors also evaluate the differentially expressed RNA (mRNAs, lncRNAs, and circRNAs) before and after treatment, and a subset of differentially expressed genes as potential targets for HCC treatment. Finally, the recent advancements in experimental resolution and the ad hoc computational modeling pipelines for RNA structures have enabled the growth of RNA-based therapy. In this context, Mollica et al. summarize the recent advances and applications of therapeutic RNAs, and the structural viewpoint, the available strategies, and the computational and experimental analysis methods with a focus on dynamic and flexibility aspects and binding analysis. Overall, the contributions highlight the interest in focussing on RNA both as a target and as a treatment, and the possibility of combining experimental and computational methods to increase the efficacy of the analysis. Besides, we believe that the study of RNA structures in conjunction with a biological and pharmacological characterization of RNA interactors and interactions could be an asset for future development in the field. The RNA structure is still not often considered in the design of new therapies, but some recent research emphasizes this aspect (Duchardt-Ferner et al., 2020; Mitchell et al., 2020; Li et al., 2021). We believe this Research Topic will be useful for biotechnologists and biologists, as well as for computational and biophysical chemists willing to drive their research in a still slightly immature but very promising field. We thank all Authors and Reviewers for their contributions to this Research Topic and we acknowledge the Frontiers in Molecular Biosciences Team for its support. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Duchardt-Ferner E. Juen M. Bourgeois B. Madl T. Kreutz C. Ohlenschlager O. (2020). Structure of an RNA aptamer in complex with the fluorophore tetramethylrhodamine. Nucleic Acids Res. 48 , 949-961. 10.1093/nar/gkz1113 31754719 Kim Y.-K. (2022). RNA therapy: Rich history, various applications and unlimited future prospects. Exp. Mol. Med. 54 , 455-465. 10.1038/s12276-022-00757-5 35440755 Li Y. Garcia G. Arumugaswami V. Guo F. (2021). "Structure-based design of antisense oligonucleotides that inhibit SARS-CoV-2 replication,". bioRxiv, 2021.08.23.457434. Mitchell B. P. Hsu R. V. Medrano M. A. Zewde N. T. Narkhede Y. B. Palermo G. (2020). Spontaneous embedding of DNA mismatches within the RNA: DNA hybrid of CRISPR-cas9. Front. Mol. Biosci. 7 , 39. 10.3389/fmolb.2020.00039 32258048 |
J Exp Bot J Exp Bot exbotj Journal of Experimental Botany 0022-0957 1460-2431 Oxford University Press UK 36913620 10.1093/jxb/erad037 erad037 eXtra Botany Editorial AcademicSubjects/SCI01210 Next generation editors Lunn John E Max Planck Institute of Molecular Plant Physiology, D-14476 Potsdam-Golm, Germany Correspondence: [email protected] Editor in Chief, JXB 13 3 2023 13 3 2023 13 3 2023 74 5 12911292 26 1 2023 26 1 2023 13 3 2023 (c) The Author(s) 2023. Published by Oxford University Press on behalf of the Society for Experimental Biology. 2023 This is an Open Access article distributed under the terms of the Creative Commons Attribution License ), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. pmc The Journal of Experimental Botany is pleased to announce the appointment of six early career researchers as editorial interns: Francesca Bellinazzo (Wageningen University and Research, the Netherlands), Konan Ishida (University of Cambridge, UK), Nishat Shayala Islam (Western University, Ontario, Canada), Chao Su (University of Freiburg, Germany), Catherine Walsh (Lancaster University, UK), and Arpita Yadav (University of Massachusetts Amherst, MA, USA) (Fig. 1). The aim of this programme is to help train the next generation of editors. Each intern has been paired with one of our Associate Editors as a mentor, who will guide them through all aspects of the editorial process for selected manuscripts: initial editorial assessment, selection of reviewers, and evaluation of the reviews to reach a decision. The strict rules of editorial confidentiality will apply at all times, and the final decision on each manuscript will remain the sole responsibility of the Associate Editor. Our interns will also be invited to write Insight commentaries on selected papers and contribute to the journal's social media output. If you would like to learn more about our editorial interns, please visit the JXB website. As we begin a new year, we look forward with hope to an end to the Covid-19 pandemic, which has had a major impact on all of our lives, both personal and professional, and JXB has been no exception. Our editorial staff in the Lancaster office and members of our editorial board rose magnificently to the challenges during these difficult times, guided by our goal to handle all submissions in an efficient, constructive, and courteous way, and helping to maintain the high publishing standards the plant science community expects from us. We are pleased to report a further increase in our ClarivateTM Web of ScienceTM impact factor to 7.378, reflecting the high quality of the manuscripts we receive. We would like to thank all the authors who entrusted their work to us for publication and our valued reviewers who kindly gave their time and the benefit of their expert knowledge to support JXB. JXB was founded by the Society for Experimental Biology (SEB) and remains part of the SEB family of journals that support its mission to promote science, supporting the science community through its scientific meetings, travel grants, careers workshops, and public outreach and education programmes. This year, the SEB celebrates the centenary of its founding in 1923 ), and we congratulate the society, its officers and members, past and present, for this remarkable achievement. We are looking forward to an exciting programme of plant, animal, and cell science at the SEB Centenary Conference in Edinburgh (4-7 July 2023; ), where there will be an opportunity to meet some of our editors and editorial staff. To mark the occasion, we have commissioned a special series of SEB Centenary Reviews, to be published later this year, representing the diverse aspects of plant science published by JXB. We thank the eminent scientists who kindly agreed to contribute to this collection, and we hope that you will enjoy reading the reviews and that you will continue helping JXB to support the invaluable work of the SEB in its second century. Fig. 1. Introducing JXB's Editorial Interns. Top (L to R): Nishat Shayala Islam, Chao Su, Francesca Bellinazzo. Bottom (L to R): Arpita Yadav, Catherine Walsh, Konan Ishida. |
Einstein (Sao Paulo) Einstein (Sao Paulo) eins Einstein 1679-4508 2317-6385 Instituto Israelita de Ensino e Pesquisa Albert Einstein 00100 10.31744/einstein_journal/2023ED0000 Editorial Obituary: Erney Felicio Plessmann de Camargo Rizzo Luiz Vicente 1 1 Instituto Israelita de Ensino e Pesquisa Albert Einstein Hospital Israelita Albert Einstein Sao Paulo SP Brazil Instituto Israelita de Ensino e Pesquisa Albert Einstein, Hospital Israelita Albert Einstein, Sao Paulo, SP, Brazil. Corresponding author: Luiz Vicente Rizzo. Avenida Albert Einstein, 627/701 - Morumbi Zip code: 05652-900 - Sao Paulo, SP, Brazil E-mail: [email protected] 10 3 2023 2023 21 eED0000 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmc Source: Pesquisa FAPESP. Erney Felicio Plessmann de Camargo, Professor Emeritus at the Universidade de Sao Paulo , a member of the Brazilian Academy of Sciences and honorary member of the National Academy of Medicine has passed. When Professor Erney took over Conselho Nacional de Desenvolvimento Cientifico e Tecnologico he revolutionized the agency, instituting many procedures that were fundamental to move Brazilian science forward. Despite the lack of appropriate funding, he managed to oversee an outstanding growth of scientific productivity in Brazil. Erney was a friend and a mentor. His role at the Scientific Advisory board of the Institute since 2010 was instrumental to the scientific success we achieved. He used to say that "science is done by scientists and that is what they should do" that thought helped to shape the idea of the Researcher Support Office at the Hospital Israelita Albert Einstein , which provides all the pre-award and post-award help to scientists at Einstein amongst other support services for the advancement of science. Erney will be sorely missed. We will try our best to keep alive his vision of science and innovation as the way for mankind to overcome the ills that plague us. With our most felt condolences to his family and friends we bid goodbye to one of the great scientists and research administrators that our nation has ever produced. |
Oncotarget Oncotarget Oncotarget Impact Journals LLC Oncotarget 1949-2553 Impact Journals LLC 28381 10.18632/oncotarget.28381 Retraction Retraction: Methylation-induced downregulation and tumor suppressive role of microRNA-29b in gastric cancer through targeting LASP1 Li Hui 1 Liu Guoqing 2 Pan Ke 2 Miao Xiongying 2 Xie Yong 2 1Department of Anesthesia, Second Xiangya Hospital, Central South University, Changsha, Hunan, China 2Department of General Surgery, Second Xiangya Hospital, Central South University, Changsha, Hunan, China Correspondence to: Yong Xie, email : [email protected] 2023 11 3 2023 11 3 2023 14 173173 Copyright: (c) 2023 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. pmc This article has been retracted: In Figures 3A, 8D, and 7D, multiple wound healing assay images of gastric cancer cell lines overlap with the images from another published paper studying the effect of different miRNA in liver cancer , which was retracted. Figure 3A images of AGS cells transfected with miR-NC (AGS/miR-NC) and BGC-823 cells transfected with miR-29b (BGC-823/miR-29b) at 0 h time point overlap with the images of HEPG2/miR-137 and /miR-NC from Figure 2E of ; image of BGC-823/miR-29b+LASP1 from Figure 8D overlaps with HEPG2/miR-NC image of Figure 2E ; Figure 7D images of AGS/NC-siRNA at 0 h time point, AGS/LASP-siRNA and BGC-823/NC-siRNA at 48 h time point overlap with images of Figure 6E HepG2/miR-137+EZH2 (0 h), HEPG2/miR-137 (24 h) and HEPG2/miR-137+EZH2 (24 h), respectively. In Figures 3B, 7E, 8E multiple transwell assay images are the duplication of transwell assay images from unrelated papers of different authors, for the example - Figures 3C/3D and 7C/7D from and Figures 4D and 6D from . Original article: Oncotarget. 2017; 8:95880-95895. 95880-95895. 1. Cui S , Sun Y , Liu Y , Liu C , Wang J , Hao G , Sun Q . MicroRNA-137 has a suppressive role in liver cancer via targeting EZH2. Mol Med Rep. 2017; 16 :9494-502. 10.3892/mmr.2017.7828. . Retraction in: Mol Med Rep. 2022; 25:145. 10.3892/mmr.2022.12661. 29152663 2. Zhang C , Long F , Wan J , Hu Y , He H . MicroRNA-205 acts as a tumor suppressor in osteosarcoma via targeting RUNX2. Oncol Rep. 2016; 35 :3275-84. 10.3892/or.2016.4700. . Retraction in: Oncol Rep. 2021; 46:155. 10.3892/or.2021.8106. 27035764 3. Xia Z , Qiu D , Deng J , Jiao X , Yang R , Sun Z , Wan X , Li J . Methylation-induced downregulation and tumor-suppressive role of microRNA-98 in glioma through targeting Sal-like protein 4. Int J Mol Med. 2018; 41 :2651-59. 10.3892/ijmm.2018.3464. . Retraction in: Int J Mol Med. 2021; 48:129. 10.3892/ijmm.2021.4962. 29436585 |
Oncotarget Oncotarget Oncotarget Impact Journals LLC Oncotarget 1949-2553 Impact Journals LLC 28356 10.18632/oncotarget.28356 Correction Correction: UBE2T knockdown inhibits gastric cancer progression Luo Changjiang 1 * Yao Yunyi 2 * Yu Zeyuan 1 Zhou Huinian 1 Guo Lingyun 1 Zhang Junqiang 1 Cao Hongtai 1 Zhang Genyuan 1 Li Yumin 1 Jiao Zuoyi 1 1Department of General Surgery, Lanzhou University Second Hospital and Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou, Gansu, 730030, China 2Department of Medical Technology and Key Laboratory of Biotechnology for Laboratory Medicine of Suzhou, Suzhou Vocational Health College, Suzhou, Jiangsu, 215009, China *These authors contributed equally to this work Correspondence to: Zuoyi Jiao, email : [email protected] Yumin Li, email : [email protected] 2023 11 3 2023 11 3 2023 14 188189 Copyright: (c) 2023 Luo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. pmc This article has been corrected: In Figure 4C, in the SGC-7901 panel, the first image in the first row is an accidental duplicate of the third image in the second row. The corrected Figure 4, obtained using the original data, is shown below. The authors declare that these corrections do not change the results or conclusions of this paper. Original article: Oncotarget. 2017; 8:32639-32654. 32639-32654. Figure 4 Suppression of UBE2T inhibits growth and colony formation in gastric cancer cells. (A) Cellomics detection indicated that SGC-7901 cell proliferation decreased after suppression of UBE2T. Data are presented as means +- SD. (B) MTT assays in SGC-7901 cells indicated that suppression of UBE2T inhibited SGC-7901 cell proliferation. Data are presented as means +- SD. (C) The tumor colony formation assay indicated that suppression of UBE2T inhibited tumor colony formation in SGC-7901 and BGC-823 cells. Data are presented as the means +- SD. ** P < 0.01 versus the control group. (D) The percentages of cells in the G1, S, and G2/M phases were determined using FCM. G1 and S phase populations decreased while the G2/M phase population increased in SGC-7901 and BGC-823 cells. Data are presented as means +- SD. ** P < 0.01 versus the control group. (E) Annexin V staining was measured using FCM to evaluate apoptosis. The percentage of apoptotic SGC-7901 and BGC-823 cells increased dramatically after siRNA lentivirus infection. Data are presented as means +- SD. ** P < 0.01 versus the control group. |
eLife Elife eLife eLife 2050-084X eLife Sciences Publications, Ltd 87507 10.7554/eLife.87507 Correction Neuroscience Correction: Learning precise spatiotemporal sequences via biophysically realistic learning rules in a modular, spiking network Cone Ian Shouval Harel Z [email protected] 13 3 2023 2023 13 3 2023 12 e87507(c) 2023, Cone and Shouval 2023 Cone and Shouval This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited. Research organism None pmc Cone I, Shouval HZ. 2021. Learning precise spatiotemporal sequences viabiophysically realistic learning rules in a modular, spiking network. eLife 10:e63751. doi: 10.7554/eLife.63751. Published 18 March 2021 A recent publication (Zajzon et al., 2023), which reproduced this paper's Markovian sequence model in NEST (Zajzon et al., 2022), has made us aware of an error in the original code included in the data availability. Specifically, the original Markovian code (which we hereafter refer to as Markovian FF) improperly restricted Messenger to Timer intercolumnar connections such that they were limited to be feed-forward (i.e. ordinal to the presented sequence). We thank Zajzon et al., 2023 for also proposing a fix (via raising the feed-forward threshold, as described below). An updated version of the Markovian code (which we hereafter refer to as Markovian A2A), which correctly allows for any (all-to-all or A2A) Messenger to Timer intercolumnar connections, is now included (along with the previous code, MATLAB FF) in the ModelDB upload. Supplementary File 1 and 2 have been updated to include accurate and correctly scaled values, for both Markovian FF and Markovian A2A. Additionally, an inconsistency in Equations 8 and 9 has been corrected, and text in the Materials and methods has been added to highlight the importance of learning thresholds rth and rthFF. We thank the authors of Zajzon et al., 2023 for their contributions to recognizing and rectifying these errors. The corrected parameters in Markovian A2A are as follows: * Feed-forward learning threshold rthFF = 30Hz * Saturation level for feed-forward LTD eligibility trace Tdmax,FF = .0045 * Activation rate for feed-forward LTP eligibility trace hpFF = 8.8 x 3500 ms-1 * Activation rate for feed-forward LTD eligibility trace hdFF = 10 x 3500 ms-1 * Feed-forward learning rate hFF = 0.4 The original parameters in Markovian FF were set as: * Feed-forward learning threshold rthFF = 20Hz * Saturation level for feed-forward LTD eligibility trace Tdmax,FF = .00345 * Activation rate for feed-forward LTP eligibility trace hpFF = 20 x 3500 ms-1 * Activation rate for feed-forward LTD eligibility trace hdFF = 15 x 3500 ms-1 * Feed-forward learning rate hFF = 0.25 The corrected equations 8 and 9 read the following:tpdTijpdt=-Tijp+epHijTmaxp-Tijp(8) tddTijddt=-Tijd+edHijTmaxd-Tijd(9) The original equations 8 and 9 were published as:tpdTijpdt=-Tijp+epHijTmaxp-TijpTmaxp(8) tddTijddt=-Tijd+edHijTmaxd-TijdTmaxd(9) The following text has been appended to the Materials and methods: "Our Hebbian term is also subject to rate thresholds rth and rthFF in the recurrent and feed-forward cases, which we further discuss at the end of this section." "However, in the presence of noise, modules can have spurious activity overlaps which cause non-zero Hij and therefore potentiation of weights Wij which are non-sequential. This can lead to network instability and a failure to encode the presented sequence. To account for this, rate thresholds rth and rthFF are included in the Hebbian term Hij. By setting these thresholds above the effective noise level (see Supplementary File 1), the Hebbian overlap Hij used to activate traces ignores the random, noise-driven overlaps. Crucially, as rthFF dictates the sensitivity to inter-columnar overlaps, it is a critical and necessary parameter to enable the all-to-all connectivity of the model." The article has been corrected accordingly. Additional files Supplementary file 1. Table of main model parameters. Supplementary file 2. Table of reservoir, sparse net, and rate-based model parameters. References Zajzon B Duarte R Morrison A 2022 Towards reproducible models of sequence learning: replication and analysis of a modular spiking network with reward-based learning 7625737 Github Zajzon B Duarte R Morrison A 2023 Towards reproducible models of sequence learning: replication and analysis of a modular spiking network with reward-based learning bioRxiv 10.1101/2023.01.18.524604 |
Braz J Cardiovasc Surg Braz J Cardiovasc Surg rbccv Brazilian Journal of Cardiovascular Surgery 0102-7638 1678-9741 Sociedade Brasileira de Cirurgia Cardiovascular 10.21470/1678-9741-2020-0448 Letter to the Editor Venous Bubble Trap - Management Types During Minimal Invasive Extracorporeal Circuits Condello Ignazio PhD 1 1 Department of Cardiac Surgery, Anthea Hospital, GVM Care & Research, Bari, Italy. E-mail: [email protected] Jan-Feb 2023 Jan-Feb 2023 38 1 211212 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcThe use of minimally invasive extracorporeal circuits (MiECC) in cardiac surgery is expanding. In this letter to the Editor, I emphasize the air evacuation management from bubble trap through various strategies. The prevention and management of macro and micro gas embolism during minimally invasive extracorporeal circulation (ECC) is crucial. In particular, according to the classification of the Minimal Invasive Extracorporeal Technologies International Society position paper, the types of MiECC II, III, and IV are equipped with bubble trap in the venous line. The improved biocompatibility ameliorates organ preservation and reduces transfusion of homologous blood products . However, the MiECC system is a closed-loop system, employing kinetically assisted venous drainage, which may increase the risk of introducing venous air. Venous air travels easily through a bypass system resulting in gaseous microemboli in the arterial line prior to entering the patient's arterial circulation. The number of cerebral microemboli increases in conventional ECC systems during drug bolus injections, blood sampling, low blood volume levels in the venous reservoir, and infusions . Microemboli activate the inflammatory response and may even obstruct the blood flow in the capillary vessels, causing ischemia of the tissues . Consequently, these pathophysiological processes may lead to a decline in the cognitive function of the patient. Less microemboli were detected in the arterial line and in the cerebral vessels during the use of MiECC systems as compared to conventional systems. However, more recently, a study on the use of a customised MiECC system was terminated prior to study completion due to venous air leakage . Others have also raised their concerns over patient safety by using a miniaturized ECC system, without a safety feature to remove venous air . The use of an air removal device at the venous side of the MiECC system could avoid air entering this system and may increase patient safety. A venous bubble trap (VBT) was designed as air removal device for air separation in the venous line of MiECC systems and it was also designed for air separation in the venous line of minimized ECC circuits. The VBT was interconnected in the venous line of the MiECC system, and the air-removal was accomplished by a combination of two principles, centrifugal flow and bubble buoyancy. The 175-mm mesh screen separates air from blood and enables removal of trapped air from both sides of the screen through the evacuation port. Many perfusionists add an accessory bubble trap in the intracavitary aspirator (vent) line before the main bubble trap and air evacuation port is connected to the autotransfusion system, allowing to block the air from the vent before the VBT. Other circuit designs for MiECC have the vent line directly on the main VBT, the air evacuation port is connected to the autotransfusion system, or dynamic port connected to the roller pump head. In the cardiopulmonary bypass consoles, there are automated systems for air purge control, detected through ultrasound sensors from the venous line and bubble trap that activate the autoclamp and purge line. REFERENCES 1 Anastasiadis K Murkin J Antonitsis P Bauer A Ranucci M Gygax E Use of minimal invasive extracorporeal circulation in cardiac surgery: principles, definitions and potential benefits. A position paper from the minimal invasive extra-corporeal technologies international society (MiECTiS) Interact Cardiovasc Thorac Surg 2016 22 5 647 652 10.1093/icvts/ivv380 26819269 2 Camboni D Schmidt S Philipp A Rupprecht L Haneya A Puehler T Microbubble activity in miniaturized and in conventional extracorporeal circulation ASAIO J 2009 55 1 58 62 19092669 3 Myers GJ Voorhees C Haynes R Eke B Post-arterial filter gaseous microemboli activity of five integral cardiotomy reservoirs during venting: an in vitro study J Extra Corpor Technol 2009 41 1 20 27 19361028 4 Roosenhoff TP Stehouwer MC De Vroege R Butter RP Van Boven WJ Bruins P Air removal efficiency of a venous bubble trap in a minimal extracorporeal circuit during coronary artery bypass grafting Artif Organs 2010 34 12 1092 1098 20545664 5 Groenenberg I Weerwind PW Everts PA Maessen JG Dutch perfusion incident survey Perfusion 2010 25 5 329 336 10.1177/0267659110377678 20630919 |
Braz J Cardiovasc Surg Braz J Cardiovasc Surg rbccv Brazilian Journal of Cardiovascular Surgery 0102-7638 1678-9741 Sociedade Brasileira de Cirurgia Cardiovascular 10.21470/1678-9741-2020-0481 Letter to the Editor Anticoagulation in Emergency Cardiac Surgery The Rationale for Modular Minimally Invasive Extracorporeal Circulation Use Condello Ignazio PhD 1 1 Department of Cardiac Surgery, Anthea Hospital, GVM Care & Research, Bari, Italy. E-mail: [email protected] Jan-Feb 2023 Jan-Feb 2023 38 1 209210 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcThe administration of heparin is crucial for cardiopulmonary bypass (CPB) establishment during cardiac arrest in an emergency cardiac surgery. Anticoagulation administration through an infusion line may not favor complete anticoagulation due to no and low flow during cardiopulmonary resuscitation, and an unreliable measure of preoperative activated clotting time (ACT) could expose the patient to the thrombotic risks of extracorporeal circuit and oxygenator during CPB initiation. Although there are guidelines for the management of anticoagulation during CPB, the topic of anticoagulation in emergency cardiac surgery is not exhaustively treated . In normal conditions, heparin (300 U/kg) is administered intravenously before arterial cannulation with a target ACT > 480 seconds (measured after three minutes). During arterial cannulation, systolic pressure should be 90-100 mmHg to reduce the risk of aortic dissection. The aortic cannulation is done first to provide volume resuscitation in case of hypotension associated with venous cannulation. Once the aortic cannula is connected to the tubing, line pressure is checked to rule out dissection. After venous cannulation, venous clamp is gradually released to establish full CPB, and then ventilation is discontinued . Due to the critical emergency conditions during cardiac arrest, extracorporeal membrane oxygenation (ECMO) was used as the primary option of choice to simplify the problems caused by anticoagulation; ACT testing is a non-specific point of care assessment method used since the 1970s when ECMO first started to be utilized. ACT is still widely used for dosage adjustment of the heparin drip in many ECMO centers. During heparin infusion, ACT levels should be kept between 180 and 220 seconds . In the article "Low-Dose Heparin Anticoagulation During Extracorporeal Life Support for Acute Respiratory Distress Syndrome in Conscious Sheep", by Prat NJ et al. , a prospective cohort laboratory investigation was conducted to evaluate the coagulation function in an ovine model of oleic-acid induced acute respiratory distress syndrome supported with veno-venous ECMO. The experimental design approximated the time needed to transport from a battlefield setting to an advanced facility and compared bolus vs. standard heparin anticoagulation therapy. The study concludes that ECMO without anticoagulation may be a safe alternative in the early phase of trauma. However, despite being flexible for anticoagulant management, ECMO does not often have the components necessary to deal with an urgent cardiac surgery procedure. Relatively few published studies have examined these issues on CPB management in emergency cardiac surgery where the time factor is crucial for survival; in this context, I present the rationale for the use of modular minimally invasive extracorporeal circulation (MiECC). MiECC has been developed in an attempt to integrate all advances in CPB technology in one closed circuit that shows improved biocompatibility and minimizes the systemic detrimental effects of CPB. Despite well-evidenced clinical advantages, penetration of MiECC technology into clinical practice is hampered by concerns raised by perfusionists and surgeons regarding air handling together with blood and volume management during CPB . The modular MiECC circuit, bearing an accessory circuit for immediate transition to an open system that can be used in every adult cardiac surgical procedure, offers enhanced safety features. An interesting study in a series of 50 consecutive patients, "Modular minimally invasive extracorporeal circulation systems; can they become the standard practice for performing cardiac surgery?" by Anastasiadis K. et al. , shows that modular circuit design offers 100% technical success rate in a cohort of random, high-risk patients who underwent complex procedures, including reoperation and valve and aortic surgery, together with emergency cases. Since no evidence of increased thrombin formation was found from a laboratory standpoint, it was concluded that the use of MiECC with a reduced anticoagulation strategy seems possible. This alternative anticoagulation strategy leads to significant reduction in dosages of both heparin and protamine. We can confidently move forward with investigating this anticoagulation concept . However, to establish clinical safety of ACT < 300 seconds, larger clinical studies are needed. From my point of view, modern MiECC systems are completely closed circuits containing a membrane oxygenator and a tip-to-tip surface coating that would allow to the operators in critical anticoagulant management to establish, in a first stage, the CPB with a closed system similar to ECMO management, and once the anticoagulation parameters have been ascertained and verified during the CPB, it's possible to transform the system into conventional extracorporeal circulation management. REFERENCES 1 Shore-Lesserson L Baker RA Ferraris VA Greilich PE Fitzgerald D Roman P The society of thoracic surgeons, the society of cardiovascular anesthesiologists, and the American society of extracorporeal technology: clinical practice guidelines-anticoagulation during cardiopulmonary bypass Ann Thorac Surg 2018 105 2 650 62 10.1016/j.athoracsur.2017.09.061 29362176 2 Sarkar M Prabhu V Basics of cardiopulmonary bypass Indian J Anaesth 2017 61 9 760 7 10.4103/ija.IJA_379_17 28970635 3 Kamdar A Rintoul N Raffini L Anticoagulation in neonatal ECMO Semin Perinatol 2018 42 2 122 8 10.1053/j.semperi.2017.12.008 29336832 4 Prat NJ Meyer AD Langer T Montgomery RK Parida BK Batchinsky AI Low-dose heparin anticoagulation during extracorporeal life support for acute respiratory distress syndrome in conscious sheep Shock 2015 44 6 560 8 10.1097/SHK.0000000000000459 26263439 5 Anastasiadis K Antonitsis P Argiriadou H Deliopoulos A Grosomanidis V Tossios P Modular minimally invasive extracorporeal circulation systems; can they become the standard practice for performing cardiac surgery? Perfusion 2015 30 3 195 200 10.1177/0267659114567555 25564510 6 Bauer A Hausmann H Schaarschmidt J Szlapka M Scharpenberg M Eberle T Is 300 seconds ACT safe and efficient during MiECC procedures? Thorac Cardiovasc Surg 2019 67 3 191 202 10.1055/s-0037-1609019 29290078 |
Braz J Cardiovasc Surg Braz J Cardiovasc Surg rbccv Brazilian Journal of Cardiovascular Surgery 0102-7638 1678-9741 Sociedade Brasileira de Cirurgia Cardiovascular 36897819 10.21470/1678-9741-2023-0960 Editorial Venoarterial Extracorporeal Membrane Oxygenation in Cardiogenic Shock to Ventricular Assist Device or Heart Transplantation - Where Are We? Perazzo Alvaro MD 12 Anderl Lisa MD 3 Lima Ricardo de Carvalho MD-MSc, PhD 1 Wiedemann Dominik MD, PhD 3 Lorusso Roberto MD, PhD 2 1 Department of Cardiac Surgery, Pronto-Socorro Cardiologico de Pernambuco (PROCAPE), Universidade de Pernambuco, Recife, Pernambuco, Brazil. 2 Cardio-Thoracic Surgery Department, Heart and Vascular Center, Maastricht University Medical Center, Cardiovascular Research Institute Maastricht, Maastricht University, Maastricht, The Netherlands. 3 Department of Cardiac Surgery, Medical University of Vienna, Vienna, Austria. Correspondence Address: Alvaro Perazzo, E-mail: [email protected] Jan-Feb 2023 Jan-Feb 2023 38 1 IIII This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcCardiogenic shock (CS) is a complex, multifactorial, and highly morbid condition requiring interdisciplinary expertise and state-of-the-art management. Despite advances in therapeutic options, CS' 30-day mortality remains high, around 40-50% in contemporary randomized trials. CS is caused by impaired myocardial contractility, resulting in reduced cardiac output, end-organ hypoperfusion, and hypoxia. The inability to meet the body's metabolic demands due to diminished cardiac output leads to insufficient tissue perfusion . Acute myocardial infarction is the most common cause of CS (7-10%) . Various conditions eventually lead to CS, most commonly valvular regurgitation, ischemic and non-ischemic cardiomyopathy, pericardial disease, and arrhythmia. The American Heart Association emphasizes the importance of early monitoring and initial stabilization prior to invasive management . A variety of mechanical circulatory support (MCS) devices have been introduced with the goal of providing hemodynamic support and improving outcomes. The basic concept is that support and decompression of the ventricle lead to reduced myocardial stress and consumption of oxygen while increasing end-organ perfusion. Venoarterial extracorporeal membrane oxygenation (VA-ECMO) offers immediate circulatory support and concomitant gas exchange for patients with left and right ventricular failure . Despite the recognized advances of VA-ECMO , there are significant discrepancies in research concerning the hemodynamic implications of its long-term use. After restoring hemodynamic stability with adequate neurological and renal function, the following question arises: what is the next step after VA-ECMO - heart transplantation (HTx) or implantation of a ventricular assist device (VAD)? Fig. 1 Venoarterial extracorporeal membrane oxygenation implanted. VA-ECMO offers temporary bridge-to-recovery with restoration of normal cardiac function, bridge-to-bridge with implantation of temporary VAD, or bridge-to-destination with more durable left VAD or cardiac transplantation . Despite advances in therapeutic options for CS, the outcome and quality of life of these patients rely on multidisciplinary efforts, from technology and engineering of the device to surgical and intensive care expertise. Establishment of standardized protocols and the shock team's multidisciplinary cooperation and shared decision-making, including evaluation of timing and strategy to escalate or de-escalate MCS, are the primary aims of care. Fig. 2 Implant of left ventricular assist device (HeartMate 3TM). Institutional protocols and algorithms are fundamental to add more surveillance and improve outcomes for these patients. In case of impossibility of left ventricular recovery with intensification of VA-ECMO, referral to the VAD team must be considered, if the metabolic conditions are resolved and neurological assessment shows no diffuse lesions . In terms of VAD, the Impella CP(r) 5.0 and 5.5, intra-aortic balloon pump, TandemHeart(r), HeartMate 3TM, and Impella RP(r) provide possible options for these patients. Although VA-ECMO offers bridging to durable left VAD or HTx, the possibility of full cardiac recovery must be considered with daily cardiorespiratory tests evaluating the possibility of weaning. If VAD therapy proves to be ineffective, it is crucial to involve the HTx team, especially when transplant requirements are met and no contraindications for HTx arise. Orthotopic HTx is an effective alternative for patients requiring long-term support. Aiming for HTx after VA-ECMO is not straightforward; it is critical that protocols and institutions are well-connected with a national or international organization managing organ donation. The scarcity of donors, primary graft dysfunction, and other complications following transplantation are limiting factors of this procedure. At the same time, donation after circulatory arrest, hypothermic preservation, and ex-vivo heart perfusion are developing advances in HTx surgery that may allow for organ procurement from greater distances and prevention of early transplant failure . Some centers in Australia and Europe have pioneered HTx after cardiac death in response to the critical demand for donor hearts . The optimal timing to refer the patient for HTx remains unclear. Due to the many challenges and importance of shared decision-making, a shock-team is essential. It is crucial to define standard protocols and regularly educate the multidisciplinary team. In conclusion, recent developments in MCS technology have caused a paradigm shift in CS care with current consensus advocating for early use of VA-ECMO in refractory CS. VA-ECMO has progressed to the point where skilled practitioners initiate the device within minutes, providing complete cardiorespiratory support. After initial diagnosis, hemodynamic stabilization of the patient is essential. The decision-making to progress to more durable devices or HTx requires interdisciplinary teamwork by means of a shock team consisting of both HTx and VAD participants. There is a scarcity of current data on trends, results, and exit strategies of patients undergoing VA-ECMO for CS. Numerous options for escalating or de-escalating MCS exist, but determining the exact timing remains a challenging and crucial task. Further studies, protocols, and definitions of criteria are necessary to propose algorithms for improved patient management. REFERENCES 1 Henry TD Tomey MI Tamis-Holland JE Thiele H Rao SV Menon V Klein DG Naka Y Pina IL Kapur NK Dangas GD American Heart Association Interventional Cardiovascular Care Committee of the Council on Clinical Cardiology; Council on Arteriosclerosis, Thrombosis and Vascular Biology; and Council on Cardiovascular and Stroke Nursing Invasive Management of Acute Myocardial Infarction Complicated by Cardiogenic Shock: A Scientific Statement From the American Heart Association Circulation 2021 Apr 13 143 15 e815 e829 10.1161/CIR.0000000000000959 33657830 2 Harjola VP Lassus J Sionis A K.ber L Tarvasm.ki T Spinar J Parissis J Banaszewski M Silva-Cardoso J Carubelli V CardShock Study Investigators; GREAT Network. Clinical picture and risk prediction of short-term mortality in cardiogenic shock Eur J Heart Fail 2015 17 501 509 10.1002/ejhf.260 25820680 3 Kolte D Khera S Aronow WS Mujib M Palaniswamy C Sule S Jain D Gotsis W Ahmed A Frishman WH Trends in incidence, management, and outcomes of cardiogenic shock complicating ST-elevation myocardial infarction in the United States J Am Heart Assoc 2014 3 e000590 10.1161/JAHA.113.000590 24419737 4 Winiszewski H Guinot PG Schmidt M Besch G Piton G Perrotti A Lorusso R Kimmoun A Capellier G. Optimizing PO2 during peripheral veno-arterial ECMO: a narrative review Crit Care 2022 Jul 26 26 1 226 10.1186/s13054-022-04102-0 35883117 5 Lorusso R Shekar K MacLaren G Schmidt M Pellegrino V Meyns B Haft J Vercaemst L Pappalardo F Bermudez C Belohlavek J Hou X Boeken U Castillo R Donker DW Abrams D Ranucci M Hryniewicz K Chavez I Chen YS Salazar L Whitman G ELSO Interim Guidelines for Venoarterial Extracorporeal Membrane Oxygenation in Adult Cardiac Patients ASAIO J 2021 Aug 1 67 8 827 844 10.1097/MAT.0000000000001510. Erratum in: ASAIO J. 2022 Jul 1;68(7):e133. 34339398 6 Kowalewski M Zielinski K Gozdek M Raffa GM Pilato M Alanazi M Gilbers M Heuts S Natour E Bidar E Schreurs R Delnoij T Driessen R Sels JW van de Poll M Roekaerts P Pasierski M Meani P Maessen J Suwalski P Lorusso R Veno-Arterial Extracorporeal Life Support in Heart Transplant and Ventricle Assist Device Centres. Meta-analysis ESC Heart Fail 2021 Apr 8 2 1064 1075 10.1002/ehf2.13080 33337072 7 DeFilippis EM Khush KK Farr MA Fiedler A Kilic A Givertz MM Evolving Characteristics of Heart Transplantation Donors and Recipients: JACC Focus Seminar J Am Coll Cardiol 2022 Mar 22 79 11 1108 1123 10.1016/j.jacc.2021.11.064 35300823 8 Rajab TK Singh SK Donation After Cardiac Death Heart Transplantation in America Is Clinically Necessary and Ethically Justified Circ Heart Fail 2018 Mar 11 3 e004884 10.1161/CIRCHEARTFAILURE.118.004884 29664408 9 Tong CKW Khush KK New Approaches to Donor Selection and Preparation in Heart Transplantation Curr Treat Options Cardiovasc Med 2021 23 5 28 10.1007/s11936-021-00906-5 33776401 |
Braz J Cardiovasc Surg Braz J Cardiovasc Surg rbccv Brazilian Journal of Cardiovascular Surgery 0102-7638 1678-9741 Sociedade Brasileira de Cirurgia Cardiovascular 35657314 10.21470/1678-9741-2021-0547 Letters to the Editor Deep Sternal Wound Infection Following OPCAB: Delving Deeper into the Predisposition! Jose Jes MD 1 Magoon Rohan DM, MD 2 Kohli Jasvinder Kaur MD 2 Kashav Ramesh MD 2 1 Department of Cardiac Anesthesiology, Sri Jayadeva Institute of Cardiovascular Sciences and Research, Bengaluru, India 2 Department of Cardiac Anaesthesia, Atal Bihari Vajpayee Institute of Medical Sciences (ABVIMS) and Dr. Ram Manohar Lohia Hospital, Baba Kharak Singh Marg, New Delhi, India. Correspondence Address: Jan-Feb 2023 Jan-Feb 2023 38 1 213213 This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmcDear Editor, Predisposition to deep sternal wound infection (DSWI) following off-pump coronary artery bypass (OPCAB) grafting surgery classifies as an area of particular research interest. Given the fact that a sound evaluation of the risk factors for DSWI mandates a comprehensive approach, we wish to highlight a few important concerns pertaining to the Enginoev et al. study recently published in the Brazilian Journal of Cardiovascular Surgery. Interestingly, the index analysis does not outline diabetes mellitus as a preoperative risk factor for DSWI (30.2% in DSWI and 26.2% in non DSWI group, P=0.5) albeit the lack of data on perioperative glycaemic control deserves attention. Appropriate to the context, the Mayo Clinic research group delineate as high as 30% increase in adverse outcomes, including infective complications for every 20 mg/dL rise in mean intraoperative glucose levels . Moreover, specific literature linking glycaemic fluctuations with infective complications continues to accumulate over the past decade . Jarvela et al. found a significantly heightened rate of postoperative infections in their cardiac surgical cohort manifesting repeated hyperglycaemia (39.7% incidence) as opposed to normoglycaemic or those with single hyperglycaemic episode (12.1% and 8.2%, respectively, P=0.019). Furnary et al. reveal the independent DSWI predictive ability of post-cardiac surgery hyperglycaemia in the Portland Diabetic Project, wherein the subset with 48-hour mean blood glucose levels >200 mg/dL demonstrated a 2.2 times elevated risk of DSWI. Concomitantly, there is convincing evidence to suggest that perioperative glucose control with insulin infusion management protocols considerably attenuate the DSWI incidence[4-6]. Alongside the absence of perioperative glucose data, Enginoev et al. fail to describe the glucose management regime employed in their retrospective study . In addition, the authors could have elaborated whether or not any of the study participants were receiving preoperative corticosteroids . Herein, a comparative account of the preoperative leucocytic counts of the DSWI and non-DSWI groups could also have added incremental value . As much as we laud the endeavours of Enginoev et al. , the points of perioperative relevance elucidated by us and the authors' explanation would probably assist readers to comprehend this dynamic research area in a more holistic manner. REFERENCES 1 Enginoev S Rad AA Ekimov S Kondrat'ev D Magomedov G Risk Factors for Deep Sternal Wound Infection after Off-Pump Coronary Artery Bypass Grafting: a Case-Control Study [ahead of print] Braz J Cardiovasc Surg 2021 10.21470/1678-9741-2020-0444 2 Gandhi GY Nuttall GA Abel MD Mullany CJ Schaff HV Intraoperative hyperglycemia and perioperative outcomes in cardiac surgery patients Mayo Clin Proc 2005 80 862 866 16007890 3 Jarvela KM Khan NK Loisa EL Sutinen JA Laurikka JO Khan JA. Hyperglycemic Episodes Are Associated With Postoperative Infections After Cardiac Surgery Scand J Surg 2018 107 138 144 28934890 4 Furnary AP Wu Y Bookin SO Effect of hyperglycemia and continuous intravenous insulin infusions on outcomes of cardiac surgical procedures: the Portland Diabetic Project Endocr Pract 2004 10 Suppl 2 21 33 15251637 5 Kramer R Groom R Weldner D Gallant P Heyl B Glycemic control and reduction of deep sternal wound infection rates: a multidisciplinary approach Arch Surg 2008 143 451 456 18490552 6 Cotogni P Barbero C Rinaldi M Deep sternal wound infection after cardiac surgery: Evidences and controversies World J Crit Care Med 2015 4 265 273 26557476 7 Magoon R Choudhury A Sahoo S Malik V Steroids for adult cardiac surgery: The debate echoes on J Anaesthesiol Clin Pharmacol 2019 35 560 562 31920249 8 Dey S Kashav R Kohli JK Magoon R ItiShri Systemic Immune-Inflammation Index Predicts Poor Outcome After Elective Off-Pump CABG: A Retrospective, Single-Center Study J Cardiothorac Vasc Anesth 2021 35 2397 2404 33046365 |
PLoS Med PLoS Med plos PLOS Medicine 1549-1277 1549-1676 Public Library of Science San Francisco, CA USA 10.1371/journal.pmed.1004201 PMEDICINE-D-23-00416 Correction Correction: Anticipatory changes in British household purchases of soft drinks associated with the announcement of the Soft Drinks Industry Levy: A controlled interrupted time series analysis Rogers Nina T. Pell David Penney Tarra L. Mytton Oliver Briggs Adam Cummins Steven Rayner Mike Rutter Harry Scarborough Peter Sharp Stephen J. Smith Richard D. White Martin Adams Jean 13 3 2023 3 2023 13 3 2023 20 3 e1004201(c) 2023 Rogers et al 2023 Rogers et al This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Anticipatory changes in British household purchases of soft drinks associated with the announcement of the Soft Drinks Industry Levy: A controlled interrupted time series analysis pmcThis article was republished on February 13th, 2023, to incorporate revised data analyses (discussed below) and update the author list and funding statement. Please download this article again to view the correct version. The originally published, uncorrected article and the republished, corrected articles are provided here for reference. Data analysis updates In the process of conducting additional analyses exploring the impact of the UK Soft Drinks Industry Levy (SDIL) on purchasing of drinks and confectionary around 2 years post implementation, we identified an error involving a weighting variable that was incorporated into the data analyses reported in . One important use of weighting variables is to take account of the fact that the people who take part in surveys and other research do not always reflect the make-up of the whole population. For instance, women are often more likely than men to take part in research. Weighting variables can correct for these differences. They are widely used in health research. The data used in these papers is an extract from the Kantar WorldPanel household purchasing panel ). Households in the panel provide information on all grocery purchases brought home. Our data extract includes purchases of drinks, confectionary and toiletries but excludes all other purchases. Our analyses focus on changes in weekly purchases of drinks in different categories over time in relation to announcement and implementation of the UK Soft Drinks Industry Levy (SDIL), as well as of confectionary and toiletries. Two weighting variables were used in the analyses reported in the original published version of this article . Firstly, a design weight provided by Kantar takes account of who responds to the survey and is applied at the level of individual purchases to make the data more representative of Great Britain. Secondly, a household weekly weight was calculated by us to take account of possible differences in the number of households in Great Britain. Following detailed exploration, we concluded that the household weekly weight was miscalculated. Further, additional discussion with Kantar has confirmed that no additional household weekly weight is required and any changes in the household structure of Great Britain is taken into account in the design weight. In the updated version of the article the data were reanalyzed to exclude the household weekly weighting variable. Removal of this variable is the only change made to the analysis. The updated analyses were reviewed and approved by PLOS Medicine, with the caveat that neither the primary data nor aggregate data underlying the analyses were available to the Editors or statistical reviewer. Impact of the error on results As the erroneous household weekly weighting variable was used throughout the original analysis, removing it has affected all results-some by a negligible amount, others more substantively. Impact of error on conclusions This article reports on changes in household purchasing in the two years following announcement of the SDIL in 2016. We studied trends in purchasing from two years before the announcement to two years after the announcement, but before implementation (i.e. from 2014 to 2018). Based on analyses including the household weekly weighting variable, the original version of the article reported no statistically significant change in total volume of, or sugar from, soft drinks purchased. The reanalyses likewise did not indicate a statistically significant change in total volume of soft drinks purchased. However, when the household weekly weighting variable was excluded from the analyses we found a statistically significant increase in sugar purchased from soft drinks of 5.3g per household per week or 1.7%. The study's original conclusion was that "the announcement of the levy was associated with reductions in volume and sugar purchased in lower-levy-tier drinks [those with 5-8g sugar per 100ml] before implementation. These were offset by increases in sugar purchased from no-levy drinks [those with less than 5g sugar per 100ml]." The revised conclusion is that "the announcement of the levy was associated with reductions in volume and sugar purchased in lower levy tier drinks before implementation. These were offset by increases in purchasing of higher-levy [those with more than 8g sugar per 100ml] and no levy drinks." We interpret our findings as potentially reflecting "reformulation of drinks from the lower to no levy tier with removal of some, but not all, sugar, alongside changes in consumer attitudes, beliefs and purchasing behaviours." In other words, whilst the total volume of soft drinks did not seem to change following the announcement of the levy, there was a small increase in the amount of sugar households purchased in soft drinks. This means that at the point just before the levy was implemented, additional action (such as implementation of the levy) was required to achieve benefits to public health. Additional limitations of this study Aspects of the study methods are proprietary and were not available to the authors, editors, and reviewers. This includes whether/how data were cleaned or pre-processed before analyses reported in the PLOS Medicine article, details of how the design weight was calculated, and the "undisclosed propriety minimum value" in weekly household spending that was used as an exclusion criterion. Future work Our evaluation of the SDIL is ongoing. We have further work in process examining changes in purchasing around 2 years after implementation. We are also exploring how the SDIL impacted on purchasing differently in different households-according to their income and whether or not they included children. Other work is exploring the impacts of the SDIL on obesity in children, on dental health outcomes, on total diet, on longer term health in adults, and on the economy. Publisher's Note As is indicated in the article's Data Availability Statement , this study used proprietary data owned by Kantar Worldpanel, and interested readers should contact the data owner directly to request access. The primary data were not available to the editors or reviewers during pre-publication peer review or the post-publication evaluation of the data analysis errors and revisions. Due to this issue and the proprietary nature of some methodological details, PLOS Medicine has been limited in our ability to evaluate the data analyses and whether methods of data collection or processing impact the validity and generalizability of the article's results and conclusions. Supporting information S1 File Originally published, uncorrected article. (PDF) Click here for additional data file. S2 File Republished, corrected article. (PDF) Click here for additional data file. Reference 1 Rogers NT , Pell D , Penney TL , Mytton O , Briggs A , Cummins S , Rayner M , et al . (2020) Anticipatory changes in British household purchases of soft drinks associated with the announcement of the Soft Drinks Industry Levy: A controlled interrupted time series analysis. PLoS Med 17 (11 ): e1003269. doi: 10.1371/journal.pmed.1003269 33180869 |
Cureus Cureus 2168-8184 Cureus 2168-8184 Cureus Palo Alto (CA) 10.7759/cureus.34874 Plastic Surgery Radiology Imaging of Malar Silastic Implant Complications Muacevic Alexander Adler John R Carfagno Vincent F 1 Lopez Ramos Zahivette 2 Fierro Eleazar 2 Gutierrez Lazarus 2 Ahmed Imtiaz 3 1 MSIII, Midwestern University Arizona College of Osteopathic Medicine, Glendale, USA 2 MSIV, Universidad Autonoma Guadalajara School of Medicine, Jalisco, MEX 3 Radiology, Tempe St. Luke's Hospital, Tempe, USA Vincent F. Carfagno [email protected] 11 2 2023 2 2023 15 2 e3487411 2 2023 Copyright (c) 2023, Carfagno et al. 2023 Carfagno et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. This article is available from Facial cosmetic implants are utilized for definition enhancements in the malar, mandibular, and nasal regions. Though these implants are safe in the majority of patients, notable complications such as implant malpositioning may be seen. More rare but serious complications such as infection, abscess, and intrasinus migration may also occur, such as in this case reported on a 69-year-old female with a history of bilateral malar silicone implants. Imaging findings on this patient, whom initially presented with complaints of erythema and edema in the left malar region, were notable for edema and soft tissue signs of infection around a well-visualized crescent shaped maxillary implant. Penetration of the implant into the left maxillary sinus was also noted. Diagnostic imaging played a key role in determining the cause and severity of this patient's condition. Thus, the case reported is with an aim to familiarize radiologists with identifying and interpreting the complications of malar cosmetic implants on diagnostic imaging. intrasinus migration malar implant facial cosmetic surgery silicone implant cosmetic surgery radiology The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus. pmcIntroduction Malar augmentation consists of adding volume to either the malar or submalar space to elevate the surrounding subcutaneous tissues . Current techniques commonly involve the implantation of silastic shell implants due to their characteristic crescent shape and ability to match the contours of the underlying anatomy. Such implants are available in a variety of sizes and may be further customized intraoperatively. Despite their widespread use, complications have been well documented including pain at the implantation site, infection, esthetic dissatisfaction, extrusion, and intrasinus migration. These complications often require evaluation via diagnostic imaging and subsequent surgical treatment. The most common complication is thought to be implant malpositioning, whereas infection, abscess, and intrasinus migration are less commonly seen . With regard to alloplastic implants in the facial region, malar implants have been previously associated with the highest post-implantation infection rates at a rate of 2.67% . Clinically, implant infections can manifest as cellulitis, abscess, draining sinuses, and osteomyelitis. High-resolution computed tomography (HRCT) and MRI are effective imaging modalities for diagnosing and detecting the extent of such complications along with intrasinus migration . Case presentation We present a 62-year-old female with a four-year history of bilateral silicone malar implants that presented with a five-day history of left-sided facial swelling and erythema. The patient reported having bilateral malar implants placed for cosmetic purposes. The patient denied any other past medical history, prior facial trauma, or previous complications with her implants. CT imaging was performed on initial evaluation, displaying a visualized left malar implant penetrating into the ipsilateral maxillary sinus with left-sided zygomatic bony erosion . Abscess formation around the left maxillary sinus was also noted . Figure 1 Enhanced CT, axial view. Enhanced CT displaying left-sided facial swelling, edema, and abscess. Penetration of the left malar implant into the left maxillary sinus and abut the lamina papyracea is noted (A) with left zygomatic bony erosion secondary to osteomyelitis (B). Figure 2 Enhanced CT in coronal (A) and sagittal (B) views. Enhanced CT displaying abscess formation in coronal view (A) around a left malar implant penetrating into the left maxillary sinus in sagittal view (B). The patient required endoscopic sinus surgery for removal of the offending foreign body. Systemic culture-directed antibiotic therapy was also initiated. The patient's post-operative course was without complication following endoscopic removal. Discussion Silicone implants in the facial region are useful for cosmetic purposes due to their volume enhancing effects. While most of these implants are without post-operative complications, maladies do occur with malpositioning being the most common . Infection is also a possibility, particularly for implants in the malar region . Although the customary treatment of implant-related infections previously looked towards prospective removal of the foreign body, conservative alternatives have more recently been favored. Such alternatives include wound debridement and localized delivery of targeted antibiotic therapy . Intrasinus migration of malar implants, such as that reported in this case, is a rare development that complicates the use of the conservative alternatives described. Precedent reports have found foreign body removal as the more appropriate treatment in such cases . Although previous case analyses have recognized this complication to occur in a delayed fashion, greater than one to two decades post-operative, this case described is unique in that the patient presented with intrasinus migration four years subsequent to implant placement [6-8]. The use of HRCT and MRI plays a fundamental role in determining the severity of this rare but serious complication. The increasing use of such implants displays the importance in educating radiologists on methods of recognizing and interpreting signs of infection via diagnostic imaging modalities. While the diagnosis of an infected facial silicone implant begins with a thorough history and physical exam, identification of such implants on imaging, along with localized soft tissue changes suggestive of post-implantation infection or implant migration, is of key importance in diagnosing and interpreting the extent of such complications. Conclusions Silastic shell cosmetic cheek implants may result in complications such as infection, abscess and osteomyelitis, with symptoms including tenderness at the implantation site, swelling, warmth, and erythema. The uses of HRCT and MRI are advantageous imaging modalities that may aid clinicians in determining the severity and extent of malar implant complications. Human Ethics The authors have declared that no competing interests exist. Consent was obtained or waived by all participants in this study References 1 Malar augmentation with silicone implants Plastic Reconstruct Surg Ivy EJ Lorenc ZP Aston SJ 63 68 96 1995 2 Malar and submalar augmentation Facial Plast Surg Clin North Am Binder WJ Azizzadeh B 11 32 16 2008 18063245 3 Alloplastic facial implants: a systematic review and meta-analysis on outcomes and uses in aesthetic and reconstructive plastic surgery Aesthetic Plast Surg Oliver JD Eells AC Saba ES 625 636 43 2019 30937474 4 Imaging of cosmetic facial implants and grafts Am J Neuroradiol Schatz CJ Ginat DT 1674 1681 34 2013 22878009 5 Treatment of infected facial implants Semin Plast Surg Mohan K Cox JA Dickey RM Gravina P Echo A Izaddoost SA Nguyen AH 78 82 30 2016 27152100 6 Intrasinus penetration of a silastic malar implant, which resulted in chronic sinusitis: a case report and literature review Allergy Rhinol (Providence) Kim LY Schwartz JS Tajudeen BA Adappa ND Palmer JN 37 39 8 2017 28381326 7 Imaging of silastic cheek implant penetration into the maxillary sinus JAMA Otolaryngol Head Neck Surg Ginat DT Schatz CJ 199 201 139 2013 23429959 8 Bilateral erosion of malar implants into the maxillary sinuses Plast Surg Case Stud Dale EL Sargent LA 32 34 2 2015 |
MMWR Morb Mortal Wkly Rep MMWR Morb Mortal Wkly Rep WR Morbidity and Mortality Weekly Report 0149-2195 1545-861X Centers for Disease Control and Prevention mm7210a5 10.15585/mmwr.mm7210a5 Erratum Erratum: Vol. 72, No. 2 10 3 2023 10 3 2023 10 3 2023 72 10 268268 All material in the MMWR Series is in the public domain and may be used and reprinted without permission; citation as to source, however, is appreciated. SeitherR , CalhounK , YusufOB , Vaccination coverage with selected vaccines and exemption rates among children in kindergarten United States, 2021-22 school year. MMWR Morb Mortal Wkly Rep 2023;72 :26-32. 10.15585/mmwr.mm7202a2 pmcIn the report "Vaccination Coverage with Selected Vaccines and Exemption Rates Among Children in Kindergarten United States, 2021-22 School Year," multiple errors occurred. On page 26, in the eighth line of the first paragraph, the sentences should have read, "Nationwide, vaccination coverage with 2 doses of measles, mumps and rubella vaccine (MMR) was 93.0%P; with the state-required number of diphtheria, tetanus, and acellular pertussis vaccine (DTaP) doses was 92.7%**; with poliovirus vaccine (polio) was 93.1%++; and with the state-required number of varicella vaccine doses was 92.8%.SSSS Compared with the 2020-21 school year, vaccination coverage decreased 0.8-0.9 percentage points for all vaccines. Although 2.6% of kindergartners had an exemption for at least one vaccine,PP an additional 4.4% who did not have an exemption were not up to date with MMR." On page 27, in the fifth line of the first paragraph, the sentences should have read, "During the 2021-22 school year, immunization programs reported 3,835,130 children enrolled in kindergarten in 49 states and the District of Columbia.PPP Reported estimates are based on 3,536,546 (92.2%) children who were surveyed for vaccination coverage, 3,686,775 (96.1%) surveyed for exemptions, and 2,527,578 (65.9%) surveyed for grace period and provisional enrollment status." Also on page 27, in the first line of the second column, the sentences should have read, "Nationally, 2-dose MMR coverage was 93.0% (range = 78.0% [Alaska] to >=98.6% [Mississippi]), with coverage of >=95% reported by 14 states and <90% by nine states and the District of Columbia (Table). DTaP coverage was 92.7% (range = 78.0% [Alaska] to >=98.6% [Mississippi]); coverage of >=95% was reported by 15 states and of <90% by 12 states and the District of Columbia. Polio vaccination coverage was 93.1% (range = 77.1% [Alaska] to >=98.6% [Mississippi]), with coverage of >=95% reported by 14 states and <90% by 10 states and the District of Columbia. Varicella vaccination coverage nationally was 92.8% (range = 76.1% [Alaska] to >=98.6% [Mississippi]), with 13 states reporting coverage >=95% and nine states and the District of Columbia reporting <90% coverage." Also on page 27, in the third line of the third paragraph in the second column, the sentences should have read, "Nationwide, 4.4% of kindergarten students were not fully vaccinated and not exempt. Among the 35 states and the District of Columbia with MMR coverage <95%, all but four could potentially achieve >=95% MMR coverage if all nonexempt kindergartners who were within a grace period, provisionally enrolled, or otherwise enrolled in school without documentation of vaccination were vaccinated ." On page 28, the Table contained multiple errors. In the first row, labeled "National estimate," the value under the column heading "Kindergarten population" should have been 3,835,130, the value under the heading "2 Doses MMR" should have been 93.0, the value under the heading "5 Doses DTaP" should have been 92.7, and the value under the heading "4 Doses polio" should have been 93.1. In the 28th row, labeled "Mississippi," the value under the column heading "Kindergarten population" should have been 36,524; the value under the heading "2 Doses MMR" should have been >=98.6; the value under the heading "5 Doses DTaP" should have been >=98.6; the value under the heading "4 Doses polio" should have been >=98.6; the value under the heading "2 Doses VAR" should have been >=98.6; and the value under the heading "Grace period or provisional enrollment, %" should have been 1.0. On page 29, the last two sentences in the 13th footnote should have read, "****Data reported from 3,536,546 kindergartners were assessed for coverage, 3,686,775 for exemptions, and 2,527,578 for grace period or provisional enrollment. Estimates represent rates for populations of coverage (3,835,130), exemptions (3,835,130), and grace period or provisional enrollment (2,604,872)." On page 30, in the 13th line of the first paragraph, the sentences should have read, "MMR coverage of 93.0% translates to approximately 250,000 kindergartners who are potentially not protected against measles; clusters of unvaccinated and undervaccinated children can lead to outbreaks of vaccine-preventable diseases." Also on page 30, in the fourth line of the second paragraph, the sentence should have read, "Nationwide, 4.4% of kindergarten students were not fully vaccinated with MMR and not exempt, and this percentage increased in most states compared with 2020-21." On page 30, in Figure 1, the line for "MMR, 2 doses" for 2021-2022, should have indicated a value of 93.0%. On page 31, in Figure 2, the bar for "MMR coverage" among kindergartners for Mississippi should have indicated a value of 98.6%. The bar for "MMR not up to date and no exemption" for kindergartners in Delaware should have indicated a value of 2.4%, and for South Carolina, should have indicated a value of 4.6%. On page 32, in the Summary box, the second line in the second paragraph should have read, "An additional 4.4% without an exemption were not up to date with measles, mumps and rubella vaccine." Supplementary materials have also been corrected. |
MMWR Morb Mortal Wkly Rep MMWR Morb Mortal Wkly Rep WR Morbidity and Mortality Weekly Report 0149-2195 1545-861X Centers for Disease Control and Prevention 36893067 mm7210a7 10.15585/mmwr.mm7210a7 Quick Stats QuickStats: Percentage Distribution* of Cigarette Smoking Status+ Among Current Adult E-Cigarette Users,SS by Age Group National Health Interview Survey, United States, 2021P Reported by: Ellen A. Kramarow, PhD, [email protected]; Nazik Elgaddal, MS. 10 3 2023 10 3 2023 72 10 270270 All material in the MMWR Series is in the public domain and may be used and reprinted without permission; citation as to source, however, is appreciated. pmcIn 2021, 4.5% of U.S. adults were current e-cigarette users. Among adult e-cigarette users overall, 29.4% also were current cigarette smokers, 40.3% were former cigarette smokers, and 30.3% had never been cigarette smokers. Among e-cigarette users aged 18-24 years, 16.3% were current smokers, 22.3% were former smokers, and 61.4% had never been cigarette smokers. Among those aged 25-44 years, 30.6% were current smokers, 45.8% were former smokers, and 23.6% had never smoked cigarettes. Among those aged >=45 years, 42.7% were current smokers, 50.1% were former smokers, and 7.2% had never smoked cigarettes. Younger e-cigarette users were more likely to have never smoked cigarettes, and older e-cigarette users were more likely to be current or former cigarette smokers. Source: National Center for Health Statistics, National Health Interview Survey, 2021. For more information on this topic, CDC recommends the following link: * With 95% CIs indicated by error bars. + Current smokers are persons who have smoked at least 100 cigarettes in their lifetime and currently smoke cigarettes every day or some days. Never smokers are persons who have not smoked 100 cigarettes in their lifetime. Former smokers are persons who have smoked at least 100 cigarettes in their lifetime but do not currently smoke cigarettes. SS Current e-cigarette users are persons who have ever tried an e-cigarette or other electronic vaping product even once and are now using every day or some days. The percentage of adults aged >=18 years currently using e-cigarettes was 4.5%. P Estimates are based on household interviews of a sample of the civilian, noninstitutionalized U.S. population. |
GMS J Med Educ GMS J Med Educ GMS J Med Educ GMS Journal for Medical Education 2366-5017 German Medical Science GMS Publishing House zma001583 10.3205/zma001583 Doc1 urn:nbn:de:0183-zma0015834 Article Acknowledgement to the reviewers of GMS Journal for Medical Education Dank an die Gutachter des GMS Journal for Medical EducationFischer Martin R. *12 Fabry Gtz *13 1 GMS Journal for Medical Education, Chief Editor, Erlangen, Germany 2 University Hospital, LMU Munich, Institute for Medical Education, Munich, Germany 3 Albert-Ludwig-Universitt Freiburg, Institut fr Medizinische Psychologie und Soziologie, Freiburg, Germany *To whom correspondence should be addressed: Gtz Fabry, Albert-Ludwig-Universitt Freiburg, Institut fr Medizinische Psychologie und Soziologie, Rheinstrae 12, D-79104 Freiburg, Germany, E-mail: [email protected] 15 2 2023 2023 40 1 Doc110 1 2023 10 1 2023 10 1 2023 Copyright 2023 Fischer et al. 2023 This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 License. See license information at This article is available from pmcAcknowledgement We gratefully acknowledge the valuable contribution of the following peer reviewers, who supported our Journal in 2022. We are looking forward to continuing our collaboration! Reviewers in alphabetical order Christian Abshagen, Windisch Kambiz Afshar, Hannover Matthias Angstwurm, Mnchen Tsedeke Asaminew, Jimma (ET) Cadja Bachmann, Rostock Ivan Bank, Amsterdam (NL) Daniel Bauer, Bern (CH) Nicola Bauer, Kln Jan Becker, Mnster Marianne Behrends, Hannover Sven Benson, Essen Pascal Berberat, Mnchen Tanja Birrenbach, Bern (CH) Kerstin Bitter, Berlin Mozhgan Bizhang, Witten Sebastian Bode, Ulm Christoph Bohne, Frankfurt/Main Hans Martin Bosse, Dsseldorf Cindy Brandes, Osnabrck Barbara Braun, Mannnheim Andreas Breuer-Kaiser, Bochum Christoph Broding, Witten Monika Brodmann Maeder, Bern (CH) Irene Brunk, Berlin Petra Brzank, Nordhausen Heinz Hans Florian Buchner, Wien (A) Rainer Bscher, Essen Jean-Francois Chenot, Greifswald Iris Demmer, Gttingen Jana Deppermann, Oldenburg Andreas Dinkel, Mnchen Carsten Ding, Dsseldorf Fabian Dupont, Homburg Jan P. Ehlers, Witten Maren Ehrhardt, Hamburg Tobias Eichinger, Zrich (CH) Yannick G. Eller, Bern (CH) Caroline Elliott, Coventry (UK) Gundula Ernst, Hannover Rebecca Sarah Erschens, Tbingen Mona Eulitz, Witten Folkert Fehr, Sinsheim an der Elsenz Teresa Festl-Wietek, Tbingen Sabine Ingrid Fischbeck, Mainz Volkhard Fischer, Hannover Michael Freitag, Oldenburg Martin Gartmeier, Mnchen Robert Gaschler, Hagen Nadja Gebhardt, Heidelberg Waltraud Georg, Augsburg Heide Gtze, Leipzig Joachim Graf, Tbingen David Groneberg, Frankfurt/Main Claudia Gundacker, Wien (A) David Gurrea Salas, Windisch Jennifer Guse, Hamburg Stefan Gysin, Luzern (CH) Martin Haag, Heilbronn Petra Hahn, Freiburg Eckhart G. Hahn, Erlangen Houda Hallal, Kln Jonathan Harth, Witten Wolf Hautz, Bern (CH) Stephan Heermann, Freiburg Inga Hege, Augsburg Patrick Heger, Ulm Heike Hei, Ulm Linn Hempel, Halle/Saale Eva Hennel, Bern (CH) Martina Hebrgge, Essen Monika Himmelbauer, Wien (A) Margarethe Hochleitner, Innsbruck (A) Anke Hollinderbumer, Mainz Christopher Holzmann-Littig, Mnchen Angelika Homberg, Mannheim Mekonnen Asfaw Hussen, Addis Abada (ET) Sren Huwendiek, Bern (CH) Nana Jedlicska, Mnchen Laura Jung, Berlin Robert Jungwirth, Ulm Martina Kadmon, Augsburg Yassin Karay, Kln Christin Kleinsorgen, Hannover Fee Klupp, Heidelberg Katharina Knie, Freiburg Timm Knrr, Heidelberg Thomas Kollewe, Frankfurt/Main Felix Krause, Aachen Dana Kropff, Wrzburg Susanne Khl, Ulm Raphael Kunisch, Erlangen Katrin Kunze, Osnabrck Ute Lange, Bochum Wolf Langewitz, Basel (CH) Christoph Lanzen, Mainz Ronny Lehmann, Heidelberg Dorothea Lemke, Frankfurt/Main Nicola Litke, Heidelberg Henriette Lffler-Stastka, Wien (A) Sabine Ludwig, Berlin Karoline Lukaschek, Mnchen Cornelia Mahler, Tbingen Jan Matthes, Kln Juliane Mees, Wrzburg Susanne Michl, Berlin Valeria Milani, Frstenfeldbruck Equlinet Misganaw, Mnchen Andreas Mltner, Heidelberg Tobias Mhling, Wrzburg Laura Mller, Ulm Beate Mller, Kln Brigitte Mller-Hilke, Rostock Oliver Mnsterer, Mnchen Ede Nagy, Heidelberg Joachim Neumann, Halle/Saale Dino Carl Novak, Berlin Wolfgang chsner, Ulm Rdiger Ostermann, Mnster Saskia Pante, Heidelberg Dorothea Penders, Berlin Swetlana Philipp, Jena Maximilian Philipp, Frankfurt/Main Alexander Rahman, Hannover Patrick Rebacz, Witten Alexander Renkl, Freiburg Fabian Riedel, Heidelberg Caroline Riedel, Heidelberg Christina Rieger, Germering Bernd Romeike, Rostock Marco Roos, Augsburg Fredy-Michel Roten, Bern (CH) Miriam Rothdiener, Tbingen Thomas Rotthoff, Augsburg Martin Ruff, Ltjenburg Emma C. Ryan, New Haven (USA) Christian Scheffer, Witten Kristina Schick, Mnchen Ann-Kathrin Schindler, Augsburg Falk Schlegelmilch, Gttingen Achim Schneider, Ulm Michael Schn, Ulm Eva Schnefeld, Mnster Christian Schulz, Berlin Johannes Schulze, Frankfurt/Main Katrin Schttpelz-Brauns, Mannheim Simon Schwill, Heidelberg Roland Seifert, Hannover Thomas Shiozawa-Bayer, Tbingen Elizabeth Sierocinski, Greifswald Anne Simmenroth, Wrzburg Melanie Simon, Aachen Robert Speidel, Ulm Thomas Stadtmller, Mnchen Robin Stark, Saarbrcken Verena Steiner-Hofbauer, Wien (A) Beate Stock-Schrer, Witten Patrick Strasser, Ulm Fabian Stroben, Berlin Cynthia Szalai, Mlheim a.d. Ruhr Daniel Tolks, Hamburg Gert Ulrich, Zrich (CH) Christian Vajda, Graz (A) Sonya E. Van Nuland, New Orleans (USA) Wolfgang von Gahlen-Hoops, Kiel Yvonne Wagner, Stuttgart Michaela Wagner-Menghin, Wien (A) Robin Walter, Bern (CH) Stefan Watzke, Halle/Saale Marc Weidenbusch, Mnchen Jrgen Westermann, Lbeck Marie-Christin Willemer, Dresden Anja Zimmermann, Berlin Jan Zottmann, Mnchen Michaela Zupanic, Witten |
GMS J Med Educ GMS J Med Educ GMS J Med Educ GMS Journal for Medical Education 2366-5017 German Medical Science GMS Publishing House zma001584 10.3205/zma001584 Doc2 urn:nbn:de:0183-zma0015845 Article Friedrich Edelhauser: Wahrnehmen und Bewegen - Grundlagen einer allgemeinen Bewegungslehre Friedrich Edelhauser: Wahrnehmen und Bewegen - Grundlagen einer allgemeinen BewegungslehreScheffer Christian *1 1 Universitat Witten/Herdecke, Integriertes Begleitstudium Anthroposophische Medizin, Witten, Germany *To whom correspondence should be addressed: Christian Scheffer, Universitat Witten/Herdecke, Integriertes Begleitstudium Anthroposophische Medizin, Alfred-Herrhausen-Str. 50, D-58448 Witten, Germany, E-mail: [email protected] 15 2 2023 2023 40 1 Doc2Edelhauser Friedrich Wahrnehmen und Bewegen - Grundlagen einer allgemeinen Bewegungslehre. Stuttgart: Kohlhammer Verlag. 2022. 198 p.39,00 EUR ISBN: 978-3-17-036270-3 . 05 12 2022 27 12 2022 27 12 2022 Copyright (c) 2023 Scheffer 2023 This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 License. See license information at This article is available from pmcBibliographical details Friedrich Edelhauser Wahrnehmen und Bewegen - Grundlagen einer allgemeinen Bewegungslehre Kohlhammer Verlag, Stuttgart Year of publication: 2022, 198 pages, prizes: EUR 39,00 ISBN: 978-3-17-036270-3 Review How does a human being move? Are his actions an expression of his primary motor cerebral cortex or do they reflect the intentions of a human individuality? How do we see? Are we passive recipients or do we have to actively shape our seeing? What results from approaching these questions by bringing together scientific and phenomenological-philosophical insights? Can guiding viewpoints for person-centered medicine be gained from this? These questions are illuminated comprehensively and in many ways in the newly published book "Wahrnehmen und Bewegen - Grundlagen einer allgemeinen Bewegungslehre" (Perceiving and Moving - Foundations of a General Theory of Movement) by Friedrich Edelhauser. In doing so, the author takes us to astonishing phenomena, to reflections worth considering, and to profound questions. Using the example of looking at a mountain landscape, the first phenomena of seeing are looked at: our gaze goes inwardly through the picture, searching for various objects and contours and arranging the details into a meaningful overall context. What at first appears to be fixed thus becomes experienceable as a process. In the "objectifying" view of physiology, vision is characterized as a process akin to a camera in which light passes through a lens onto the retina and then leads to electrochemical nervous processes. In this process, the qualitative perceptions melt down into a measurable but qualityless process. Vision thus becomes an example of the stimulus-response sequence, in which an external sensory stimulus becomes electrochemical processes inside, i.e. in the brain, and is answered with a reaction. Thereby not only the quality of the perceived disappears, but also the perceiving person. In the following, this so-called third-person-perspective as an objectifying approach is supplemented by introspection, the first-person-perspective. In chapter 5 "perceiving and moving" the process of seeing is examined more closely. In doing so, one becomes aware of the fact that seeing includes an inner scanning of the contour to be perceived. This unconscious movement of the eyeballs can be represented technically and shows individual movement patterns, similar to gait or handwriting. If this movement is suppressed, the perceived blurs to a gray-in-gray for a short time due to the lack of contrast. During further analysis, it is noticeable that one is not only aligned to the object to be seen with one's eye muscles, but with one's entire head and body posture. Only this self-movement makes seeing possible. Something similar can be shown for hearing and other sensory modalities. Looking back at the mountain landscape, it becomes clear that there is a circular relationship, the perception of the image and the contours that can be found in it are guiding the scanning movements of the eye, which in turn are conditions for what is to be seen. Thus, there is no monocausal relationship with temporal succession, but a mutually dependent one. In chapter 6 the Gestalt circle of W. V. Weizsacker is introduced and the mutual enabling of perceiving and moving is examined in more detail. The organism-environment relationship is constituted in an encompassing, circular process of perception and movement. Intentional attention is now examined as a further object of investigation. On the basis of optical examples, in which one can see different things in the same form context depending on intention (e.g. either a transparent cube oriented to the front or to the back), it becomes clear that perception is not something simply given or depicted, but something given up, something produced by a directed, intentional act of perception. This intentional attention influences my seeing in different ways, so it can change between center and periphery, between foreground and background, between future and past. The sensually given is not unambiguous in the way it appears, but is accessible to ambiguous interpretations. Chapter 7 now turns to human movement. In the sense of the stimulus-response model, one assumes here in the traditional conceptions a purely efferent process, in which from the center, the brain, a movement impulse goes over motor nerves to the target musculature and triggers the movement. Here, too, the book comes up with exciting phenomena. For example, the case of Ian Waterman, who, at the age of 19, falls ill with a viral infection and within a few days loses both his sense of touch and proprioception, and thus his sense of position and orientation of his limbs, from the neck down. Thus, he also loses the ability to move at the same time, since this requires not only an efferent nervous structure, but also a perception of the context of movement. The patient solves this with an extraordinary achievement by compensating the missing sense of movement by the sense of sight in a laborious learning process and by controlling the movement by seeing the limb movements. From this - and from specific experiments - it becomes clear that a movement that is meaningfully placed in context only becomes possible through a complex interplay of efferent and afferent processes, which at the same time require the intentional shaping of the subject. Thus, moving presupposes perceiving and vice versa. The intentional shaping processes are called self-movement, following Aristotle. Both, perceiving and moving, are thus circularly causally connected processes, which do not function meaningfully without the respective other part. At the same time, it becomes clear that individual intentionality becomes effective in the way in which perceiving is controlled via self-movement and moving is controlled via perception. Thus, not only the brain or the nervous system is an expression of individuality, but also the organization of movement. This basic idea is continued in the further chapters with Rudolf Steiner's functional threefold structure as well as with modern embodiment research, which is concerned with the question of how the entire body is in resonance with the experience and intentions of an individuality. Specific therapeutic-physiological issues are also addressed, including the question of how everyday movements as well as meditative forms of movement such as therapeutic eurythmy affect cardiovascular regulation. The book spans a wide range from everyday phenomena to exciting case presentations and reflection on one's own perceptual processes to very fundamental philosophical and anthropological questions. This is at times demanding, but at the same time fruitful and stimulating. Is there a need for such a book in the education of physicians and further health professionals? I would have wished for such a book in my medical education, in which physiological processes are presented so clearly and brought into the context of fundamental anthropological questions. The otherwise frequent separation into "objective" physiology, which leaves out the inner human being, and a philosophical approach, which at the same time leaves out the basic science conditions, are here brought together in an exciting, easily comprehensible and illuminating way. From this can be derived not only helpful points of view for a medicine that perceives the individuality of a human being in the intentionality of his perceptions and movements, in his self-movement and in his entire bodily expression, but also for teaching. For here, too, we often have a passive image of the learners, who primarily have to absorb content, while we give insufficient space to the inner intentional self-movement of the students. Competing interests The author declares that he has no competing interests. |
Ann Med Surg (Lond) Ann Med Surg (Lond) MS9 Annals of Medicine and Surgery 2049-0801 Lippincott Williams & Wilkins Hagerstown, MD 10.1097/MS9.0000000000000109 00047 3 Short Communications Impact of mystical belief and traditional healing on the health-seeking practice of conversion disorder in low-income countries Sumbal Anusha MBBS [email protected] Baig Mirza M.A. MBBS [email protected] Sumbal Ramish MBBS [email protected] Dow University of Health Sciences, Karachi, Pakistan * Corresponding author. Address: Dow University of Health Sciences, Baba-E-Urdu Road, Karachi 74200, Pakistan. E-mail address: [email protected] (A. Sumbal). 3 2023 17 2 2023 85 3 567568 2 11 2022 22 12 2022 Copyright (c) 2023 The Author(s). Published by Wolters Kluwer Health, Inc. 2023 This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Conversion disorder is a somatoform condition in which patients present with a range of neurologic deficits and sensorimotor loss with no obvious pathology. There has been a rising trend in the incidence of conversion disease in countries with low socioeconomic backgrounds, accounting to be one-third of ambulatory visits in middle and low-income countries (MLIC). However, even with such a high prevalence health-seeking practice for conversion disorder is low in MLIC. One possible reason for such behavior could be the high prevalence of mystical beliefs and traditional healing in MLIC. Existing economic distress with limited healthcare resources convinces people to opt for traditional and local healers who make use of mystical and superstition beliefs prevalent in those regions to offer prospering and cheaper methods of treatment. In this scenario, addressing and counseling mythological fallacies and the use of an economically friendly 'holistic model' of treatment should be adopted in these countries. Keywords: conversion disorder mystical belief socioeconomic status OPEN-ACCESSTRUE pmcImpact of mystical belief and traditional healing on the health-seeking practice for conversion disorder in low-income countries (MLICs). Functional neurological symptom disorder, popularly known as conversion disorder is a type of somatoform disorder in which a patient presents with severe motor and sensory symptoms such as paralysis, tremor, and seizure1. Since this is a psychiatric illness and not any neuropathology, even on detailed radiologic imaging and an extensive blood workup, there is no conclusive finding1. There has been an increasing trend in the incidence of conversion disorder in MLICs over the past couple of decades2. It accounts for the second-leading cause of neurology consults and about one-third of new patients in ambulatory emergency visits are cases of conversion disorder patients2. Especially in countries with low socioeconomic status, conversion disorder is becoming increasingly endemic. In Monroe County, United States spikes of 854 new patients were reported in just a time of 5 years2. Similarly, in South East Asia, conversion disorder stands for 12.4% of admission in Psychiatric wards1. Even with such a high prevalence of conversion disorder, the health-seeking behavior by the family and patients of conversion illness in MLICs is very poor2. The reporting ratio of patients with symptoms of conversion in these regions is as low as 0.2%, and the psychiatric consultation rate for diagnosed conversion disorder patients is less than 5%2. Such a decrease in health-seeking behavior could be due to many reasons, such as misconception, wrong or delayed diagnosis, poor counseling, and a lack of documented evidence for 'medically unexplained symptoms' in conversion disease3. One such reason includes the high prevalence of mystical belief and traditional healing, particularly in middle-income countries4. In MLICs, the use of a biomedical model to treat mental illness is way too limited, whereas the use of traditional and spiritual healing is greater than 70%4. Such a profound establishment of mystical belief and superstition has been a consequence of illiteracy, limited healthcare standards, and a high poverty rate5. In MLICs, the chain of healthcare and infrastructure are weak, medical assistance is expensive, and the threshold of inflation is far beyond reach6. Here the role of traditional healers comes into play6. These traditional local healers make use of the fear and financial limitations of these populations to make them believe that a mystical or supernatural force is causing these 'unexplained symptoms' in them5. They also integrate elements of cultural and religious ideologies to support their superstition, promising to get rid of their pain and illness6. Taking into account the financial crisis, it is quite convincing to the people of middle-income countries (MLIC) to choose this cheaper and easier-to-access method of healing rather than opting for a proper healthcare consultation and medical assistance, which is relatively expensive for them5. Also to mention that the costly treatment regime and follow-up fees significantly contribute to the hesitation toward medical assistance6. The role of superstition in MLICs is so strong that its account to be a key factor in health care decisions and that up to 80% population of MLIC it is considered completely normal to seek traditional healing for common diseases5. These methods are cheap, convincing, and culturally significant thus, approaching local faith healers and use of medicinal herbs is economically and socially easier for them, thus, patients and families of conversion illness do not even show up to healthcare and are reluctant to use expensive pharmacologic agents available which seems unsatisfactory to them4. According to the literature, 73% of patients with conversion disorder and their families approached local faith healers as the first line of treatment7. Whereas, 33% used traditional remedies, herbs, and hypnosis to treat their patients7. It was quite unfortunate that seeking healthcare support is not the foremost choice of people, possibly because these countries have quite limited access to a modern medicinal framework which outcasts their ability to understand the pathophysiology of these and easily fabricate it to already existing mythologies and paranormal beliefs4. The mindset of these subjects behind their neglecting psychiatric help is that around one-third of them firmly believe that a 'supernatural' force is causing these symptoms7. A French neurologist, Hippolyte Bernheim, pointed out that it was not until the 19th century that conversion disorder was considered hysterical; before this, it was popularly considered a 'demonic possession'8. Therefore, this popular mystical belief in MLICs convinces the common people that evil spirits and metaphysical forces are the causative agents4. That is why about 27% of patients who used amulets (sacred stones) found a cure, and a significant group used herbs and home remedies rather than using the correct medicines and psychiatric support available4,7. Now, this is a medical challenge for MLICs. Increasing conversion disorder patients and decreasing health-seeking approaches are an emerging threat to the future healthcare system in the regions. In this entire scenario, we need a multipronged approach to integrate possible control over these fallacies, myths, and mystical beliefs9. Taking into account the financial status of patients' limited use of anticonvulsive and antidepressive medicine and the dominant use of cognitive behavioral therapy, mindfulness, and psychodynamic therapies should be preferred3,9. These therapies are relatively inexpensive and easy to communicate, thereby increasing patient compliance and adherence to treatment9. Also, the use of older labels such as 'pseudoseizure' or 'false/hysterical paralysis' creates a negative energy of self-blame and guilt in patients, we encourage psychiatrists to use terms like 'converted' or 'somatization' which reduce stigmatization and minimizes psychological distress in the patients3,9. Even rather than directly refuting patient cultural values and mythical beliefs, integrating cultural, and social beliefs with psychological help to create a 'holistic model' of treatment should be adopted9. Valuing a patient's traditional and financial background helps to establish a bond of trust and respect between healthcare and patients3,4. Nevertheless, financial aid and the dispersion of modern health facilities in these countries would create a better long-term perspective result4. Hence, we believe that the high prevalence of mystical belief in MLICs could be a potential barrier to a proper understating and health-seeking practice of conversion disorder. Ethical approval Not applicable. Consent Not applicable. Sources of funding None to declare. Author contribution A.S., M.M.A.B., and R.S.: concept and writing the paper. Conflicts of interest disclosure None to declare Research registration unique identifying number (UIN) 1. Name of the registry: not applicable. 2. Unique identifying number or registration ID: not applicable. 3. Hyperlink to your specific registration (must be publicly accessible and will be checked): not applicable. Guarantor None to declare. Provenance and peer review Not commissioned, externally peer-reviewed. Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article. Published online 17 February 2023 References 1 Farooq S . Conversion Disorder - A Dilemma Facing the Psychiatrist in Developing Countries. J Pak Psy Soc; 2007;4 :60-2. 2 Stefansson JG Messina JA Meyerowitz S . Hysterical neurosis, conversion type: clinical and epidemiological considerations. Acta Psychiatr Scand 1976;53 :119-38.1251758 3 Canna M Seligman R . Dealing with the unknown. Functional neurological disorder (FND) and the conversion of cultural meaning. Soc Sci Med 2020;246 :112725.31911360 4 Kpobi L Swartz L . 'That is how the real mad people behave': Beliefs about and treatment of mental disorders by traditional medicine-men in Accra, Ghana. Int J Soc Psychiatry 2018;64 :309-16.29529921 5 Uwayezu D Ntigura E Gatarayiha A . Conflict between science and superstition in medical practices. Int Med Educ 2022;1 :33-42. 6 Green B Colucci E . Traditional healers' and biomedical practitioners' perceptions of collaborative mental healthcare in middle-income countries: a systematic review. Transcult Psychiatry 2020;57 :94-107.31937197 7 Akhtar J Haq MMU Awan N . Beliefs and attitudes of family members towards patients suffering from conversion disorder. J Pak Psychiatr Soc 2013;10 :21-4. 8 Kechichian E Khoury E Richa S . Religious stigmata: a dermato-psychiatric approach and differential diagnosis. Int J Dermatol 2018;57 :885-93.29624652 9 O'Neal MA Baslet G . Treatment for patients with a functional neurological disorder (conversion disorder): an integrated approach. Am J Psychiatry 2018;175 :307-14.29606068 |
Ann Med Surg (Lond) Ann Med Surg (Lond) MS9 Annals of Medicine and Surgery 2049-0801 Lippincott Williams & Wilkins Hagerstown, MD 10.1097/MS9.0000000000000162 00042 3 Correspondence Metallic nanoparticle-coated sutures: a breakthrough in the field of surgery Khan Abdul Moiz MBBS [email protected] a Shahnoor Syeda MBBS [email protected] Sajjad Aliza BDS [email protected] a Ayub Medical College, Abbottabad b Dow University of Health Sciences, Karachi c Peshawar Dental College, Peshawar, Pakistan * Corresponding author. Address: Ayub Medical College, Abbottabad 22040, Pakistan.Tel.: +92 992 9311100 E-mail address: [email protected] (A.M. Khan). 3 2023 17 2 2023 85 3 555556 2 12 2022 24 12 2022 Copyright (c) 2023 The Author(s). Published by Wolters Kluwer Health, Inc. 2023 This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. OPEN-ACCESSTRUE pmc Dear Editor, Surgical site infections (SSIs) are postoperative infection manifestations at the site of surgery performed. SSI is prevalent at a high rate of 1.2-5.2% in developed countries1. Amongst hospital-acquired infections, SSIs are the most costly and common, with a 20% presentation2. SSIs increase mortality risk by 2-11 folds and extend hospital stay by 9.7 days2. Patients with SSIs are vulnerable to a higher risk of hospital readmissions, longer ICU stays, and various other postoperative complications, thus not only causing financial stress on the patients but also burdening the economy and healthcare system of the country1. SSI occurs due to microbial invasion and pathogenesis at the surgical site. It mostly begins with contamination by local microflora or environmental pathogens. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Citrobacter species are the common bacteria involved in SSIs3. Duration of surgery, length of preoperative hospital stays, preexisting infections, and diabetes are some of the leading risk factors for nurturing microorganisms that lead to SSIs1. The presence of any sort of foreign materials, like surgical implants and dressing on a wound, provides an anchoring surface for bacterial invasion1. Similarly, sutures also act as prosthetic implants and biofilms have been identified to form over them. They provide conductive material for the adherence and colonization of infection-causing agents. Therefore, sutures coated with a wide-range antibiotic like triclosan started being used for surgeries, preventing it from becoming a nidus for biofilm and infection4. However, unfortunately, these antibiotics are progressively losing their effectiveness due to antibiotic resistance. In recent years, studies around metallic nanoparticles (NPs) have been the topic of interest because NPs not only exhibit antibacterial properties but are also nontoxic to mammalian cells, and bacteria develop less resistance to metals5. The possibilities of applying metallic NPs to sutures have also been explored. In the latest work by Vieira et al.6, a novel technique was developed to successfully coat different metallic NPs on surgical sutures, and their antibacterial potentials were studied. Synthetic absorbable PDS-II (polydioxanone) sutures made of polyester were used for this study. Metallic NPs were then coated on these sutures by the dip-coating method. Different aqueous solutions were prepared for each metal NP (ZnO, TiO2, Fe2O3, Cu, Cu2O, and MgO) by taking 25 ml of ultrapure water and adding 0.1 M Na2SO4, 30 mM of ascorbic acid and the desired NP in it. The PDS-II sutures were then individually dipped in liquid while the solution was continually agitated mechanically. A thin layer of silk fibroin was then applied to prevent the detachment of NPs. This method of the coating was analyzed to preserve the strength, elasticity, and degradability of PDS-II sutures. The success of the experiment was based on calculations analyzing the antibacterial properties against P. aeruginosa and S. aureus, and the extent of minimal cytotoxicity that was exhibited by metallic NP-coated sutures. Metallic NP coatings displayed strong antibacterial properties, as indicated by the percentage of bacteria killed, which varied from 40% for MgO-coated sutures to about 90% for Fe2O3, compared to 15% for bacteria killed by uncoated PDS-II sutures after 7 days. Also positively, all sutures displayed minimal cytotoxicity, that is cell viability greater than 70%, supporting the hope of metallic NP-coated sutures being used as potentially viable postoperative antibacterial therapy. Innovations are always of prime importance in the field of medicine. Over the years, developments have been made to prevent SSIs. Metallic NP-coated sutures are highly effective against SSIs, cost-friendly, and easily applicable. Because of the promising results displayed, further advanced research should be conducted on its viability so that the complications caused by SSIs can be minimized. If additional research supports the efficiency of metallic NP-coated sutures, they would be a promising breakthrough. Ethical approval Not required. Patient consent Not needed. Sources of funding Not applicable. Author contribution All authors equally contributed. Conflicts of interest disclosure There are no conflicts of interest. Research registration unique identifying number (UIN) None. Guarantor Syeda Shahnoor, Department of Internal Medicine, Dow University of Health Science, Karachi, Pakistan. E-mail: [email protected] Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article. Published online 17 February 2023 References 1 Chua RAHW Lim SK Chee CF . Surgical site infection and development of antimicrobial sutures: a review. Eur Rev Med Pharmacol Sci 2022;26 :828-45.35179749 2 CDC Surgical Site Infection Event (SSI), 2022. Accessed 20 October 2022. 3 Negi V Pal S Juyal D . Bacteriological profile of surgical site infections and their antibiogram: a study from resource constrained rural setting of Uttarakhand State, India. J Clin Diagn Res 2015;9 :DC17. 4 Leaper D Wilson P Assadian O . The role of antimicrobial sutures in preventing surgical site infection. Ann R Coll Surg Engl 2017;99 :439.28660816 5 Crane JK . Metal nanoparticles in infection and immunity. Immunol Invest 2020;49 :794-807.32524902 6 Vieira D Angel SN Honjol Y . Engineering surgical stitches to prevent bacterial infection. Sci Rep 2022;12 :834.35039588 |
Ann Med Surg (Lond) Ann Med Surg (Lond) MS9 Annals of Medicine and Surgery 2049-0801 Lippincott Williams & Wilkins Hagerstown, MD 10.1097/MS9.0000000000000251 00044 3 Correspondence The outbreak of shigellosis in Sweden as a looming concern for public health: a correspondence Kaur Navneet MBBS [email protected] Satapathy Prakasini PhD [email protected] b Neyazi Ahmad MD [email protected] Padhi Bijaya K. PhD [email protected] a Department of Geography, Jamia Millia Islamia, New Delhi Departments of b Virology c Community Medicine and School of Public Health, Postgraduate Institute of Medical Education and Research, Chandigarh, Punjab, India d Afghanistan Center for Epidemiological Studies, Herat, Afghanistan * Corresponding author. Address: Afghanistan Center for Epidemiological Studies, Herat, 3001, Afghanistan. Tel./Fax: 0093790617023. E-mail address: [email protected] (A. Neyazi). 3 2023 17 2 2023 85 3 559560 4 1 2023 8 1 2023 Copyright (c) 2023 The Author(s). Published by Wolters Kluwer Health, Inc. 2023 This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. SDCT OPEN-ACCESSTRUE pmc Dear Editor, Since the middle of November, an increasing number of cases of Shigella infection with a travel connection to Cape Verde have been reported in Sweden. On 22 December 2022, the Swedish Public Health Agency, Folkhalsomyndigheten, reported 30 cases of shigellosis with a travel connection to Cape Verde that had been reported in Sweden since mid-November. So far, 11 bacterial isolates have been identified: nine Shigella sonnei and two Shigella boydii 1. European countries such as the Netherlands, Denmark, France, Germany, Portugal, and the United Kingdom have reported cases of Shigella infection associated with Cape Verde travel histories2. Several countries have taken notice of the spread of infection in Cape Verde and informed the European Centre for Disease Prevention and Control and WHO. Infections with various intestinal pathogens, such as Enterohemorrhagic Escherichia coli, Campylobacter, Cryptosporidium, and Giardia, have also been reported among Swedish travelers. Shigella infection associated with travel to Cape Verde has been a persistent issue. This, along with the presence of various species of Shigella and intestinal infections, suggests contamination by food. Shigella bacteria are extremely virulent enteric pathogens that inflict shigellosis, an intestinal infection. The most prominent mode of transmission of Shigella spp. is fecal-to-mouth contact, which is transmitted from person to person. The main transmission occurs through contaminated food and water. An infected person may experience stomach pain, fever, blood and mucus, and dysentery3. Shigella is classified into 43 serotypes and four species or subgroups (A, B, C, and D). Historically, subgroup A is designated as Shigella dysenteriae, subgroup B as Shigella flexneri, subgroup C as S. boydii, and subgroup D as S. sonnei 4. Although infections occur worldwide and among people of all ages, prevalent infections are among 1-4-year-olds in middle-income settings. and infected by S. flexneri and S. sonnei account for most of the infection burden. In the 1970s, a distinct epidemiological niche for Shigella became a sexually transmitted disease among men who have sexual relations with other men (MSM). In 2009, uncommon serotypes (S. flexneri 3a) emerged in England and Wales in the MSM community and expanded across continents among the MSM community to low-risk regions of shigellosis4. S. sonnei causes travel-associated shigellosis in high-income countries among people who have visited places with a high prevalence of endemic diseases and a periodic upsurge caused by S. flexneri. The WHO reports that there are at least 80 million cases of shigellosis per year, with about 700 000 deaths5. Shigellosis contracted during travel can result in the transmission of antimicrobial-resistant Shigella to new population groups. The potential for long-term disability from postinfection complexities such as irritable bowel syndrome and reactive arthritis, in addition to the potential of outbreaks in tourist groups and military deployments. During the 18th and 19th centuries, Shigella infection was a prevalent and severe disease in Sweden. According to the Annual Report (1998), there were 7078 cases of Shigellosis found in Sweden between 1989 and 19986. Approximately 200-400 cases are reported annually in Sweden, most of which were infected overseas, such as in Turkey, India, and Egypt. S. sonnei is the most prevalent species in Sweden now. The number of cases of Shigella infection reported in 2008, 2009, and 2015 was 157, 50, and 43, respectively. In poor hygiene settings, it is very uncommon for infections to spread directly from person to person, and secondary cases are quite common during outbreaks in Sweden. Typically, the shedding period is less than 4 weeks, but substantially longer carriers are possible. Due to the low infectious dose, around 10-100 bacteria are sufficient to cause disease. When bacteria are in the feces through culture, a diagnosis can be determined. The approach is unreliable since bacteria are quickly killed during sample transfer7. The cases of S. sonnei associated with hotel stays in Cape Verde have so far been confined to European travelers. Consequently, concerns have been raised about the hygiene and sanitation standards of hotels in Cape Verde8. There is no vaccination present. Due to the low infectious dose, the infection can quickly spread from person to person, making strict hygiene imperative. The food industry should be especially aware of the potential for Shigella infection. Antibiotics are frequently prescribed both to reduce the symptoms of the disease and to prevent its spread. Along with other hygiene practices, regularly washing of hands with soap and running water can help prevent infection9. Livsmedelsverket, the Swedish food agency, advises travelers traveling abroad, as many countries have higher incidences of disease-causing bacteria and parasites in contaminated food10. Shigella is a significant cause of worldwide morbidity and mortality, impacting young children in places with few resources disproportionately. An insignificant infectious inoculum and lapses in hygiene and sanitation enable Shigella to evade control measures, and the global expansion of strains resistant to current first-line treatments impedes treatment success. The global spread of Shigella strains that are resistant to multiple drugs has been fueled by international travel, and since some Shiga toxin-producing strains could be very dangerous, the world desperately needs to be on guard shield4. Ethical approval NA. Consent NA. Sources of funding None. Author contribution All authors are equally contributed. Conflicts of interest disclosure None. Research registration unique identifying number (UIN) None Guarantor Ahmad Neyazi. Provenance and peer review Not commissioned, externally peer reviewed. Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article. Supplemental Digital Content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's website, www.annalsjournal.com Published online 17 February 2023 References 1 Folkhalsomyndigheten Shigella infection (Cape Verde, International November 2022-), 22-12-2-2022. Accessed 1 January 2023. 2 European Centre for Disease Prevention and Control. Communicable Disease Threat Report, Week 45, 6-12 November 2022. Accessed 1 January 2023. 3 Foster T . Staphylococcus Medical Microbiology, 4th ed. University of Texas Medical Branch at Galveston; 1996. 4 Kotloff KL Riddle MS Platts-Mills JA . Shigellosis. Lancet 2018;391 :801-12.29254859 5 WHO. Extensively Drug-resistant Shigella sonnei infection - Europe-European Region (EURO). Accessed 24 March 2022. 6 Infection Protection Institute. Infectious Diseases in Sweden 1998, Annual Reports of the Epidemiology Unit. Accessed 1 January 2023. 7 Folkhalsomyndigheten. Disease information about shigella infection. Infectious diseases. Accessed 1 January 2023. 8 EU/Schengen. EU & UK reports Shigella Infection Cases liked to Recent Travel to Cape Verde, Schengenvisa News. Accessed 1 January 2023. 9 Centres for Disease Control and Prevention. Shigella Prevention and Control Toolkit. Accessed 1 January 2023. 10 Advice for Traveling Abroad. Livemedelsverket. Accessed 1 January 2023. |
World J Nucl Med World J Nucl Med 10.1055/s-00052852 World Journal of Nuclear Medicine 1450-1147 1607-3312 Thieme Medical and Scientific Publishers Pvt. Ltd. A-12, 2nd Floor, Sector 2, Noida-201301 UP, India 10.1055/s-0042-1757251 11921 Case Report 18 F-FDG PET-CT Evaluation of Primary Adrenal Ewing Sarcoma with Venous Thrombosis: An Unusual Presentation Roy Debdip 1 Pereira Melvika 1 Shivdasani Divya 1 Singh Natasha 1 1 Department of Nuclear Medicine and Molecular Imaging, P. D. Hinduja National Hospital and MRC, Mahim, Mumbai, Maharashtra, India Address for correspondence Debdip Roy, DNB Department of Nuclear Medicine and PET-CT, P.D. Hinduja National Hospital and MRCV S Marg, Mahim (W), Mumbai, 400016, [email protected] 09 9 2022 3 2023 1 9 2022 22 1 2628 The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. ( ) 2022 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ewing sarcoma (EWS) is primarily an osseous malignancy of childhood and young adults. Extraskeletal occurrence is less frequent and primary adrenal involvement is an even rare presentation. We present such a case of a 7-year-old boy diagnosed with adrenal EWS with associated venous thrombosis and pulmonary embolism detected on 18 F-fluorodeoxyglucose positron emission tomography-computed tomography scan. Keywords adrenal Ewing sarcoma FDG PET-CT IVC thrombus Funding None. pmcIntroduction Ewing sarcoma (EWS) is a round cell tumor primarily affecting skeletal system, with a higher incidence in children and young adults after osteogenic sarcoma among skeletal malignancies. Although rare, primary extraosseous EWS has been reported involving chest wall, paravertebral and retroperitoneal region, and even rarer occurrence of organ involvement (lungs, gastrointestinal, prostate, others). 1 2 Primary adrenal EWS is unusual in pediatric population with very few cases reported till date. We present such a case of primary adrenal EWS in a 7-year-old boy with tumor thrombus involving renal vein and inferior vena cava (IVC) with pulmonary thromboembolism detected on positron emission tomography-computed tomography (PET-CT). The case emphasizes on considering EWS as a differential diagnosis in aggressive presentation of adrenal mass lesions in pediatric population and role of 18 F-fluorodeoxyglucose positron emission tomography-computed tomography ( 18 F-FDG PET-CT) scan in assessing disease burden that can guide diagnosis and early management. Case Presentation A 7-year-old boy, presenting with complains of paroxysmal seizure, tachycardia, hypertension, and respiratory distress and a palpable abdominal mass in left hypochondrium, was admitted at our institution. Magnetic resonance imaging (MRI) abdomen done at another center suggested a large left suprarenal mass lesion raising possibility of neuroblastic tumor. Laboratory investigation revealed normal plasma cortisol, plasma-free metanephrine and normetanephrine, and urinary metanephrine levels. Patient was referred to our department for 18 F-FDG PET-CT scan to further characterize the lesion and evaluate the disease extent. The scan taken after 1 hour of 4 mCi of 18 F-FDG injection. PET-CT scan showed high-grade FDG avid large, lobulated, heterogeneously enhancing left adrenal mass lesion (maximum standardized uptake value: 9.2) with hypodense necrotic areas within and associated thrombus in left suprarenal vein, extending in both renal veins, and IVC reaching upto right atrium, with heterogeneous components within showing mild FDG uptake suggesting tumor thrombus. In addition, bilateral pulmonary thromboembolism was detected ( Fig. 1A-F ). No lymphadenopathy or distant metastasis was seen. Based on the clinical and PET-CT findings, possibility of adrenocortical tumor was considered over neuroblastoma. However, CT-guided biopsy evaluation of left adrenal mass revealed EWS, immunohistochemical (IHC) profile showing intense expression of CD99, with K i -67 index of 35%. After multidisciplinary discussion, the patient was treated with chemotherapy including vincristine, ifosfamide, doxorubicin, and etoposide, showing good symptomatic response. Treatment response PET-CT scan was performed after three cycles of chemotherapy that showed significant decrease in size and FDG uptake of primary left adrenal neoplastic lesion, and decrease in extent of IVC thrombus with resolution of thrombus in renal and suprarenal vein, and pulmonary thromboembolism ( Fig. 1G, H ). Patient is doing clinically well on chemotherapy. Fig. 1 Baseline PET-CT MIP ( A ), fused PET-CT coronal ( B ), transaxial ( E ), CECT axial ( F ) images show FDG avid large, heterogeneously enhancing left adrenal mass with hypodense-necrotic areas within, associated FDG avid tumor thrombus in left suprarenal vein, both renal veins, IVC reaching upto right atrium ( C ). Bilateral pulmonary thromboembolism was detected ( D ). Post chemotherapy PET-CT ( G ), CECT ( H ) images show significant decrease in size and FDG uptake of left adrenal lesion and IVC thrombus. Discussion EWS is the second most common skeletal malignancy affecting adolescents after osteogenic sarcoma. 3 Extraskeletal EWS is less frequently encountered and involves soft tissue and rarely even organ involvement. Primary involvement of adrenal gland in EWS being extremely rare is not considered among the usual differential diagnosis of adrenal mass in children. 2 Rather, based on the age group and site of involvement in our case neuroblastoma and possibly adrenocortical carcinoma were our major differentials. Detection is commonly done on CT scan or MRI, whereas in our case adrenal mass was characterized on whole body FDG PET-CECT scan. These modalities help in differentiating benign from neoplastic adrenal lesion. Adrenal EWS lesions have been reported as mass lesion with heterogeneous enhancement, areas of necrosis or internal foci of calcification and being locally aggressive in nature may involving adjacent vessels. 4 5 6 Our case showed similar features of large lobulated heterogeneously enhancing adrenal mass with central areas of necrosis with tumor thrombus extending into adjacent renal vein and IVC. Since adrenal involvement formed major bulk of the lesion on PET-CT scan, possibility of adrenal metastasis was ruled out. There are no reports yet on detection of primary EWS on FDG PET, and our case shows that lesions demonstrate FDG avidity considering their aggressive nature. Although there are no specific imaging findings on PET-CT pertaining to primary adrenal EWS, FDG PET-CT scan can help in staging by determining the disease burden and thus guiding management. Additionally in our case due to whole body imaging, bilateral pulmonary thromboembolism was detected. Histopathology is the gold standard to determine this rare diagnosis, and EWS pathological features include round blue cell tumor positive for pancytokeratin, membranous CD99 on IHC, and reverse-transcription polymerase chain reaction positive for EWSR1-FL1 gene that are highly sensitive. 7 8 Biopsy performed in our patient showed similar IHC characteristics. Treatment strategy includes surgery and chemotherapy both. Our patient received chemotherapy demonstrating a good response on subsequent posttreatment PET-CT. So, we see another benefit of FDG PET in assessment of treatment response in EWS. Our case thus highlights the rarity of the diagnosis of primary adrenal EWS with locally aggressive features detected on staging FDG PET-CT scan, and the importance of including EWS as one of the differential diagnoses of adrenal masses. Also, we must note that since these lesions are FDG avid, FDG PET-CT is a useful modality in assessing metastatic burden and treatment response, both of which guide management decisions. Conflict of Interest None declared. References 1 Eddaoualline H Mazouz K Rafiq B Ewing sarcoma of the adrenal gland: a case report and review of the literature J Med Case Reports 2018 12 01 69 2 Ibabao C Tsetse C Sheth Y Maitland C Mohammed M Primary Ewing sarcoma of the adrenal gland: A rare cause of abdominal mass Radiol Case Rep 2019 15 01 1 6 31737137 3 Balamuth N J Womer R B Ewing's sarcoma Lancet Oncol 2010 11 02 184 192 20152770 4 Zhang Y Cai P Chen M Imaging findings of adrenal primitive neuroectodermal tumors: a series of seven cases Clin Transl Oncol 2017 19 05 641 649 27878756 5 Saboo S S Krajewski K M Jagannathan J P Ramaiya N IVC tumor thrombus: an advanced case of rare extraosseous Ewing sarcoma of the adrenal gland Urology 2012 79 06 e77 e78 6 Kato K Kato Y Ijiri R Ewing's sarcoma family of tumor arising in the adrenal gland-possible diagnostic pitfall in pediatric pathology: histologic, immunohistochemical, ultrastructural, and molecular study Hum Pathol 2001 32 09 1012 1016 11567233 7 Shibuya R Matsuyama A Nakamoto M Shiba E Kasai T Hisaoka M The combination of CD99 and NKX2.2, a transcriptional target of EWSR1-FLI1, is highly specific for the diagnosis of Ewing sarcoma Virchows Arch 2014 465 05 599 605 25031013 8 Renshaw A A Perez-Atayde A R Fletcher J A Granter S R Cytology of typical and atypical Ewing's sarcoma/PNET Am J Clin Pathol 1996 106 05 620 624 8929472 |
World J Nucl Med World J Nucl Med 10.1055/s-00052852 World Journal of Nuclear Medicine 1450-1147 1607-3312 Thieme Medical and Scientific Publishers Pvt. Ltd. A-12, 2nd Floor, Sector 2, Noida-201301 UP, India 10.1055/s-0042-1758805 WJNM-22-5-0005 Case Report Not All Glittering Bone Lesions Are Gold: A Case of Sclerotic Bone Lesions with Elevated 68 Ga PSMA and 99m Tc HDP Uptake with No Signs of Malignancy Bentestuen Morten 1 Elkjaer Maria Carlsen 2 Zacho Helle D. 13 1 Department of Nuclear Medicine, Aalborg University Hospital, Aalborg, Denmark 2 Department of Urology, Aalborg University Hospital, Aalborg, Denmark 3 Department of Clinical Medicine, Aalborg University Hospital, Aalborg, Denmark Address for correspondence Morten Bentestuen, MD Department of Nuclear Medicine, Aalborg University HospitalHobrovej 18-22, Aalborg [email protected] 20 12 2022 3 2023 1 12 2022 22 1 6769 The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. ( ) 2022 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Gallium-68 prostate-specific membrane antigen positron emission tomography/computed tomography ( 68 Ga PSMA PET/CT) outperforms CT and bone scintigraphy in terms of diagnostic accuracy for the primary staging of prostate cancer and has become widely used. However, 68 Ga PSMA uptake is also encountered in nonprostatic tissue. We present a 63-year-old male with newly diagnosed high-risk prostate cancer who underwent bone scintigraphy with single-photon emission computed tomography/computed tomography (SPECT/CT), which showed inhomogeneous elevated uptake in sclerotic bone lesions in the pelvis. Likewise, 68 Ga PSMA PET/CT revealed inhomogeneous uptake in the same areas. Subsequent biopsy revealed hyperplastic bone marrow without signs of malignancy. The patient underwent radical prostatectomy, and the prostate-specific antigen level dropped to less than 0.1 ng/mL. Keywords 68 Ga PSMA PET/CT bone scan prostate cancer primary staging pmcIntroduction Prostate cancer is one of the most common malignancies in the Western world and frequently metastasizes to lymph nodes or bone; particularly bone metastases are the major cause of morbidity in advanced prostate cancer. 1 For primary staging of high-risk prostate cancer, gallium-68 prostate-specific membrane antigen positron emission tomography/computed tomography ( 68 Ga PSMA PET/CT) has proven to be a highly accurate diagnostic tool. 2 Although 68 Ga PSMA as the name implies is relatively prostate tissue-specific, several cases have demonstrated elevated 68 Ga PSMA uptake in benign bone lesions. Case History A 63-year-old male was diagnosed with high-risk prostate cancer (prostate-specific antigen [PSA] 4.7 ng/mL, Gleason score 9 [4 + 5, International Society of Urological Pathology (ISUP) grade 5], stage T1c) and referred for a 99m Tc bone scan and CT of the thorax, abdomen, and pelvis. The bone scan revealed slightly elevated, inhomogeneous tracer uptake ( Fig. 1A , bone scan in posterior projection; Fig. 1B , axial single-photon emission computed tomography [SPECT]) correlating with inhomogeneous sclerotic lesions of both iliac bones on the corresponding CT ( Fig. 1C ) and as shown in the fused SPECT/CT image ( Fig. 1D ). Bone metastases were suspected, but due to the rather unusual appearance, the patient was referred to 68 Ga PSMA PET/CT for the further evaluation of the disease stage. Fig. 1 Whole body bone scan and single-photon emission computed tomography/computed tomography. The maximal intensity projection in the posterior view of the 68 Ga PSMA-11 PET/CT ( Fig. 2A ) showed inhomogeneous low-to-moderate PSMA uptake (maximum standardized uptake value: 4.5-5.0) of both iliac bones, as shown in the axial PET image ( arrows , Fig. 2B ), corresponding to several small sclerotic lesions seen on the corresponding CT ( arrows , Fig. 2C ). The fused axial image is shown in Fig. 2D . In addition, the PSMA uptake pattern showed increased uptake along the iliac crest ( Fig. 2A ), which was not typical for bone metastases; for this reason, a bone biopsy was conducted to confirm or rule out bone metastases. CT-guided fine-needle and core-needle biopsies of the left ilium were conducted, and microscopic analysis revealed normal bone marrow with trilinear hyperplasia without any signs of malignancy. Immunohistochemistry analysis with the prostate-specific markers NKX3 and PSA was negative. Fig. 2 Prostate-specific membrane antigen positron emission tomography/computed tomography. The patient underwent curatively intended radical prostatectomy with dissection of seminal vesicles and pelvic lymph nodes. Final pathology revealed prostate cancer pT2c N0 M0, Gleason score 7 (4 + 3), ISUP grade 3, and a spontaneous decrease in the PSA level to less than 0.1 ng/mL following prostatectomy, supporting the diagnosis of benign changes in the pelvic bones. Discussion 68 Ga PSMA PET/CT has proven to be a highly accurate diagnostic tool for staging newly diagnosed high-risk prostate cancer. 2 Despite the name prostate-specific membrane antigen, several studies have reported 68 Ga PSMA uptake in other types of cancer, 3 as well as several types of benign bone lesions, such as osteoid osteoma, 4 vertebral hemangioma, 5 myeloma, 6 fractures, 7 osteophytes 8 and Paget's disease. 9 Despite such findings, the specificity of 68 Ga PSMA PET/CT is very satisfactory and is often reported to be 93 to 98%. 2 10 However, the present case emphasizes the need for biopsy when PSMA PET/CT is not entirely diagnostic of metastases to assign the correct treatment to the patient. Note Authors' Contributions Conflict of Interest None declared. The patient was scanned and treated at Aalborg University Hospital, Aalborg, Denmark. Authors are credited in the presented order of authorship. Morten Bentestuen was responsible for the completion of the present case report, gathered data, drafted manuscripts and created all figures. Helle Damgaard Zacho supervised the process. Maria Carlsen Elkjaer and Helle Damgaard Zacho revised drafts and accepted the final product. References 1 Taitt H E Global trends and prostate cancer: a review of incidence, detection, and mortality as influenced by race, ethnicity, and geographic location Am J Men Health 2018 12 06 1807 1823 2 proPSMA Study Group Collaborators Hofman M S Lawrentschuk N Francis R J Prostate-specific membrane antigen PET-CT in patients with high-risk prostate cancer before curative-intent surgery or radiotherapy (proPSMA): a prospective, randomised, multicentre study Lancet 2020 395 (10231):1208 1216 32209449 3 Zacho H D Pedersen S H Petersen A Petersen L J 68Ga-PSMA PET/CT uptake in the ureter caused by ligand expression in urothelial cancer Clin Nucl Med 2020 45 01 e43 e45 31306199 4 Castello A Lopci E Incidental identification of osteoid osteoma by 68 Ga-PSMA PET/CT Eur J Nucl Med Mol Imaging 2018 45 03 509 510 29242960 5 Artigas C Otte F X Lemort M van Velthoven R Flamen P Vertebral hemangioma mimicking bone metastasis in 68Ga-PSMA ligand PET/CT Clin Nucl Med 2017 42 05 368 370 28319497 6 Merrild E H Baerentzen S Bouchelouche K Buus S Vertebral myeloma mimicking prostatic carcinoma metastasis in 68Ga-PSMA PET/CT Clin Nucl Med 2017 42 10 790 792 28737577 7 Vamadevan S Le K Bui C Mansberg R Incidental PSMA uptake in an undisplaced fracture of a vertebral body Clin Nucl Med 2017 42 06 465 466 28240660 8 Jochumsen M R Madsen M A Gammelgaard L Bouchelouche K Lumbar osteophyte avid on 68Ga-prostate-specific membrane antigen PET/CT Clin Nucl Med 2018 43 06 456 457 29538033 9 Sasikumar A Joy A Nanabala R Pillai M R TA H 68Ga-PSMA PET/CT false-positive tracer uptake in Paget disease Clin Nucl Med 2016 41 10 e454 e455 27556797 10 Petersen L J Zacho H D PSMA PET for primary lymph node staging of intermediate and high-risk prostate cancer: an expedited systematic review Cancer Imaging 2020 20 01 10 31973751 |
World J Nucl Med World J Nucl Med 10.1055/s-00052852 World Journal of Nuclear Medicine 1450-1147 1607-3312 Thieme Medical and Scientific Publishers Pvt. Ltd. A-12, 2nd Floor, Sector 2, Noida-201301 UP, India 10.1055/s-0042-1750387 12821 Case Report 123-Iodine MIBG in the Assessment of Sympathetic Denervation in Ogilvie's Syndrome Bhoil Amit 1 Vinjamuri Sobhan 1 1 Department of Nuclear Medicine, The Royal Liverpool University Hospital NHS Trust, Liverpool, United Kingdom Address for correspondence Amit Bhoil, MD Department of Nuclear Medicine, The Royal Liverpool University Hospital NHS TrustLiverpool L7 8XPUnited [email protected] 09 9 2022 3 2023 1 9 2022 22 1 3335 The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. ( ) 2022 The Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 123-Iodine metaiodobenzylguanidine (I-123 MIBG) imaging is frequently used in the assessment of sympathetic innervation and autonomic dysfunction in patients with cardiac failure, neurodegenerative Parkinson's syndrome, multiple system atrophy, myotonic dystrophy, and diabetic mellitus. The etiology of pseudo-obstruction remains unknown with likely imbalance between sympathetic and parasympathetic innervation proposed as a hypothesis. We present a case demonstrating the utility of I-123 MIBG scintigraphy for evaluating a case of pseudo-obstruction requiring frequent hospitalization due to progressive complex autoimmune neurological disorder. Keywords I-123 MIBG autonomic neuropathy Ogilvie's syndrome pseudo-obstruction sympathetic dysfunction Funding None. pmcCase Report A 48-year-female presented with a complex history of chronic back pain with frequent episodes of hospitalization due to pseudo-obstruction with history of dysautonomia for the last 2 years. The contrast-enhanced computerized tomography (CECT) scan in the axial ( Fig. 1A ), coronal ( Fig. 1B ), and sagittal plane ( Fig. 1C ) showed nonspecific large bowel dilatation proximal to the short segment narrowing in the distal sigmoid colon, with no feature of true obstruction. Colonic transit capsule study was normal with no transit delay. The patient progressively had swallowing difficulty, which on video fluoroscopy study was diagnosed with pharyngeal and esophageal phase dysphasia. She later developed unexplained spastic paraplegia with sustained clonus and autonomic pain over time period. The patient had a family history with mother having similar neurological disorder, hence genomic testing was considered. The hereditary spastic paraparesis genomic test for 129 gene and autoimmune autonomic ganglionopathy was negative. The plasma concentration of norepinephrine was within normal limits. Patient was suspected with poorly characterized syndrome of autonomic failure and considered for cardiac 123-iodine metaiodobenzylguanidine (I-123 MIBG) scan for the assessment of the autonomic dysfunction. The cardiac I-123 MIBG scan showed reduced myocardial uptake in the early (15minutes) ( Fig. 2A ) and delayed (4hours) ( Fig. 2B ) images, with the quantification of heart and mediastinal (H/M) ratio at early time point of 15minutes 1.58 (control: 2.81) 1 and at delayed time point of 4hours 1.54 (control: 3.04). 1 The findings were suggestive of cardiac sympathetic denervation. The findings supported the diagnosis of progressive autoimmune autonomic neuropathy and hereditary spastic paraparesis with gastrointestinal and cardiac dysfunction. The patient was symptomatically treated, with nasojejunal feeding and cold octreotide therapy. Fig. 1 Contrast-enhanced computed tomography (CECT) scan in the ( A ) axial, ( B ) coronal, and ( C ) sagittal planes shows narrowing in the distal sigmoid colon with nonspecific proximal large bowel dilatation. Fig. 2 The cardiac 123 I MIBG scan with the quantification of heart and mediastinal (H/M) ratio at the early time point of 15 minutes and at the delayed time point of 4 hours showed a reduced (H/M) ratio ( A ) at the early time point of 1.58 (control: 2.81) and ( B ) at the delayed time point 1.54 (control: 3.04). Discussion Ogilvie's syndrome, or acute colonic pseudo-obstruction (ACPO), is a rare multifactorial disorder that consists of dilatation of part or all of the colon and rectum. The pathophysiology of ACPO is incompletely understood with an imbalance of sympathetic and parasympathetic innervations, being the most widely-postulated theory. However, recently sacral parasympathetic denervation causing atonic distal colonic segment similar to adynamic ileus is suspected as the likely postulated cause. 2 3 The parasympathetic nerve endings release acetylcholine, activating the muscarinic receptors stimulating the plexus activity of entire nervous system, leading to stimulation of bowel movements, gastrointestinal secretion, and blood flow. However, the sympathetic nerve endings release norepinephrine, which inhibits both the plexus of the enteric nervous system through activation of the a 1 , a 2 , and b adrenergic receptors. The effects of sympathetic nervous system are further augmented by a presynaptic norepinephrine-mediated inhibition of release of parasympathetic acetylcholine. 4 I-123 MIBG as a radionuclide tracer is an analogue of norepinephrine, and concentrated in adrenergic neurons in the presynaptic vesicles, the concentration reflects scintigraphic display of the adrenergic nervous system. The change in concentration of myocardial sympathetic innervation reflects neuronal integrity and functions. 5 6 The autonomic nervous system abnormalities may be regional, with the adrenergic nerves of the heart particularly vulnerable to the effect of this disease. 6 The scintigraphic display of the adrenergic nervous system with the late H/M ratio is an index of relative distribution of sympathetic nerve terminal offering information about neuronal integrity and function. 7 I-123 MIBG has been reported to provide information regarding cardiac sympathetic function in heart disease, Parkinson's disease, myotonic dystrophy, multiple system atrophy, diabetes mellitus, and Chagas heart disease. 5 8 9 10 Conclusion This case demonstrates the potential use of I-123 MIBG scintigraphy for the assessment of the autonomic function of sympathetic denervation with correlation with MIBG uptake in clinical condition as progressive degenerative autoimmune autonomic neuropathy. Note Conflict of Interest None declared. The manuscript has been read and approved by the author that the requirements for authorship as stated earlier in this document have been met, and that author believes that the manuscript represents honest work, if that information is not provided in another form. Reference 1 Chung E J Lee W Y Yoon W T Kim B J Lee G H MIBG scintigraphy for differentiating Parkinson's disease with autonomic dysfunction from Parkinsonism-predominant multiple system atrophy Mov Disord 2009 24 11 1650 1655 19514077 2 Harnsberger C R Acute colonic pseudo-obstruction (Ogilvie's syndrome) Semin Colon Rectal Surg 2019 30 03 100690 3 Wells C I O'Grady G Bissett I P Acute colonic pseudo-obstruction: a systematic review of aetiology and mechanisms World J Gastroenterol 2017 23 30 5634 5644 28852322 4 Osinga T E Kerstens M N van der Klauw M M Intestinal pseudo-obstruction as a complication of paragangliomas: case report and literature review Neth J Med 2013 71 10 512 517 24394736 5 EANM Cardiovascular Committee European Council of Nuclear Cardiology Flotats A Carrio I Agostini D Proposal for standardization of 123I-metaiodobenzylguanidine (MIBG) cardiac sympathetic imaging by the EANM Cardiovascular Committee and the European Council of Nuclear Cardiology Eur J Nucl Med Mol Imaging 2010 37 09 1802 1812 20577740 6 Sisson J C Shapiro B Meyers L Metaiodobenzylguanidine to map scintigraphically the adrenergic nervous system in man J Nucl Med 1987 28 10 1625 1636 3655915 7 Wakabayashi T Nakata T Hashimoto A Assessment of underlying etiology and cardiac sympathetic innervation to identify patients at high risk of cardiac death J Nucl Med 2001 42 12 1757 1767 11752070 8 Genovese E A Mallardo V Cipullo S [Cardiac sympathetic innervation imaging with myocardial MIBG scintigraphy] Recenti Prog Med 2013 104 (7-8):356 360 24042407 9 Ichikawa Y Takeda K Murashima S Increased myocardial uptake of iodine-123 metaiodobenzylguanidine on delayed images, compared with early images, in patients with multiple system atrophy Clin Nucl Med 2003 28 11 890 892 14578702 10 Landesmann M C da Fonseca L M de B Pereira B Iodine-123 metaiodobenzylguanidine cardiac imaging as a method to detect early sympathetic neuronal dysfunction in chagasic patients with normal or borderline electrocardiogram and preserved ventricular function Clin Nucl Med 2011 36 09 757 761 21825843 |
Mediators Inflamm Mediators Inflamm mi Mediators of Inflammation 0962-9351 1466-1861 Hindawi 10.1155/2023/9864040 Expression of Concern Expression of Concern on "IkB Kinase Inhibitor VII Modulates Sepsis-Induced Excessive Inflammation and Cardiac Dysfunction in 5/6 Nephrectomized Mice" Inflammation Mediators of [email protected] 2023 6 3 2023 6 3 2023 2023 986404023 5 2022 23 5 2022 Copyright (c) 2023 Mediators of Inflammation. 2023 This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. pmc Mediators of Inflammation would like to express concern with the article titled "IkB Kinase Inhibitor VII Modulates Sepsis-Induced Excessive Inflammation and Cardiac Dysfunction in 5/6 Nephrectomized Mice" due to concerns with the data as identified by the authors. The authors contacted the journal to request the retraction of the article stating that they were unable to repeat results shown in Figure 9. They explained that the manuscript states 'When the 5/6 nephrectomized CLP mice were treated with IKK inhibitor VII, it caused a significant reduction in the increases seen in MPO activity and in levels of plasma inflammatory cytokines', however, when the experiments were repeated no significant difference was observed. During a reassessment of the article by the journal, potential concerns were identified in the Western blots of Figures 8 and 3, however, the resolution of the images prevented a conclusive result. The authors apologized but did not provide a response to our request for further clarification and did not provide the original blots. As the journal has not received evidence that the findings are fundamentally flawed, it remains published, however, the conclusions should be viewed with caution. 1 Ding M. Lian D. Zhang L. Jiang T. Wang W. IkB Kinase Inhibitor VII Modulates Sepsis-Induced Excessive Inflammation and Cardiac Dysfunction in 5/6 Nephrectomized Mice Mediators of Inflammation 2020 2020 14 4251682 10.1155/2020/4251682 32963493 |
Society) and Medical online (Meteo Inc.). The search method was similar to that used in PubMed. However, the first keyword ("Japanese or Japan") was omitted. Figure 4 shows the search algorithm and results. Figure 4 Algorithm and result of the comprehensive literature analysis of Japanese patients with IgAV harboring MEFV gene mutations. In the analysis of studies in PubMed, three keywords are shown in the tree diagram. Two articles were searched using the following keywords: "Japan," "Henoch-Schonlein purpura," and "MEFV." Similarly, one article was searched using the following keywords: "Japan," "Henoch-Schonlein purpura," and "Familial Mediterranean Fever." In total, six studies were detected. In the article analysis using the Japanese article search engine (Ichushi-Web and Medical Online), two keywords were detected in the tree diagrams. Moreover, 14 papers were found in Ichushi-Web and Medical Online. Six documents (including duplicates) were found in PubMed. By contrast, 28 studies (including duplicates) were found in the Japanese search engine. In these studies, five patients presented with IgAV harboring MEFV gene mutation. Four documents were conference abstracts and one case report . Table 1 depicts information about the other five patients with IgAV harboring MEFV gene mutation and our patient. Table 1 Reported cases about Japanese IgA vasculitis with MEFV mutation. DDS, diaminodiphenyl sulfone; In, ineffective; Partial, partially effective; MTX, methotrexate; IgAV, immunogloblin A vasculitis; FMF, familial Mediterranean fever; MEFV, Mediterranean fever, N.D., not described Case Age Sex Course Duration from first symptom to diagnosis of IgAV with MEFV gene mutation Symptoms Colchicine Other treatment MEFV gene mutation Year Authors Reference 1 9 Female Periodic fever - Vasculitis Over 4 years Periodic fever and vomiting since infant. At 5 y, tonsillectomy. At 9 y, refractory purpura. Effective Tonsillectomy (In) P369S/R408Q 2020 Kubota et al. Conference abstract written in Japanese 2 52 Female Periodic fever - Vasculitis Over 40 years Periodic fever since childhood. At 34 y, recurrent arthritis and diagnosed as FMF. Recurrent purpura for 6 years. Ongoing MTX N.D. 2014 Yamamoto et al. Conference abstract written in Japanese 3 49 Male Vasculitis - Prolonged symptoms 8 years At 41 y, purpura, arthritis, abdominal pain, vasculitis, and purpura nephritis. At 49 y, shortening of period of fever and abdominal pain. Effective Steroid (In), Immunosuppressant (In) E148Q/M694I 2014 Sato et al. Conference abstract written in Japanese 4 3 Male Vasculitis - Prolonged symptoms 6 months Purpura, abdominal pain, arthritis, and decreased platelet. Refractory fever for 6 months and hepatosplenomegaly. Ongoing Steroid (In), Antibiotics (In) G304R/wt 2015 Kinoshita et al. Conference abstract written in Japanese 5 51 Male Periodic fever - Vasculitis Over 40 years Periodic fever since childhood. At 46 y, diagnosed as IgAV based on skin biopsy. Recurrent purpura for 6 years. Effective Steroid (Partial), Immunosuppressant (In) E148Q/M694I 2021 Sasajima et al. 6 5 Female Vasculitis - Prolonged symptoms 1.5 months Purpura and fever, bladder mass, intussusception. Refractory abdominal pain for 2 months. Effective Steroid (In), DDS (In), Montelukast (In) E148Q/M694I Our case Our case Our case Three patients (cases 1, 2, and 5) diagnosed with periodic fever developed IgAV. Interestingly, cases 1 and 5 were not diagnosed to MEFV gene mutation although they had periodic fever which looks FMF symptom in their childhood. And, MEFV gene analysis was performed after their suffering IgAV. The other two patients (cases 3 and 4) were diagnosed with IgAV before the onset of periodic fever. In such cases, the patients were treated with colchicine six months to two years after the diagnosis of IgAV. Meanwhile, our patient was treated with colchicine 1.5 months after diagnosis, which was the fastest. The five patients received treatments such as tonsillectomy and use of methotrexate, steroids, and immunosuppressant. They were refractory to these treatments. However, they responded to colchicine (0.5 mg-1.0 mg/day). Discussion To the best of our knowledge, this literature review first described IgAV associated with MEFV gene mutation in Japanese patients. In our case, IgAV was clinically diagnosed based on the presence of palpable purpura, leukocytoclastic vasculitis, which was confirmed via skin biopsy, and intussusception. In the early stages of the disease, abdominal pain was manageable with steroids. However, it gradually became steroid-dependent and, eventually, steroid-resistant. Various treatments were provided. However, the patient was refractory. Then, colchicine was administered because abdominal pain was periodic and very intense. Steroid was ineffective, and colchicine was highly effective. Thus, we hypothesized her pathological condition was similar to FMF. FMF is a genetic abnormality associated with inflammasome, and patients with this condition present with high serum IL-1b and IL-18 levels . In particular, FMF with M694I mutation is associated with high IL-18 levels even in the intermittent afebrile phase . In the current case, the serum IL-18 levels of our patient were higher than those of other patients with IgAV, and they decreased with the administration of colchicine. Interestingly, after the discontinuation of colchicine, the IL-18 levels increased again. However, its level was equivalent to that of patients with FMF M694I (+). During this period, the patient had no symptoms of FMF and no elevation of blood inflammatory markers like C-reactive protein (CRP) and serum amyloid A (SAA). To the best of our knowledge, this literature review first described IgAV associated with MEFV gene mutation in Japanese patients. In our case, IgAV was clinically diagnosed based on the presence of palpable purpura, leukocytoclastic vasculitis, which was confirmed via skin biopsy, and intussusception. In the early stages of the disease, abdominal pain was manageable with steroids. However, it gradually became steroid-dependent and, eventually, steroid-resistant. Various treatments were provided. However, the patient was refractory. Then, colchicine was administered because abdominal pain was periodic and very intense. Steroid was ineffective, and colchicine was highly effective. Thus, we hypothesized her pathological condition was similar to FMF. Familial Mediterranean fever is a genetic abnormality associated with inflammasome, and patients with this condition present with high serum IL-1b and IL-18 levels . In particular, FMF with M694I mutation is associated with high IL-18 levels even in the intermittent afebrile phase . In the current case, the serum IL-18 levels of our patient were higher than those of other patients with IgAV, and they decreased with the administration of colchicine. Interestingly, after the discontinuation of colchicine, the IL-18 levels increased again. However, its level was equivalent to that of patients with FMF M694I (+). During this period, the patient had no symptoms of FMF and no elevation of blood inflammatory markers like C-reactive protein (CRP) and serum amyloid A (SAA). Based on the clinical characteristics and serum IL-18 levels, we considered the possibility of MEFV gene mutations in this patient. In fact, she presented with E148Q/M694I compound heterozygote mutation. Hence, MEFV gene mutation was a symptom modifier in this patient. However, in a strict sense, whether this patient presented with clinically typical FMF remains unclear. This is because she did not have recurrent febrile episodes. FMF may develop in adulthood, and the IL-18 concentration in this patient is still high even though asymptomatic . Therefore, she should be monitored for periodic febrile episodes in the future. No study has investigated the epidemiological or clinical features of IgAV associated with MEFV gene mutation in Japanese patients. IgAV is predominantly a childhood disease, with an incidence of 3-26.7 cases per 100,000 children . IgAV is a ubiquitous disease with no evident geographical, racial, or ethnic variations in terms of risk . By contrast, there are significant differences in the incidence rate of MEFV gene mutation. In Turkey, Israel, and Armenia, field surveys revealed that the prevalence of FMF is approximately 1 in 500-1000 children (0.1%-0.2%) . The number of patients with FMF in Japan is about 500 (1 in 1-5x105: 0.0002%-0.001%) and <1/250-500 in highly affected areas. Moreover, 25% of individuals in the general population in Japan present with E148Q heterozygote mutation. Thus, E148Q is considered a single nucleotide polymorphism, and FMF can develop when E148Q and M694I cause compound heterozygote mutation . If the MEFV gene is not involved in IgAV pathogenesis, the prevalence of IgAV among patients with MEFV gene mutation will be similar to that among patients without MEFV gene mutation in the general population. However, in Turkey, 10% of patients with IgAV presented with homozygote/compound heterozygote mutations in the MEFV gene. The rate is significantly higher than that of MEFV gene mutations in the general population . The clinical features in IgAV with MEFV gene mutations are 1) younger, 2) severer edema, arthritis and abdominal pain, 3) refractory against conventional IgAV treatment, 4) elevated CRP and SAA, and 5) lack of IgA deposits in skin biopsy . In Japan, several patients with IgAV could present with MEFV gene mutations. However, previous studies have not reported comprehensive results, and there are only five patients found in the literature review. In addition, there is no report showing that IgAV is likely to occur in Japanese patients with FMF. Whether MEFV gene mutation is associated with the pathophysiology of IgAV among Japanese, similar to those in the Mediterranean region, remains unclear. Nevertheless, a cohort study must be conducted to validate the clinical and epidemiological characteristics of IgAV correlated with MEFV gene mutation among Japanese. This article was previously posted to the Research Square preprint server on April 14, 2022. Conclusions The prevalence of IgAV associated with MEFV gene mutations in Japan may be low. However, MEFV gene mutations can be masked if symptoms are prolonged or if patients are refractory to treatment. In such cases, IL-18 monitoring may be useful, and colchicine can be a treatment option for refractory IgAV. Human Ethics The authors have declared that no competing interests exist. Consent was obtained or waived by all participants in this study. The institutional review board of Graduate School of Medical Sciences at Kanazawa University issued approval Kanazawa, Japan; protocol number: 2016-055 |
translation . This web only file has been produced by the BMJ Publishing Group from an electronic file supplied by the author(s) and has not been edited for content. The authors acknowledge the contributions of the study staff and participants in Zimbabwe and Uganda. The authors thank the following members of the Fichorova Laboratory, who contributed to this study by processing the cervical samples and performing all protein assays (listed in alphabetical order): Bi Yu Li, Bisiayo Fashemi, Hassan Dawood, Hidemi Yamamoto, Huaiping Yuan, Noah Beatty, Olimpia Suciu, Raymond Wong, Ryan Murray, Tai Nguyen, Xenia Chepa-Lotrea, Yoshika Yamamoto and Yujin Lee. Data availability statement Data are available on reasonable request. All data will be made available on reasonable request to be submitted to the corresponding author. Ethics statements Patient consent for publication Not applicable. Ethics approval The study received approval from institutional review boards at FHI 360 and the Brigham and Women's Hospital. The transfer of biospecimens was approved by institutional authorities in Zimbabwe and Uganda. Handling editor: Erica L Plummer Correction notice: This article has been corrected since it was first published. The open access licence has been updated to CC BY. Contributors: Conceptualisation: RNF, CSM, P-LC, TC, RS and GFD. Data curation: RNF, P-LC, HY, TC and RS. Formal analysis: RNF, P-LC and XG. Funding acquisition: RNF and CSM. Methodology: RNF, CSM and P-LC. Supervision of immunological analysis and data integrity: RNF. Visualisation: RNF and YG. Writing: RNF, YG and CSM. Discussion of results, review and editing: all authors. All authors approved the final version. RNF is responsible for the overall content and as the guarantor accepts full responsibility for the finished work and the conduct of the study, had access to the data, and controlled the decision to publish. Funding: This study was supported by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) R01 HD077888 and R01 HD099091. Competing interests: None declared. Provenance and peer review: Not commissioned; externally peer reviewed. Supplemental material: This content has been supplied by the author(s). It has not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been peer-reviewed. Any opinions or recommendations discussed are solely those of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content includes any translated material, BMJ does not warrant the accuracy and reliability of the translations (including but not limited to local regulations, clinical guidelines, terminology, drug names and drug dosages), and is not responsible for any error and/or omissions arising from translation and adaptation or otherwise. |
Front Pharmacol Front Pharmacol Front. Pharmacol. Frontiers in Pharmacology 1663-9812 Frontiers Media S.A. 1148908 10.3389/fphar.2023.1148908 Pharmacology Correction Corrigendum: Bushen huoxue decoction inhibits RANKL-stimulated osteoclastogenesis and glucocorticoid-induced bone loss by modulating the NF-kB, ERK, and JNK signaling pathways Liu et al. 10.3389/fphar.2023.1148908 Liu Yamei 1 + Fu Binlan 1 2 + Li Xiaoman 1 2 Chen Chen 3 Li Xican 3 Xu Liangliang 4 * Wang Bin 5 * 1 School of Basic Medical Science, Guangzhou University of Chinese Medicine, Guangzhou, China 2 Laboratory of Orthopedics and Traumatology, Lingnan Medical Research Center, Guangzhou University of Chinese Medicine, Guangzhou, China 3 School of Chinese Herbal Medicine, Guangzhou University of Chinese Medicine, Guangzhou, China 4 The First Affiliated Hospital of Guangzhou University of Chinese Medicine, Guangzhou, China 5 Department of Traumatology, The Third Affiliated Hospital of Guangzhou University of Chinese Medicine, Guangzhou, China Edited and reviewed by: Chang-Hee Suh, Ajou University, Republic of Korea *Correspondence: Bin Wang, [email protected]; Liangliang Xu, [email protected] + These authors have contributed equally to this work and share first authorship This article was submitted to Integrative and Regenerative Pharmacology, a section of the journal Frontiers in Pharmacology 27 2 2023 2023 27 2 2023 14 114890820 1 2023 17 2 2023 Copyright (c) 2023 Liu, Fu, Li, Chen, Li, Xu and Wang. 2023 Liu, Fu, Li, Chen, Li, Xu and Wang This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A Corrigendum on Bushen huoxue decoction inhibits RANKL-stimulated osteoclastogenesis and glucocorticoid-induced bone loss by modulating the NF-kB, ERK, and JNK signaling pathways by Liu Y, Fu B, Li X, Chen C, Li X, Xu L and Wang B (2022). Front. Pharmacol. 13:1007839. doi: 10.3389/fphar.2022.1007839 bushen huoxue decoction osteoporosis NF-kB pathway ERK pathway JNK pathway pmcIn the published article, there was an error in Figure 5 as published. In Figure 5E, the position of the experimental images of DEX group and DEX + BHD group is inverted, that is, the images of DEX group should appear in DEX + BHD group, while the images of DEX + BHD group should appear in DEX group. The corrected Figure 5 and its caption appear below. FIGURE 5 BHD affects osteoclast formation and differentiation by suppressing the expression of the NF-kB signaling pathway in vivo. (A-E) Representative images of Immunohistochemical staining of decalcified bone sections. Scale bar = 20 mm. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Egypt Heart J Egypt Heart J The Egyptian Heart Journal 1110-2608 2090-911X Springer Berlin Heidelberg Berlin/Heidelberg 36913033 346 10.1186/s43044-023-00346-5 Correction Correction: The predictive value of precipitating factors on clinical outcomes in hospitalized patients with decompensated heart failure: insights from the Egyptian cohort in the European Society of Cardiology Heart Failure long-term registry Bendary Ahmed [email protected] [email protected] 1 Hassanein Mahmoud 2 Bendary Mohamed 3 Smman Ahmed 4 Hassanin Ahmed 5 Elwany Mostafa 2 1 grid.411660.4 0000 0004 0621 2741 Cardiology Department, Faculty of Medicine, Benha University, Benha, Egypt 2 grid.7155.6 0000 0001 2260 6941 Cardiology Department, Alexandria University, Alexandria, Egypt 3 grid.7776.1 0000 0004 0639 9286 Biostatistics Department, National Cancer Institute, Cairo University, Cairo, Egypt 4 grid.7155.6 0000 0001 2260 6941 Alexandria University Students' Hospital, Alexandria, Egypt 5 grid.241054.6 0000 0004 4687 1637 Division of Cardiology, University of Arkansas for Medical Sciences, Arkansas, NY USA 13 3 2023 13 3 2023 12 2023 75 18(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit issue-copyright-statement(c) The Author(s) 2023 pmcCorrection: The Egyptian Heart Journal (2023) 75:16 Following publication of the original article , the authors noticed an error in affiliation 3. The correct affiliation is: Biostatistics Department, National Cancer Institute, Cairo University, Cairo, Egypt. The original article has been corrected. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Co-first authors: Ahmed Bendary and Mahmoud Hassanein. Reference 1. Bendary A Hassanein M Bendary M The predictive value of precipitating factors on clinical outcomes in hospitalized patients with decompensated heart failure: insights from the Egyptian cohort in the European Society of Cardiology Heart Failure long-term registry Egypt Heart J 2023 75 16 10.1186/s43044-023-00342-9 36884155 |
Endocr Pathol Endocr Pathol Endocrine Pathology 1046-3976 1559-0097 Springer US New York 36826690 9757 10.1007/s12022-023-09757-1 Article Sarcomatous Transformation of a Medically Treated Lactotroph Pituitary Neuroendocrine Tumor? Terry Merryl [email protected] 1 Reis Gerald 2 Horvai Andrew 1 Pekmezci Melike 13 Perry Arie 14 1 grid.266102.1 0000 0001 2297 6811 Department of Pathology, University of California San Francisco (UCSF), San Francisco, CA USA 2 grid.489080.d 0000 0004 0444 4637 Department of Pathology, Memorial Healthcare System, Hollywood, FL USA 3 grid.266102.1 0000 0001 2297 6811 Department of Pathology, Clinical Cancer Genomics Laboratory, UCSF, San Francisco, CA USA 4 grid.266102.1 0000 0001 2297 6811 Department of Pathology and Neurological Surgery, UCSF, San Francisco, CA USA 24 2 2023 24 2 2023 2023 34 1 161163 14 2 2023 (c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit Keywords Pituitary Adenoma PitNET Sarcomatous Transformation issue-copyright-statement(c) Springer Science+Business Media, LLC, part of Springer Nature 2023 pmcCase History This 49-year-old man presented with headaches, diplopia, and elevated serum prolactin (> 2000 ng/mL). Brain MRI revealed a 4.6 cm enhancing mass in the pituitary fossa, with inferolateral invasion. He was treated medically with cabergoline with normalization of prolactin but no improvement in symptoms. He underwent tumor resection. What Is Your Diagnosis? Figure composites (see Figs. 1 and 2).Fig. 1 Post-contrast T1-weighted MRI showed an enhancing, invasive sellar mass A (sagittal), B (coronal). Histology revealed sheets of poorly differentiated cells adjacent to nests of well-differentiated neuroendocrine cells C. The PitNET featured small monomorphic cells with high N/C ratios, embedded in a densely collagenous stroma, consistent with dopamine agonist treatment effects D. The sarcoma consisted of pleomorphic cells with abundant mitoses E and F Fig. 2 At low magnification, the sarcoma is in the top half, and the PitNET is in the bottom half. The sarcoma was diffusely positive for CD34 A. The PitNET was densely granulated, with strong prolactin positivity B (inset: higher magnification at the interface). The sarcoma was also positive for vimentin C. The Ki-67 labeling index was < 1% in the PitNET and ~ 60% in the sarcoma D (inset: higher magnification at the interface) Diagnosis: Densely Granulated Lactotroph Pituitary Neuroendocrine Tumor (PitNET) with Treatment Effects and Adjacent Sarcoma A biphasic neoplasm was found, with a well-defined but focally intermingled PitNET and a high-grade sarcoma, not otherwise specified (Fig. 1). The PitNET was comprised of small epithelioid cell nests with minimal cytoplasm and delicate "salt and pepper" chromatin. Stromal hyalinization was prominent and in combination with the high N/C ratio was consistent with dopamine agonist treatment effects. The sarcomatous component contained anaplastic spindled to epithelioid cells arranged in sheets and fascicles, with pleomorphic nuclei, open chromatin, scattered macronucleoli, and moderate cytoplasm. There were > 20 mitotic figures per 10 high-power fields. The PitNET was reticulin-poor (though the surrounding fibrotic stroma was positive). Extensive intercellular reticulin characterized the sarcomatous component. By immunohistochemistry (Fig. 2), the densely granulated PitNET cells were positive for prolactin and PIT1, but negative for SF1, TPIT, ACTH, growth hormone, TSH, FSH, and LH. The sarcomatous cells were diffusely positive for vimentin and CD34, but negative for all pituitary hormones and transcription factors, cytokeratin, melanocytic, glial, and muscle markers. The Ki-67 labeling index was < 1% in the PitNET, but up to 60% in the sarcomatous component. The tumor was further characterized by the UCSF500 Next-Generation Sequencing (NGS) cancer panel. Tumor-only sequencing was performed separately on the two components, revealing an overlapping common activating missense mutation in the PDGFRB oncogene in both regions (allele frequency: 8% in PitNET and 60% in sarcoma). No additional alterations were identified in the PitNET, but the sarcomatous component contained an activating missense mutation in PIK3CA, a truncating missense mutation in RECQL4, biallelic homozygous deletion of CDKN2A/CDKN2B, and TERT promoter rearrangement. Chromosomal copy number analysis revealed an aneuploid genome in both components but essentially no overlap in the copy number variants. While the possibility of contamination could not be entirely excluded, it was considered unlikely, as the other sarcoma-associated alterations were not identified in the PitNET sequencing. Comment PitNETs are generally well-differentiated NETs with a favorable prognosis, although a subset is associated with considerable morbidity and mortality. Sarcomatous transformation of PitNETs is exceedingly rare and is nearly always associated with prior irradiation . We are only aware of a single additional case reported, similarly showing a sarcoma in association with a lactotroph PitNET treated with bromocriptine 5 years prior to surgery . The sarcoma appeared similar to ours, although the reported Ki-67 labeling index of 7.2% was considerably lower. The genetic alterations identified in our sarcoma were not specific for a more distinct tumor type . However, given the common molecular alteration between the sarcoma and PitNET, the malignant transformation of a single clonal neoplasm is favored over a collision tumor. Imatinib, used in the treatment of other PDGFRB-fusion positive neoplasms (e.g., gastrointestinal stromal tumor and dermatofibrosarcoma protuberans), may theoretically have clinical utility. Our patient experienced dramatic improvement to his headaches and partial improvement to his double vision after surgery. He was recommended to follow up with oncology and was subsequently evaluated for post-surgical radiotherapy. Author Contribution M.T. wrote the manuscript. A.P. generated the figures. All authors edited the manuscript. Availability of Data and Materials Not applicable. Declarations Ethical Approval Not applicable. Competing Interests The authors declare no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. Berkmann S Tolnay M Hanggi D Ghaffari A Gratzl O Sarcoma of the sella after radiotherapy for pituitary adenoma Acta Neurochir (Wien). 2010 152 10 1725 1735 10.1007/s00701-010-0694-6 20512596 2. Duncan VE Nabors LB Warren PP Conry RM Willey CD Perry A Riley KO Hackney JR Primary Sellar Rhabdomyosarcoma Arising in Association With a Pituitary Adenoma Int J Surg Pathol. 2016 24 8 753 756 10.1177/1066896916658955 27422470 3. Nagasaka T Sarcomatous transformation of pituitary adenoma after bromocriptine therapy Hum Pathol. 1998 29 2 190 193 10.1016/s0046-8177(98)90233-7 9490282 4. WHO Classification of Tumours Editorial Board. Soft tissue and bone tumours. Lyon (France): International Agency for Research on Cancer; 2020. (WHO classification of tumours series, 5th ed.; vol. 3). 5. Bi WL Landscape of Genomic Alterations in Pituitary Adenomas Clin Cancer Res. 2017 23 7 1841 2191 10.1158/1078-0432.CCR-16-0790 27707790 |
Biosci Rep Biosci Rep bsr Bioscience Reports 0144-8463 1573-4935 Portland Press Ltd. 36892089 10.1042/BSR-2016-0576_RET BSR-2016-0576_RET Retractions Retraction: MiR-130a-3p inhibits the viability, proliferation, invasion, and cell cycle and promotes apoptosis of nasopharyngeal carcinoma cells by suppressing BACH2 expression 31 3 2023 09 3 2023 09 3 2023 43 3 BSR-2016-0576_RET 2023 The Author(s). 2023 This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY). 10.1042/BSR20160576BACH2 miR-130a-3p nasopharyngeal carcinoma pmcThis article is being retracted from Bioscience Reports at the request of the authors following receipt of a notification from a reader, alerting the Editorial Office to multiple concerns within the paper. Various images seem to appear in papers by other, unrelated authors. The Figure 2C control and miR-NC panels and 5C control panel seem to appear in Figure 3B from Feng et al. 2017 (doi: 10.1042/BSR20170019), Figure 3B from Guan et al. 2018 (doi: 10.1111/jcmm.13620) and in Figures 3A, 3C and 7D from Li et al. 2017 (doi: 10.18632/oncotarget.22133). The GAPDH Western Blots from Figure 1D also seem to appear as the Figure 1D GAPDH blots from Yin et al. 2018 (doi: 10.1111/jcmm.13888). Multiple duplications have also been identified within the paper by both the Reader and the Editorial Office between features of the Figures 3 and 6 panels, which include the following: Figure 3A, 48h/control and 48h/miR-NC panels Figure 3A 0h/miR-mimics and Figure 6A 24h/siRNA-NC panels Figure 6A 48h/control and 48h/siRNA/NC Figure 3A 48h/control and Figure 6 48h/control Figure 3A 48h/miR-NC and Figure 6 48h/siRNA-NC It has also been noted that the middle scatter plot graphs of Figures 2E and 5E (the FITC miRNA-NC and FITC siRNA-NC plots respectively) seem to share heavily similar features. It has also been noted that the Figure 6E E-cadherin and Vimentin blots seem to be duplicates after a 180-degree rotation. The authors are unable to correct the article and wish to retract the article. The Editor-in-Chief and Editorial Board agree with the retraction. |
Eur Heart J Eur Heart J eurheartj European Heart Journal 0195-668X 1522-9645 Oxford University Press US 36130335 10.1093/eurheartj/ehac508 ehac508 Cardiovascular Flashlight AcademicSubjects/MED00200 Eurheartj/27 Eurheartj/28 Eurheartj/39 Eurheartj/41 Eurheartj/15 Eurheartj/16 Eurheartj/48 Eurheartj/53 Eurheartj/8 Changing biventricular mechanics during thrombectomy for intermediate high-risk pulmonary embolism van den Enden Antoon J M Department of Cardiology, Thoraxcenter, Erasmus University Medical Center, office Nt-645, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands Meuwese Christiaan L Department of Cardiology, Thoraxcenter, Erasmus University Medical Center, office Nt-645, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands Department of Intensive Care Adults, Erasmus University Medical Center, Rotterdam, The Netherlands Van Mieghem Nicolas M Department of Cardiology, Thoraxcenter, Erasmus University Medical Center, office Nt-645, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands Corresponding author. Tel: +31 10 7035260, Fax: +31 10 7035254, Email: [email protected] 14 3 2023 21 9 2022 21 9 2022 44 11 Focus Issue on Clinical Trials 10011001 (c) The Author(s) 2022. Published by Oxford University Press on behalf of the European Society of Cardiology. 2022 This is an Open Access article distributed under the terms of the Creative Commons Attribution License ), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. pmc A 49-year-old female with recent intracranial bleeding was admitted after an unwitnessed syncope. On hospital admission, oxygen saturation was 97% on room air, heart rate was >=100 beats/min, and blood pressure was 121/52 mmHg. Pulmonary embolism (PE) was confirmed by computed tomography, affecting bilateral central and subsegmental branches (Panel C). Transthoracic echocardiography demonstrated a dilated right ventricle (RV) with flattened interventricular septum (see Supplementary material online, Video S1). Troponin-T level was 133 ng/L (reference: <14 ng/L). Despite heparin therapy, blood pressure decreased upon minor mobilization. Endovascular thrombectomy was performed using the 24Fr Flowtriever (Inari Medical, Basel, Switzerland) with concomitant invasive biventricular pressure-volume (PV) loop monitoring to appraise immediate changes in cardiomechanics.1,2 Heart rate immediately fell from 105 to 85 beats/min. Systolic pulmonary artery pressure dropped from 42 to 19 mmHg. A prompt left-shift of the RV PV loop indicated direct RV unloading (Panel A). Biventricular PV area (PVA) decreased with higher stroke work/PVA ratio, suggesting improved cardiomechanics leading to enhanced myocardial metabolic demand (Panels A, B, and D, Supplementary material online, Table S1). Arterial elastance (Ea) decreased for both ventricles. Right ventricle PV loop morphology transformed from notched to quadratic throughout thrombectomy (Panel A).3 Ventricular-vascular coupling (Ees/Ea ratio) improved for both ventricles in the presence of stable load-independent contractility (the end-systolic elastance, Ees). The patient could mobilize within hours after thrombectomy and was discharged home the next day. These observations underscore the immediate favourable effects of restored pulmonary flow on biventricular cardiomechanics in the setting of intermediate high-risk PE. The patient provided informed consent for publication. Supplementary material is available at European Heart Journal online. A.J.M.v.d.E. received personal fees from Abiomed and honorarium from Angiodynamics. C.L.M. declares no conflict of interest. N.M.V.M. received grant support from Abbott Vascular, Biotronik, Boston Scientific, Edwards Lifesciences, Medtronic, Daiichi Sankyo, Abiomed, PulseCath BV, FEops, and Pie Medical and received financial support from Antaris Medical and JenaValve. The data underlying this article will be shared on reasonable request to the corresponding author. Supplementary Material ehac508_Supplementary_Data Click here for additional data file. References 1 Bastos MB , BurkhoffD, MalyJ, DaemenJ, den UilCA, AmelootKet al Invasive left ventricle pressure-volume analysis: overview and practical clinical implications. Eur Heart J 2020;41 :1286-1297.31435675 2 Brener MI , MasoumiA, NgVG, TelloK, BastosMB, CornwellWK. et al Invasive right ventricular pressure-volume analysis: basic principles, clinical applications, and practical recommendations. Circ Heart Fail 2022;15 :e009101. 3 Richter MJ , HsuS, YogeswaranA, Husain-SyedF, VadaszI, GhofraniHAet al Right ventricular pressure-volume loop shape and systolic pressure change in pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2021;320 :L715-L725.33655769 |
NPJ Digit Med NPJ Digit Med NPJ Digital Medicine 2398-6352 Nature Publishing Group UK London 789 10.1038/s41746-023-00789-9 Editorial Identifying vulnerable populations in the electronic Framingham Heart Study to improve digital device adherence Mittermaier Mirja [email protected] 12 Venkatesh Kaushik P. 3 Kvedar Joseph C. 3 1 grid.6363.0 0000 0001 2218 4662 Charite Universitatsmedizin Berlin, Corporate Member of Freie Universitat Berlin and Humboldt-Universitat zu Berlin, Department of Infectious Diseases, Respiratory Medicine and Critical Care, Berlin, Germany 2 grid.484013.a 0000 0004 6879 971X Berlin Institute of Health at Charite Universitatsmedizin Berlin, Chariteplatz 1, 10117 Berlin, Germany 3 grid.38142.3c 000000041936754X Harvard Medical School, Boston, MA USA 13 3 2023 13 3 2023 2023 6 403 2 2023 1 3 2023 (c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit The usage of digital devices in clinical and research settings has rapidly increased. Despite their promise, optimal use of these devices is often hampered by low adherence. The relevant factors predictive of long-term adherence have yet to be fully explored. A recent study investigated device usage over 12 months in a cohort of the electronic Framingham Heart Study. It identified sociodemographic and health-related factors associated with the long-term use of three digital health components: a smartphone app, a digital blood pressure cuff, and a smartwatch. The authors found that depressive symptoms and lower self-rated health were associated with lower smartwatch usage. Female sex and higher education levels were associated with higher app-based survey completion. Here, we discuss factors predictive for adherence and personalized strategies to promote adherence to digital tools. Subject terms Diagnosis Developing world issue-copyright-statement(c) The Author(s) 2023 pmcDigital device adherence Digital devices like smartwatches, fitness trackers, and digital medical devices such as digital blood pressure (BP) cuffs and spirometers have become increasingly common. These devices offer new ways to track patient health in real-time and facilitate self-management and prevention of disease. Such digital health innovations could also transform clinical trials, including prospective cohort studies or randomized controlled trials (RCTs), through new dimensions of data collected longitudinally outside a clinical setting. For most applications, daily and long-term use of digital devices is required to collect meaningful data for clinical and research contexts. In clinical practice, long-term adherence is essential to the quality of care provided. For example, endocrinologists and primary care physicians receive real-time glucose data for insulin management. Some tests (such as those for hypoglycemia) require continuous monitoring during a specific time window. While clinical trials have found that adherence to digital devices is often low1,2, most studies evaluating such adherence behaviors have captured data for only a short period. Further work is needed to explore the factors associated with long-term usage. Pathiravasan et al. aimed to identify factors associated with using digital devices in a nested e-cohort (eFHS) embedded within the well-known Framingham Heart Study3. Usage of digital components, i.e., smartphone app, digital BP cuff, and smartwatch, was observed over 12 months. The authors identified several sociodemographic and health-related factors associated with long-term usage by applying multivariate analysis. Depressive symptoms and lower than excellent self-rated health were associated with lower use of the smartwatch3. This corresponds with other studies showing digital devices are least used by high-risk patients such as elderly persons and patients with chronic diseases4. Further, previous studies have shown that chronic diseases, lower self-reported health, and depression were associated with lower usage of wearing activity trackers5,6. This data helps to identify patient subgroups who might benefit from additional measures to support the use of digital devices to promote health. Identifying each patient's unique needs is crucial in encouraging adherence to technology. For example, patients unable to track medication intake using an app may benefit from a pill that monitors ingestions7 or an electronic medication bottle cap with audio-visual reminder8. On the other hand, certain health and socioeconomic factors determine good adherence to digital medical devices. For example, Pathiravasan et al. found that higher levels of education and female sex were associated with higher completion of the app-based surveys. They also found that iPhone users were likelier to submit app-based surveys than Android users. Android users were less likely to be women and had lower educational and health levels. A previous study9 showed that iPhone users are more tech-enabled and interested in retail-mobile apps. This suggests that the type of smartphone itself can be a proxy for socioeconomic and educational factors associated with digital device usage3. It also suggests that developers and health promotion leaders should be keen to avoid entrenching disparities by targeting multiple device platforms. Digital health devices can empower older patients to maintain functional independence by self-managing their health conditions using symptom trackers and regular monitoring. Elderly patients face significant barriers (e.g., digital literacy) that affect their ability to interact with digital devices, a phenomenon known as the digital divide10. However, Pathiravasan et al3. found that older adults, once enrolled, were more likely to engage with digital devices than younger participants, consistent with previous findings11. These findings support investment into digital literacy for elderly patients, which can be delivered by individual physicians, provider groups, community organizations, etc. It also encourages further action to include elderly populations in digital health initiatives rather than exclude them due to starting hurdles. While digital devices offer immense potential for personalized medicine, they also provide new ways to address population-based impact. Daily habits can be challenging to change, and digital devices are more likely to be used if they are easily integrated into a patient's lifestyle. A person who has never worn a watch might find it harder to wear a smartwatch daily. A diabetes patient habituating to measuring blood sugar several times per day might easily switch to a device that automatically saves and transfers data. In these ways, digital health tools should be offered and integrated into patients' lives based on their unique behavioral, environmental, health, and social contexts. Conclusion Altogether, digital devices have an immense potential to transform clinical delivery and clinical research. To fully exploit the potential of digital devices across all populations, it is pivotal to identify the complex factors contributing to and preventing adherence. Developing personalized supporting strategies for identified patient subgroups is essential to increase digital device adherence. Author contributions M.M. wrote the first draft. K.P.V. contributed to the first draft and provided critical revisions. J.C.K. provided critical revisions. All authors approved the final draft. Competing interests J.C.K. is the Editor-in-Chief of npj Digital Medicine. The other authors declare no competing financial or non-financial interests. References 1. Meyerowitz-Katz G Rates of attrition and dropout in app-based interventions for chronic disease: systematic review and meta-analysis J. Med. Internet Res. 2020 22 e20283 10.2196/20283 32990635 2. Torous J Lipschitz J Ng M Firth J Dropout rates in clinical trials of smartphone apps for depressive symptoms: a systematic review and meta-analysis J. Affect. Disord. 2020 263 413 419 10.1016/j.jad.2019.11.167 31969272 3. Pathiravasan CH Factors associated with long-term use of digital devices in the electronic Framingham Heart Study NPJ Digital Med. 2022 5 195 10.1038/s41746-022-00735-1 4. Reiners, F., Sturm, J., Bouw, L. J. W. & Wouters, E. J. M. Sociodemographic factors influencing the use of eHealth in people with chronic diseases. Int. J. Environ. Res. Public Health 16, 10.3390/ijerph16040645 (2019). 5. Li L Peng W Kononova A Bowen M Cotten SR Factors associated with older adults' long-term use of wearable activity trackers Telemed. J. E Health 2020 26 769 775 10.1089/tmj.2019.0052 31553281 6. Chandrasekaran R Katthula V Moustakas E Patterns of use and key predictors for the use of wearable health care devices by US adults: insights from a national survey J. Med. Internet Res. 2020 22 e22443 10.2196/22443 33064083 7. Mullard A FDA approves first digital pill Nat. Rev. Drug Discov. 2017 16 818 29180736 8. Chun-Yun Kang G Technology-based interventions to improve adherence to antihypertensive medications an evidence-based review Digit. Health 2022 8 20552076221089725 35531090 9. Taylor, D. G. & Levin, M. Predicting mobile app usage for purchasing and information-sharing. Int. J. Retail Distrib. Manag. 42, 10.1108/IJRDM-11-2012-0108 (2014). 10. Frutos E Exploring the digital divide as a barrier to use a personal health record in the elderly Stud. Health Technol. Inform. 2022 294 545 549 35612139 11. Pratap A Indicators of retention in remote digital health studies: a cross-study evaluation of 100,000 participants NPJ Digital Med. 2020 3 21 10.1038/s41746-020-0224-8 |
Sci Rep Sci Rep Scientific Reports 2045-2322 Nature Publishing Group UK London 36914707 31255 10.1038/s41598-023-31255-x Publisher Correction Publisher Correction: Sortilin knock-down alters the expression and distribution of cathepsin D and prosaposin and up-regulates the cation-dependent mannose-6-phosphate receptor in rat epididymal cells Aguilera Andrea Carolina 12 Leiva Natalia 12 Alvarez Pablo Ariel 2 Pulcini Georgina 3 Pereyra Laura Lucia 3 Morales Carlos Ramon 4 Sosa Miguel Angel 23 Carvelli Lorena [email protected] 23 1 grid.412108.e 0000 0001 2185 5065 CONICET, Facultad de Ciencias Medicas, Universidad Nacional de Cuyo, M5500 Mendoza, Argentina 2 grid.412108.e 0000 0001 2185 5065 Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Cuyo, M5500 Mendoza, Argentina 3 grid.412108.e 0000 0001 2185 5065 IHEM-CONICET, Facultad de Ciencias Medicas, Universidad Nacional de Cuyo, M5500 Mendoza, Argentina 4 grid.14709.3b 0000 0004 1936 8649 Faculty of Medicine, McGill University, Montreal, QC H3A0C7 Canada 13 3 2023 13 3 2023 2023 13 4152(c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit issue-copyright-statement(c) The Author(s) 2023 pmcCorrection to: Scientific Reports published online 01 March 2023 Figure 1 in the original version of this Article displayed a yellow border which was redundant and consequently removed. The original Figure 1 and accompanying legend appear below.Figure 1 Effect of sortilin depletion on the distribution and processing of Cathepsin D in RCE-1 cells. (A) Immunofluorescence staining of sortilin and CatD in the RCE1 cells. Confocal representative images and quantification of co-localization of sortilin and CatD (MCC-M1); CatD and sortilin (MCC-M2). The shown cells were taken from the framed area of the lower magnification image (right merge). (B) Representative immunofluorescence staining of CatD and LAMP-1 in RCE1 and RCE-1 KD cells. Quantification of co-localization of LAMP-1 and CatD (MCC-M1); CatD and LAMP-1 (MCC-M2). Values are expressed as the means of Manders colocalization coefficients 1 and 2 (MCC-M1 and MCC-M2, respectively) +- SEM. (*) significant difference from RCE-1 (p < 0.01). Scale bars = 10 mm. (C) Representative immunoblot of CatD in RCE-1 M (mock-depleted), RCE-1 and RCE-1 KD cells. Bands intensities of pro-CatD (52 kDa) and CatD (48 kDa) were quantified separately. Bars represent the means of the total CatD (pro-CatD + CatD), as relative optical densities (R.O.D.) +- SEM (upper histogram) and the means of pro-CatD percentage in each sample +- SEM (lower histogram) from four independent experiments. (*) and (**) significant differences (p < 0.01 and p < 0.05, respectively). Ponceau S staining were used as loading control. The full-lenght immunoblot is presented in Supplementary Fig. 2. The original Article has been corrected. |
Shankar M 68 Obesity, penile cancer AV Cefo+Lev No Died This report 1M, male; NK, not known; PcG, penicillin G; Ceft, ceftriaxone; Gen, gentamicin; Cefo, cefotaxime; Van, vancomycin; Cefe, cefepime; Lev, levofloxacin; Mer, meropenem; PAV, prosthetic aortic valve; AV, aortic valve; MV, mitral valve; MVR, mitral valve replacement. In larger case series describing the prognosis of IE caused by aerococci it appears that the prognosis is relatively favourable despite that patients are typically very old and have multiple comorbidities , . In this respect our case is unusual as the patient had an unfavourable outcome despite that he was not very old and did not have multiple known comorbidities. The death was likely caused by the acute IE of the aortic valve and aortic root. The severe acute aortic regurgitation probably led to volume overload of the left ventricle and pulmonary congestion. It also, probably, led to severely decreased stroke volume and coronary perfusion gradients, thus, ending with cardiac arrest due to extensive myocardial ischemia. The point of entry of the A. sanguinicola isolate was not identified in our case but we speculate that the urological problems posed after penectomy was the cause of infection and the point of entry for the bacteria. In patients with underlying urological problems, aerococci are likely among the more common causes of IE. In our case, empirical treatment effective against A. sanguinicola was rapidly instituted and therefore the exact aetiology of the IE was not important for the choice of therapy in this specific case. The indication for acute surgery in this case was clear, based on acute left ventricular volume overload due to acute aortic regurgitation, congestive left heart failure, periannular extension with abscess root formation and a large vegetation. As the state of the patient was temporarily stable and the planned surgical procedure was complex and associated with a high intraoperative risk, the surgical intervention was planned within 24 h, in accordance with current guidelines , under careful clinical monitoring. Current guidelines recommend preoperative coronary angiography in male patients with atherosclerotic risk factors, and in patients presenting with suspected myocardial ischemia, as in our case . Soon after coronary angiography the patient developed refractory cardiogenic shock and cardiac arrest with a fatal outcome. This case illustrates the well-known high mortality risk associated with acute severe aortic regurgitation due to IE. Moreover, this case demonstrates that IE caused by A. sanguinicola may have a severe course. Author statement Raluca Jumatate did the echocardiography and drafted the case report. Peter Hammarlund treated the patient and provided critical comments to the draft. Madlene Holmqvist participated in the care as an ID-consultant, provided the microbiology details and commented on the draft. Arash Mokthari was the cardiac surgeon involved and gave critical comments especially to the parts concerning surgery. Magnus Rasmussen drafted the introduction and discussion and provided expertise on aerococcal endocarditis. All authors agreed to the submission of the manuscript in the present form. Competing interests The authors have no competing interests. Acknowledgements None. Ethical approval Not applicable according to Swedish legislation for case reports. Consent The patient is diseased and thus the son gave his consent as the closest relative. Informed consent The relatives of the patient gave informed consent to the publication of this report. |
NPJ Parkinsons Dis NPJ Parkinsons Dis NPJ Parkinson's Disease 2373-8057 Nature Publishing Group UK London 483 10.1038/s41531-023-00483-3 Author Correction Author Correction: A meta-analysis of the diagnostic utility of biomarkers in cerebrospinal fluid in Parkinson's disease Xiang Chunchen 12 Cong Shengri 1 Tan Xiaoping 1 Ma Shuang 1 Liu Yang 1 Wang Hailong 3 Cong Shuyan [email protected] 1 1 grid.412467.2 0000 0004 1806 3501 Department of Neurology, Shengjing Hospital of China Medical University, Shenyang, China 2 grid.24696.3f 0000 0004 0369 153X Department of Neurology, Beijing Tiantan Hospital, Capital Medical University, Beijing, China 3 grid.412636.4 0000 0004 1757 9485 Department of Clinical Epidemiology and Evidence-Based Medicine, First Hospital of China Medical University, Shenyang, China 13 3 2023 13 3 2023 2023 9 39(c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit Subject terms Parkinson's disease Diagnostic markers issue-copyright-statement(c) The Author(s) 2023 pmcCorrection to: npj Parkinson's Disease 10.1038/s41531-022-00431-7, published online 29 November 2022 In this article the paragraph starting 'Recommendation for CSF biomarkers' was repeated. The original article has been corrected. |
Sci Rep Sci Rep Scientific Reports 2045-2322 Nature Publishing Group UK London 31266 10.1038/s41598-023-31266-8 Publisher Correction Publisher Correction: Comparison of finger flexor resistance training, with and without blood flow restriction, on perceptional and physiological responses in advanced climbers Andersen Vidar [email protected] 1 Hermans Espen 1 Vereide Vegard 1 Stien Nicolay 1 Paulsen Goran 12 Balas Jiri 3 Michailov Michail Lubomirov 4 Pedersen Helene 1 Saeterbakken Atle Hole 1 1 grid.477239.c 0000 0004 1754 9964 Faculty of Education, Arts and Sports, Western Norway University of Applied Sciences, 133 6851 Sogndal, PB Norway 2 grid.412285.8 0000 0000 8567 2092 Department of Physical Performance, Norwegian School of Sport Sciences, Oslo, Norway 3 grid.4491.8 0000 0004 1937 116X Faculty of Physical Education and Sport, Charles University, Prague, Czechia 4 grid.445373.2 0000 0001 0700 7967 Department Theory and Methodology of Sports Training, National Sports Academy, Sofia, Bulgaria 13 3 2023 13 3 2023 2023 13 4168(c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit issue-copyright-statement(c) The Author(s) 2023 pmcCorrection to: Scientific Reports 10.1038/s41598-023-30499-x, published online 25 February 2023 The original version of this Article contained an error in the order of the Figures. Figures 1 and 2 were published as Figures 2 and 1. As a result, the Figure legends were incorrect.Figure 1 Accumulated training volume (kg x sec) in set 1, set 1 + 2, and set 1 + 2 + 3 in the three sessions Low, Low + BFR, and High. Data presented as mean and standard deviation. *p < 0.05, #p < 0.01. Figure 2 Overview of the study design and finger flexor training apparatus. The original Figures 1 and 2 and accompanying legends appear below. The original Article has been corrected. |
NPJ Breast Cancer NPJ Breast Cancer NPJ Breast Cancer 2374-4677 Nature Publishing Group UK London 516 10.1038/s41523-023-00516-3 Author Correction Author Correction: Lipid exposure activates gene expression changes associated with estrogen receptor negative breast cancer Yadav Shivangi 1 Virk Ranya 2 Chung Carolina H. 3 Eduardo Mariana Bustamante 1 VanDerway David 2 Chen Duojiao 4 Burdett Kirsten 5 Gao Hongyu 4 Zeng Zexian 6 Ranjan Manish 1 Cottone Gannon 1 Xuei Xiaoling 4 Chandrasekaran Sriram 3789 Backman Vadim 2 Chatterton Robert 10 Khan Seema Ahsan [email protected] 1 Clare Susan E. [email protected] 1 1 grid.16753.36 0000 0001 2299 3507 Department of Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611 USA 2 grid.16753.36 0000 0001 2299 3507 Department of Biomedical Engineering, Northwestern University, Evanston, IL 60208-2850 USA 3 grid.214458.e 0000000086837370 Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109 USA 4 grid.257413.6 0000 0001 2287 3919 Center of for Medical Genomics, Indiana University School of Medicine, Indianapolis, IN 46202 USA 5 grid.16753.36 0000 0001 2299 3507 Department of Preventive Medicine, Northwestern University, Chicago, IL 60611 USA 6 grid.65499.37 0000 0001 2106 9910 Department of Data Sciences, Dana Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, MA 02215 USA 7 grid.214458.e 0000000086837370 Program in Chemical Biology, University of Michigan, Ann Arbor, MI 48109 USA 8 grid.214458.e 0000000086837370 Rogel Cancer Center, University of Michigan Medical School, Ann Arbor, MI 48109 USA 9 grid.214458.e 0000000086837370 Center for Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI 48109 USA 10 grid.16753.36 0000 0001 2299 3507 Department of Obstetrics and Gynecology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 USA 13 3 2023 13 3 2023 2023 9 11(c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit Subject terms Breast cancer Chromatin remodelling issue-copyright-statement(c) The Author(s) 2023 pmcCorrection to: npj Breast Cancer 10.1038/s41523-022-00422-0, published online 04 May 2022 In this article, funding from the National Institutes of Health (award number R01CA228272) was inadvertently omitted. The original article has been corrected. |
Front Psychol Front Psychol Front. Psychol. Frontiers in Psychology 1664-1078 Frontiers Media S.A. 10.3389/fpsyg.2023.1140818 Psychology Correction Corrigendum: Utilising online eye-tracking to discern the impacts of cultural backgrounds on fake and real news decision-making Brockinton Amanda 1 * Hirst Sam 2 Wang Ruijie 1 McAlaney John 1 Thompson Shelley 3 1Department of Psychology, Faculty of Science and Technology, Bournemouth University, Poole, United Kingdom 2Department of Archaeology, Faculty of Social Sciences and Health, Durham University, Durham, United Kingdom 3Bournemouth Business School, Bournemouth University, Poole, United Kingdom Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Amanda Brockinton [email protected] This article was submitted to Cognition, a section of the journal Frontiers in Psychology 28 2 2023 2023 28 2 2023 14 114081809 1 2023 17 2 2023 Copyright 2023 Brockinton, Hirst, Wang, McAlaney and Thompson. 2023 Brockinton, Hirst, Wang, McAlaney and Thompson This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on Utilising online eye-tracking to discern the impacts of cultural backgrounds on fake and real news decision-making by Brockinton, A., Hirst, S., Wang, R., McAlaney, J., and Thompson, S. (2022). Front. Psychol. 13:999780. doi: 10.3389/fpsyg.2022.999780 fake news online eye-tracking psychology culture cybersecurity pmcIn the published article, there was an error in the Funding statement. The grant number was mistakenly omitted. The correct Funding statement appears below. This material is based upon work supported by, or in part by, the Army Research Laboratory and the Army Research Office under contract/grant number W911NF-19-0419. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Microbiol Front Microbiol Front. Microbiol. Frontiers in Microbiology 1664-302X Frontiers Media S.A. 10.3389/fmicb.2023.1159629 Microbiology Editorial Editorial: Gut-lung interaction axis Pi Jiang 1 Zhang Guoliang 2 3 * Zeng Gucheng 4 * 1Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, The First Dongguan Affiliated Hospital, Guangdong Medical University, Dongguan, China 2Institute for Hepatology, National Clinical Research Center for Infectious Disease, Shenzhen, China 3Guangdong Key Laboratory for Emerging Infectious Diseases, Shenzhen Third People's Hospital, National Clinical Research Center for Tuberculosis, Southern University of Science and Technology, Shenzhen, China 4Department of Microbiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China Edited and reviewed by: Zhiyong Li, Shanghai Jiao Tong University, China *Correspondence: Guoliang Zhang [email protected] Gucheng Zeng [email protected] This article was submitted to Microbial Symbioses, a section of the journal Frontiers in Microbiology 28 2 2023 2023 14 115962906 2 2023 13 2 2023 Copyright (c) 2023 Pi, Zhang and Zeng. 2023 Pi, Zhang and Zeng This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Gut-lung interaction axisgut lung microorganisms immunity gut-lung interaction axis pmcGastrointestinal diseases or disorders have been widely reported to accompany lung diseases. A wide range of microorganisms colonize in the epithelial tissue of the gastrointestinal tract and the lung compartment, and the mucous membranes of the intestine and respiratory tract provide a physiological and immune barrier against invading microorganisms. Recently, increasing studies have indicated that the gut microbe's unique composition, structure, and function and, consequently, their unique productions of metabolites and other components may effectively affect the occurrence and development of lung diseases. Thus, although the intestine and lung tissues are relatively far apart in their anatomic structure, they have similar cell origins and close physiological connections, which makes such extensive and intensive communications between the intestine and lung happen and sustain. However, causal relationship between lung and intestinal disease are largely clinically and mechanistically uncharacterized, and, particularly, the exact microorganisms or microbial components that play a critical role in mediating health and diseases of intestine or lung through the gut-lung axis and their underlying mechanisms are still largely unclear. Therefore, identifying the exact microbial components and mechanisms that govern the gut-lung interactions is fundamentally important and may facilitate the development of new therapeutics against both lung and gastrointestinal diseases. Frontiers in Microbiology recently published a series of articles under the Research Topic "Gut-lung interaction axis." This Research Topic contains four original articles exploring the potential linkages and underlying mechanisms for gut-lung interaction axis. Xi et al. utilized fecal metagenome analysis to evaluate the association between gut microbiome signatures and disease progression in locally advanced non-small cell lung cancer (LA-NSCLC) patients treated with concurrent chemoradiotherapy (CCRT). They found that the baseline composition and functionality of gut microbiome might be associated with progression-free survival (PFS) rates in LA-NSCLC treated with CCRT, and, interestingly, the higher baseline microbiome diversity and the outcomes of CCRT might be modulated through bacterial metabolic pathways (Xi et al.). Moreover, their results indicated that the expression of antibiotic-resistance genes might play a role in disease progression, which therefore provide potential new information on the relationship between the use of antibiotics and therapeutic efficacy of CCRT in LA-NSCLC. Xia et al. comparatively analyzed the lung microbiota and lung immune profiles in bronchoalveolar lavage fluid (BALF) derived from a total of 78 patients, including 21 patients with primary pulmonary tuberculosis (PTB), eight patients with newly diagnosed lung cancer (LC), and 49 patients with community-acquired pneumonia (CAP). They found increased bacterial a-diversity and richness in LC patients, and the CAP-associated pulmonary microbiota were significantly different between PTB and LC patients (Xia et al.). Additionally, BALF cytokine profiles were varied significantly and correlated with the key functional bacteria signatures in pulmonary microbiota of patients with PTB, LC, and CAP. Zhu et al. explored the microbiome-driven pathogenesis mechanisms of pneumocystis pneumonia (PCP) in acquired immune deficiency syndrome (AIDS) patients. They found that human immunodeficiency virus (HIV) infection and PCP significantly altered the species compositions of both lung and intestinal microbiomes, and HIV infection significantly affected intestinal microbiome gene functions (Zhu et al.). They also found close correlations between different microorganisms and clinical indicators and their classification models that may have potentials to distinguish HIV+ from . Mazzarelli et al. analyzed the association between gut microbiota and a combination of several clinical covariates to characterize the bacterial signatures associated with mild or severe symptoms during the SARS-CoV-2 infection. They found a significant greater proportion of Campylobacterota and Actinobacteriota at phylum level in SARS-CoV-2-infected patients affected who developed more severe diseases characterized by respiratory distress requiring invasive or non-invasive ventilation (Mazzarelli et al.). Their results showed that patients affected by SARS-CoV-2 with mild or severe symptoms displayed significantly different gut microbiota profiles, which can be exploited as potential prognostic biomarkers paving the new way to integrative therapeutic approaches. In conclusion, these four articles introduced a series of interesting evidence advancing our understanding for the role of "Gut-lung interaction axis" in pathogenesis mechanisms of lung diseases and AIDS. However, more works are still needed to further explore the exact molecular events in "Gut-lung interaction axis" modulating the pathogenesis mechanisms of diseases, which may provide novel insights into diagnoses, prevention and treatments for pulmonary, intestinal, and potentially other systematic diseases. Author contributions JP wrote the draft. GZh and GZe helped to revise the draft and were responsible for leading this work. All authors contributed to the article and approved the submitted version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Psychol Front Psychol Front. Psychol. Frontiers in Psychology 1664-1078 Frontiers Media S.A. 10.3389/fpsyg.2023.1148186 Psychology Editorial Editorial: Secondary traumatic stress: Risk factors, consequences, and coping strategies Acquadro Maran Daniela 1 * Dolce Valentina 2 Colombo Lara 1 1Department of Psychology, University of Turin, Turin, Italy 2Institut de Psychologie, Universite Lumiere Lyon 2, Lyon, France Edited by: Pietro Crescenzo, University of Bari Aldo Moro, Italy Reviewed by: Giuseppe Pierpaolo Merola, University of Florence, Italy *Correspondence: Daniela Acquadro Maran [email protected] This article was submitted to Organizational Psychology, a section of the journal Frontiers in Psychology 28 2 2023 2023 14 114818619 1 2023 10 2 2023 Copyright (c) 2023 Acquadro Maran, Dolce and Colombo. 2023 Acquadro Maran, Dolce and Colombo This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Secondary traumatic stress: Risk factors, consequences, and coping strategiessecondary trauma stress coping strategies risk factors consequence vicarious trauma pmcThe concept of "vicarious traumatization" was first introduced by McCann and Pearlman (1990), and from then on the construct gained increasing interest among researchers (Branson, 2019; Ashley-Binge and Cousins, 2020). Figley (1995) used the term "secondary traumatic stress" or "vicarious traumatization" to refer to all those individuals who, because of repeated and close relationships with individuals who have directly experienced traumatic events, are at risk of becoming indirect victims of the same trauma and experiencing forms of emotional decompensation. Everyone is potentially exposed to at least one traumatic event during their lifetime; for people in helping professions, the likelihood increases because they themselves and others are exposed to more stressful events (Argentero and Setti, 2011). Thus, it can be said that this risk affects all professions that provide assistance and support to individuals and/or populations who are victims of trauma (Figley, 1999). Concurrent with the expansion of the topic into professional research, a meta-analysis was conducted to develop Australian clinical guidelines for working with adult survivors of child abuse (Adult Survivors of Child Abuse, 2012). Adult Survivors of Child Abuse (2012) recognizes that working with traumatized individuals through both direct and indirect means requires significant commitment and notes that knowledge of the risk factors associated with these forms of abuse is insufficient to effectively deal with situations that result in severe distress. Furthermore, it is increasingly recognized that secondary traumatic stress is a common, natural, and potentially harmful response for all professionals working with individuals affected by traumatic events (Sprang et al., 2019). Setti and Argentero (2012) identify vicarious traumatization as a form of occupational stress and, consequently, a psychosocial risk factor characteristic of all helping professions. In terms of consequences, psychological symptoms are similar to those of post-traumatic stress disorder acquired through contact with people suffering from the effects of trauma. Thus, workers may experience negative consequences such as anxiety, depression, sleep disturbances, intrusive thoughts, maladaptive coping strategies (e.g., increased use of psychotropic substances), and negative emotions such as anger and feelings of inadequacy (Collins and Long, 2003). In addition, secondary trauma can impact resilience and affect worker performance: e.g., decreased effectiveness of intervention with patients/clients/citizens, etc., inability to express negative feelings through denial of difficulties at work, emotional withdrawal that can impact emotional (relatives, friends) and social (colleagues, supervisors) environments. This Research Topic includes four research articles that deepen our understanding of the phenomenon, its analysis, and ways to alleviate it. Three articles are from China and one from Slovakia. Wu et al. conducted a study on the coping style choices of recruits under psychological stress while performing military tasks. One thousand and twenty-eight Chinese recruits were interviewed in two waves of survey. Results showed that recruits' psychological stress negatively affected positive coping styles and positively correlated with negative coping styles. In addition, self-efficacy and social support mediated the relationship between psychological stress and positive coping styles, and self-efficacy mediated the relationship between psychological stress and negative coping styles. More importantly, self-efficacy and social support formed the mediating chain between psychological distress and positive coping styles. The use of appropriate coping strategies can help reduce stress and improve task performance through their effect on self-efficacy ratings. Coping style was also analyzed in the study by Sun et al. The authors examined the factors and mechanisms that influence depression in medical professions. In their cross-sectional study, 1,139 physicians were surveyed using a cluster sampling method. Questionnaires included the Psychological Capital Questionnaire, the Chinese Employees' Organizational Commitment Questionnaire, the Coping Style Questionnaire, and the Depression Self-Rating Scale. The study found that 41.6% of the physicians suffered from depression. Among them, 17.0% of the physicians suffered from moderate depression and 2.6% from severe depression. Results showed that psychological capital was sequentially associated with higher organizational commitment and a more positive coping style, which led to a reduction in depression among physicians. Yan et al. examined the psychometric properties of a simplified version of the Secondary Trauma Questionnaire for Chinese on a potentially traumatized sample (N = 875) of physicians, nurses, teachers, administrators, and social workers. Results showed that the full scale had good internal consistency, convergent validity, discriminant validity, and factorial validity. The CFA confirmed a single-factor structure; the configural, metric, scalar, and strict invariance of the secondary trauma questionnaire were acceptable for all genders. The present results suggest that the scale is a reliable and valid self-report instrument for use with potentially traumatized individuals in China and support the notion that it is suitable for further cross-cultural adaptation. Examining the phenomenon in multiple cultures or measuring the differences between cultures could be useful to better understand the process underlying the experience and its consequences. In their study, Halamova et al. from Slovakia examined the long-term effectiveness of a novel emotion-focused training for helping professions on levels of compassion fatigue (secondary traumatic stress and burnout), self-criticism, self-compassion, and compassion for others. A randomized controlled trial was conducted with 253 participants. Results showed that participants in the experimental group reported significantly lower scores for secondary traumatic stress, burnout, and self-criticism and higher scores for self-compassion at the conclusion of the intervention, and that these results persisted 2 months after the conclusion of the intervention. Compared with the control group, participants in the experimental group had significantly lower scores for secondary traumatic stress, burnout, and self-criticism and higher scores for self-compassion after the intervention. The training proved effective in reducing compassion fatigue (secondary traumatic stress and burnout) and self-criticism and increasing self-compassion. Author contributions DA, VD, and LC contributed substantially and intellectually to the Research Topic and approved the editorial for publication. All authors contributed to the article and approved the submitted version. The authors would like to thank all authors for their commitment to the Research Topic and all Frontiers staff for their support of the Research Topic. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Adult Survivors of Child Abuse. (2012). Practice Guidelines for Treatment of Complex Trauma and Trauma Informed Care and Service Delivery, eds C. A. Kezelman and P. A. Stavropoulous Sydney, NSW: ASCA. Argentero P. Setti I. (2011). Engagement and vicarious traumatization in rescue workers. Int. Arch. Occup. Environ. Health 84 , 67-75. 10.1007/s00420-010-0601-8 21079988 Ashley-Binge S. Cousins C. (2020). Individual and organisational practices addressing social workers' experiences of vicarious trauma. Practice 32 , 191-207. 10.1080/09503153.2019.1620201 31828329 Branson D. C. (2019). Vicarious trauma, themes in research, and terminology: a review of literature. Traumatology 25 , 2-10. 10.1037/trm0000161 Collins S. Long A. (2003). Working with the psychological effects of trauma: consequences for mental health-care workers - a literature review. J. Psychiatr. Mental Health Nurs. 10 , 417-424. 10.1046/j.1365-2850.2003.00620.x 12887633 Figley C. R. (1995). "Systemic traumatization: secondary traumatic stress disorder in family therapists," in Integrating Family Therapy: Handbook of Family Psychology and Systems Theory, eds R. H. Mikesell, D.-D. Lusterman, and S. H. McDaniel (Washington, DC: American Psychological Association), 571-581. 10.1037/10172-033 Figley C. R. (1999). "Police compassion fatigue (PCF): theory, research, assessment, treatment, and prevention," in Police Trauma: Psychological Aftermath of Civilian Combat, eds J. M. Violanti and D. Paton (Baltimore: Charles C Thomas Publisher, Ltd.), 37-53. McCann I. L. Pearlman L. A. (1990). Vicarious traumatization: a framework for understanding the psychological effects of working with victims. J. Traumat. Stress 3 , 131-149. 10.1007/BF00975140 Setti I. Argentero P. (2012). Vicarious Trauma: A Contribution to the Italian Adaptation of the Secondary Traumatic Stress Scale in a Sample of Ambulance Operators. Firenze: Giunti Organizzazioni Speciali. 10.1037/t21882-000 Sprang G. Ford J. Kerig P. Bride B. (2019). Defining secondary traumatic stress and developing targeted assessments and interventions: lessons learned from research and leading experts. Traumatology 25 , 72. 10.1037/trm0000180 |
Front Nutr Front Nutr Front. Nutr. Frontiers in Nutrition 2296-861X Frontiers Media S.A. 10.3389/fnut.2023.1157853 Nutrition Editorial Editorial: Bioaccessibility and bioavailability studies and their importance in the evaluation of health-promoting properties of bioactive compounds Gutierrez-Grijalva Erick P. 1 * + Antunes-Ricardo Marilena 2 3 + Heredia J. Basilio 4 + 1Catedras CONACYT-Centro de Investigacion en Alimentacion y Desarrollo (CIAD) A.C., Culiacan, Sinaloa, Mexico 2Tecnologico de Monterrey, Centro de Biotecnologia-FEMSA, Monterrey, Nuevo Leon, Mexico 3Tecnologico de Monterrey, The Institute for Obesity Research, Monterrey, Nuevo Leon, Mexico 4Laboratory of Functional Foods and Nutraceuticals, Centro de Investigacion en Alimentacion y Desarrollo (CIAD) A.C., Culiacan, Sinaloa, Mexico Edited and reviewed by: Ken Ng, The University of Melbourne, Australia *Correspondence: Erick P. Gutierrez-Grijalva [email protected] This article was submitted to Food Chemistry, a section of the journal Frontiers in Nutrition +These authors have contributed equally to this work 28 2 2023 2023 10 115785303 2 2023 14 2 2023 Copyright (c) 2023 Gutierrez-Grijalva, Antunes-Ricardo and Heredia. 2023 Gutierrez-Grijalva, Antunes-Ricardo and Heredia This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Bioaccessibility and bioavailability studies and their importance in the evaluation of health-promoting properties of bioactive compoundsbioaccessibility bioavailability polyphenols bioactive peptides terpenoids pmcIn the last decade, it has been observed an increasing demand on the part of consumers to have healthier foods that, in addition to providing nutritional benefits and pleasant sensorial characteristics, can also improve their state of health or prevent the appearance of some diseases. Additionally, there is a strong requirement for high-protein products on the market that can be economical and sustainably produced. This situation has represented important challenges for the food industry, not only for the design and development of new products that contain one or more ingredients considered bioactive compounds but also in the search for new protein sources, the development of new environmentally friendly processes in agreement with the circular economy concept, among many others challenges. This panorama has prompted many researchers to focus their efforts on the search for solutions by studying new novel functional ingredients, and how to incorporate them in the development of new foods. The study of new potential ingredients based on bioactive compounds must consider very relevant aspects such as their physical and chemical characteristics, as well as their bioaccessibility after digestion, which will undoubtedly determine the most suitable delivery system to ensure their stability, thus guaranteeing greater bioavailability. of the active compounds and their corresponding biological effects. The study of new potential ingredients based on bioactive compounds must consider relevant aspects of these compounds such as their physical and chemical characteristics, as well as their bioaccessibility after digestion, which will undoubtedly determine the most suitable delivery system to ensure their stability improving their bioavailability of the active compounds and in consequence enhancing their biological effects. As we can understand the different pathways that follow active molecules during their passing through the organism, it will be possible to develop novel products that meet the demands of the market. This Research Topic is aimed to collect research work related to systemic studies of bioaccessibility, bioavailability, and the bioactive properties of bioactive molecules, as well as the strategies to enhance them in favor of human health. In this Research Topic there are four papers covering the different aforementioned aspects. Ajanaku et al. comprehensively reviews the bioactive and phytochemical constituents in ginger, turmeric, and garlic with an association with their potential pharmaceutical properties against cancer and cardiovascular diseases. Zingiberene and zingerone two of the most studied molecules in ginger have been associated with strong anti-inflammatory and antioxidant properties. On the other hand, curcumin is the main phytochemical found in turmeric, and it's potent anti-inflammatory effect is being studied against inflammatory diseases like arthritis. Lastly, garlic is rich in organosulfur compounds like allicin, allin, and ajoene. Marin-Morales et al. showed that the edible grasshoppers Sphenarium purpurascens are a rich source of protein and bioactive peptides with antioxidant properties. Moreover, the authors hypothesize that due to their plant-based feed, grasshopers also contain phenolic acids like protocatechuic acid, hydroxybenzoic acid and flavonoids like luteolin and apigenin. Furthermore, Gong et al. showed the anti-fibrotic effect of extracellular vesicles from tea leaves to liver fibrosis by inhibiting collagen deposition, reducing lipids in the liver, and reduce alanine aminotransferase and aspartate aminotransferase levels. Also, Sharma et al. showed that Glycyrrhiza glabra extracts enhance the permeation ov vitamin B12 up to five times in vitro and ex vivo. Their pharmacokinetic evaluations on Swiss albino mice showed that Cmax, AUC, and Tmax values of B12 were enhanced with the extracts. Author contributions EG-G, MA-R, and JH were responsible for the management of the whole issue. All authors contributed to the article and approved the submitted version. Many thanks to all the authors that contributed to this Research Topic. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Nutr Front Nutr Front. Nutr. Frontiers in Nutrition 2296-861X Frontiers Media S.A. 10.3389/fnut.2023.1154898 Nutrition Editorial Editorial: Application of nano/biotechnology in the detection of food safety and spoilage Belwal Tarun 1 Shen Yizhong 2 Jafari Seid 3 Lin Xingyu 1 4 * 1State Key Laboratory of Fluid Power and Mechatronic Systems, College of Biosystems Engineering and Food Science, Fuli Institute of Food Science, Zhejiang University, Hangzhou, China 2Key Laboratory for Agricultural Products Processing of Anhui Province, School of Food and Biological Engineering, Hefei University of Technology, Hefei, China 3Faculty of Food Science and Technology, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran 4Key Laboratory of Agro-Products Postharvest Handling of Ministry of Agriculture and Rural Affairs, Zhejiang University, Hangzhou, China Edited and reviewed by: Elena Ibanez, Institute of Food Science Research (CSIC), Spain *Correspondence: Xingyu Lin [email protected] This article was submitted to Nutrition and Food Science Technology, a section of the journal Frontiers in Nutrition 28 2 2023 2023 10 115489831 1 2023 07 2 2023 Copyright (c) 2023 Belwal, Shen, Jafari and Lin. 2023 Belwal, Shen, Jafari and Lin This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Application of nano/biotechnology in the detection of food safety and spoilagenano/biotechnology food safety electrochemical analysis optical analysis signal amplification pmcNanotechnology is an emerging technology that utilizes the characteristics of atomic and molecular structures and their interaction principles at the nanoscale and microscale. A lot of nanotechnology research is focused on the field of biological science, while the application of nanotechnology and biotechnology in the field of food science mainly focuses on food safety and spoilage, which can greatly improve the speed, efficiency, and accuracy of food safety and spoilage detection, simplify operation steps, and save manpower and material resources. This Research Topic provides the latest trends on the different analytical methods applying nano/biotechnology for the detection of hazardous substances in food: electrochemical-based food analysis methods and optical-based food analysis methods. Electrochemical sensors have high sensitivity, accuracy, and stability for the monitoring of food safety and spoilage and have been widely used in the field of food science. Vertically-ordered mesoporous silica films (VMSF) are attractive nanoporous materials that have ultra-small, ordered, and uniform nanopores perpendicular to the electrode substrate, showing excellent molecular selectivity and anti-fouling ability, which can be directly applied in complex samples. Guanine, which is abundant in foods and drinks, such as seafood and beer, eventually metabolizes into uric acid in the body, possibly causing gout. Yang L. et al. developed a sensitive electrochemical method for the detection of guanine by integrating VMSF/ITO and tris(2,2'-bipyridine) ruthenium (III) [Ru(bpy)32+] redox media. The electrostatic accumulation of Ru(bpy)32+ by VMSF can act as an electron shuttle between the surface of guanine and the underlying ITO. Thus, it can be used to quantify guanine. In addition to the direct electrochemical (EC) method, electrochemical luminescence (ECL) technology also shows outstanding application prospects in the field of food analysis. Luo et al. first established an EC and ECL two-mode detection method for antimicrobial peptide analysis by combining the specific recognition from antibacterial peptides and the signal amplification effect from VMSF. Ru(bpy)32+@ liposomes are used as signal probes, which can be enriched and sensitively detected by VMSF/ITO electrodes when the Ru(bpy)32+ leaks from nisin-damaged liposomes. The nanoporous material-modified electrode in the confined space can detect the Faraday current to sense the analyte, while the single nanopore can also detect the analyte signal due to ionic current changes. In another study, Yang T. et al. prepared a low aspect-ratio SiN pore with PDMS coating that has high temporal-spatial resolution and can be used to observe the bacterial translocation "event". According to the changes in the electric pulse signals generated by different bacteria passing the pore, three common foodborne pathogens can be identified, such as Salmonella enterica, Listeria monocytogenes, and Escherichia coli. Optical analysis, which is based on the interaction between electromagnetic radiation and matter, plays an important role in food analysis. Nanomaterials can significantly improve the signal strength of food-analyzed substances. Wang et al. developed a new method for the determination of trace Ag(I) by spectrophotometry and Rayleigh scattering (RRS). Ag(I) can react with erythrosine to form nanoparticles in pH 4.4-4.6, leading to a lower absorbance and higher RRS signal, thus the quantitative determination of Ag(I) content was realized. Lv et al. used AuMOF as a nanoprobe to establish a new RS-ET method for detecting sulfur dioxide concentration in food. When basic rhodopsin (BF) is on the surface of AuMOF, RRS intensity at 330 nm decreases, and sulfite can react with BF to form a colorless product (SBF), resulting in an enhanced RRS peak. Therefore, it can be used for quantitative analysis of sulfur dioxide. Zhi et al. established a novel MXene catalytic fluorescence/absorption two-mode aptamer sensor to detect traces of Pb2+. Ti3C2 nanosheet (NS) can catalyze the oxidation of TMB, which can lead to an intense fluorescence peak at 415 nm and an absorption peak at 295 nm, but the Pb2+ aptamer (Aptpb) that adsorbed on the surface of NS can inhibit its catalytic activity. When target Pb2+ is added, it specifically binds with Aptpb, leading to the release of Aptpb from NSs, and the signal is enhanced. Shahdeo et al. developed a microfluidic colorimetric detection device coupled with AuNPs and aptamers to detect Ochratoxin A (OTA). AuNPs were combined with an OTA-specific 36-mer aptamer, and the size of AuNPs changed in the presence of an OTA analyte. The absorbance ratios of A630 and A520 were determined to quantitate OTA. In summary, the studies in this collection showcase the latest advances in the application of nanomaterials to enhance the signal of electrochemical and optical analysis. The research has demonstrated that nano/biotechnology can significantly improve the analytical performance of food analytical methods. We believe that nano/biotechnology has great potential in the development of food safety and spoilage detection technology and these articles may provide inspiration for future research. Author contributions TB, YS, SJ, and XL are responsible for the management of the whole issue. TB wrote the introduction and the conclusion. XL wrote the central part with comments to the cited papers. YS and SJ revised the paper. All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Cardiovasc Med Front Cardiovasc Med Front. Cardiovasc. Med. Frontiers in Cardiovascular Medicine 2297-055X Frontiers Media S.A. 10.3389/fcvm.2023.1141032 Cardiovascular Medicine Editorial Editorial: The role of sex in heart failure and transplantation, volume II Ayesta Ana 1 Diaz-Molina Beatriz 1 Bayes-Genis Antoni 2 Baranchuk Adrian 3 Martinez-Selles Manuel 4 * 1Area del Corazon, Servicio de Cardiologia, Hospital Universitario Central de Asturias, Oviedo, Spain 2Servicio de Cardiologia, Hospital Universitari Germans Trias i Pujol, CIBERCV, Universidad Autonoma de Barcelona, Badalona, Spain 3Kingston Health Science Center, Division of Cardiology, Queen's University, Kingston, ON, Canada 4Servicio de Cardiologia, Hospital General Universitario Gregorio Maranon, Centro de Investigacion Biomedica en Red. Enfermedad Cardiovascular (CIBERCV), Universidad Europea, Universidad Complutense, Madrid, Spain Edited and reviewed by: Matteo Cameli, University of Siena, Italy *Correspondence: Manuel Martinez-Selles [email protected] This article was submitted to Heart Failure and Transplantation, a section of the journal Frontiers in Cardiovascular Medicine 28 2 2023 2023 10 114103209 1 2023 13 2 2023 Copyright (c) 2023 Ayesta, Diaz-Molina, Bayes-Genis, Baranchuk and Martinez-Selles. 2023 Ayesta, Diaz-Molina, Bayes-Genis, Baranchuk and Martinez-Selles This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic The role of sex in heart failure and transplantation, volume IIheart failure heart transplantation frailty sex women pmcHeart failure (HF) is one of the main causes of hospitalization and death in developed countries. This is partly due to population aging but also due to increased survival in patients with heart disease (1). Differences between men and women with HF seem to be extremely relevant a several of them are still under investigation. This Research Topic is a continuation of the first volume previously published regarding this topic. Den Ruijter summarizes the importance of cardiovascular disease in women and the role of sex in this relation. Most cardiovascular diseases at younger ages are more common in men, but under diagnosis in women might increase this difference. X chromosome seems to be related to inflammation and the Y chromosome to atherosclerosis. This fact might be one of the explanations to why men suffer more frequently from coronary artery disease and HF with left ventricular reduced ejection fraction, while women typically have stable atherosclerosis with non-obstructive coronary disease and HF with preserved left ventricular ejection fraction. Women underrepresentation in clinical trials is still an issue that should be solved as sex-dependent mechanisms of cardiovascular diseases might modulate the effect of HF treatments. In fact, Sanroman Guerrero et al. conducted a systematic review of 29 randomized clinical trials in patients with HF with reduced ejection fraction. They observed that the proportion of women was low, there was not a pre-specified analysis of efficacy by sex, and the quality of evidence on the efficacy of medical treatment and devices in women was poor. Dahlen et al. described a sex-specific association between parathyroid hormone and platelet indices in HF patients. The phenotypes of symptomatic HF varied depending on the interaction between parathyroid hormone and platelets in men and women. In women with symptomatic HF with reduced ejection fraction there was a positive association between parathyroid hormone and mean platelet volume, while platelet count was inversely associated with parathyroid hormone in males with HF with reduced ejection fraction and in both sexes with HF with preserved ejection fraction. Some treatments may precipitate HF in women. Cheng et al. evaluated the risk of HF hospitalizations in patients suffering from gout under febuxostat and allopurinol. Febuxostat users had a higher risk of HF hospitalization than allopurinol users, irrespective of previous cardiovascular risk. Interestingly, the risk was higher in women than in men. Bi et al. analyzed the effect of sex on left atrial remodeling and its relationship with myocardial fibrosis in 85 patients with hypertrophic obstructive cardiomyopathy treated with surgical septal myectomy. Left atrial function was evaluated using the early atrial peak of emptying rate and was normalized by left ventricular filling volume. These measurements were lower in patients with this entity compared with healthy controls, particularly in the case of female patients. This was attributed to a higher susceptibility to myocardial fibrosis in women, quantified by collagen volume fraction on magnetic cardiac resonance imaging. These would explain some previously evidence that suggests more severe diastolic dysfunction in women than in men. Gual-Capllonch et al. review sex differences in the prevalence of atrial mitral and tricuspid regurgitations. These valvular heart diseases occur mainly in patients with atrial fibrillation and HF with preserved ejection fraction. Women have a higher prevalence than men, especially in the case of atrial tricuspid regurgitation. Several potential mechanisms might explain these differences. Sex hormones may induce a proinflammatory state with different electrophysiological responses leading to a more advanced left atrial dysfunction and fibrosis in women. In addition, histopathological differences in the annuli and leaflets between women and men have been described. Finally, a later diagnosis of atrial fibrillation and of HF with preserved ejection fraction in women may lead to a less aggressive treatment increasing the prevalence of atrial mitral and tricuspid regurgitation in females. Lozano-Jimenez et al. describe a cohort of 163 patients presenting with cardiogenic shock, 39 women (24%). Postcardiotomy and fulminant myocarditis were more frequent in women, while acute myocardial infarction was more common in male. The use of temporary mechanical circulatory support and its escalation was similar in women and men. The authors found no relevant sex-differences in hospital mortality, Society for Cardiovascular Angiography and Interventions risk stratification, and in the use of advanced HF therapies. Two manuscripts focused on sex-differences in older patients with HF. Sun et al. presented a secondary analysis of The Treatment of Preserved Cardiac Function Heart Failure with an Aldosterone Antagonist Trial (TOPCAT) study (2) evaluating the impact of sex on baseline characteristics and outcomes of 1,619 patients with preserved ejection fraction older than 70 years, with 55.1% women. They found that, compared to males, females had worse cardiac diastolic function, worse New York Heart Association functional class and worse quality of life. However, outcomes in women were better than in men, with lower cardiovascular and all-cause mortality and less hospitalization due to HF. They found no association between sex and spironolactone effects. et al. present a post-hoc analysis of 499 outpatients (28% women) with HF older than 75 years included in the FRAGIC registry (impacto de la FRAGilidad y otros sindromes Geriatricos en el manejo clinico y pronostico del paciente anciano ambulatorio con Insuficiencia Cardiaca) (3). Compared to men, women were more frail and had more frequently other geriatric syndromes, as malnutrition, depression and poorer physical status. Interestingly, this was the case even despite the lower rates of comorbidities in women than in men. Frailty was less common in men but was only an independent predictor of mortality in males. We would like to finish this Research Topic with a call for action to perform more studies on different aspects of HF in women and men. It is particularly important to address this issue in elderly patients with HF, as both women and advanced aged patients have been traditionally underrepresented in HF studies. Author contributions AA prepared the first draft of the manuscript. BD-M, AB-G, AB, and MM-S improved the manuscript with relevant content, contributed to the article, and approved the submitted version. All authors contributed to the article and approved the submitted version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Emmons-Bell S Johnson C Roth G . Prevalence, incidence and survival of heart failure: a systematic review. Heart. (2022) 108 :1351-60. 10.1136/heartjnl-2021-320131 35042750 2. Pitt B Pfeffer MA Assmann SF Boineau R Anand IS Claggett B . Spironolactone for heart failure with preserved ejection fraction. N Engl J Med. (2014) 370 :1383-92. 10.1056/NEJMoa1313731 24716680 3. Jimenez-Mendez C Diez-Villanueva P Bonanad C Ortiz-Cortes C Barge-Caballero E Goirigolzarri J . Frailty and prognosis of older patients with chronic heart failure. Rev Esp Cardiol. (2022) 75 :1011-19. 10.1016/j.rec.2022.04.016 35718066 |
Front Med (Lausanne) Front Med (Lausanne) Front. Med. Frontiers in Medicine 2296-858X Frontiers Media S.A. 10.3389/fmed.2023.1145163 Medicine Editorial Editorial: Rheumatoid arthritis: Pathogenesis and target-treatments Piantoni Silvia 1 * Ohrndorf Sarah 2 1Rheumatology and Clinical Immunology Unit, Department of Clinical and Experimental Sciences, Azienda Socio Sanitaria Territoriale Spedali Civili and University of Brescia, Brescia, Italy 2Department of Rheumatology and Clinical Immunology, Charite-Universitatsmedizin Berlin, Berlin, Germany Edited and reviewed by: Joao Eurico Fonseca, University of Lisbon, Portugal *Correspondence: Silvia Piantoni [email protected] This article was submitted to Rheumatology, a section of the journal Frontiers in Medicine 28 2 2023 2023 10 114516315 1 2023 09 2 2023 Copyright (c) 2023 Piantoni and Ohrndorf. 2023 Piantoni and Ohrndorf This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Rheumatoid arthritis: Pathogenesis and target-treatmentsrheumatoid arthritis pathogenesis research treatments target pmcRheumatoid arthritis (RA) is a chronic autoimmune disease causing progressive articular destructions leading to deformities of the joints. Mainly targeting synovial membranes, it is a systemic inflammatory disease, that affects about 1% of the population (1). The disease strategy of RA is well-established if compared with other rheumatic conditions and has led to improved outcomes (2). Recently, an update of the European recommendations of management has been published (3). Despite the use of many effective immune-targeted drugs, which have dramatically improved the prognosis of the disease during the last years, there are still unmet needs, e.g., accurate biomarkers to stratify patients and to predict therapeutic response (2, 4). In this Research Topic, we focused on basic research papers presenting novel insights in RA pathogenesis and suggesting potential new molecular targets for therapeutics. Hernandez-Breijo et al. have investigated the role of B cell immunophenotyping to predict remission in RA patients after 6 months of therapy [TNF-inhibitors (TNFi) in combination with methotrexate]. They found out that RA patients who were responsive to TNFi therapy showed a reduction of the relative amount of circulating naive B cells, that were recently identified as the first B cell subpopulation involved in joint flares (5, 6). As one limitation, it was not possible to show that the reduction of naive B cells was related to the specific inhibition of the TNF alpha molecule. Therefore, larger studies on RA cohorts treated with different drugs will be needed to confirm the potential utility of the flow cytometric analysis before start of targeted therapies. Su et al. suggested using the analysis of flow cytometry in the peripheral blood of RA patients. They focused in their analysis on different subtypes of follicular T cells. Compared with healthy controls, RA patients had a significantly higher proportion of follicular helper-like T cells, whilst the amount of regulatory T cells was reduced. The authors concluded that T cells might represent potential circulating biomarkers in RA, especially since they play a central role in the pathogenesis of the disease in the early phase. Furthermore, they are responsible for maintenance of the autoimmune process as well as their activation requires co-stimulatory signals provided by surface molecules on the membrane (7). Another paper of our Research Topic has dealt with the T cell related gene polymorphisms in RA. Liu et al. combined an original case-control study on a Chinese population with a meta-analysis focusing on genes. The genes of interest were CTLA-4, CD80/86, and CD28, as being related to co-stimulatory mechanisms. Interestingly, they found out that some CTLA-4 polymorphisms decreased the risk of RA development, furthermore, the CTLA-4 molecule is central in the co-inhibition toward early T cell activation, restraining immune response (7). Studying synovial tissues with advanced and combined laboratory techniques, El Shikh et al. demonstrated new insights into the regulation of follicular dendritic cells. Specific molecules regulate the differentiation of these cells influencing fibroid or a lymphoid synovitis, which are related to prognosis in RA. This study revealed the interactions among new molecules that could potentially be involved in the therapy for difficult-to-treat RA patients. Finally, Shi et al. suggested a potential drug target, which has already been investigated in the context of cancer research. The authors used an arthritis model to demonstrate the role of METTL3 (methyltransferase-like 3), a component of the N6-methyladenosine methyltransferase complex and a regulator of posttranscriptional processes, in the development of the human disease. They presented an upregulation of METTL3 in RA fibroblast-like synoviocytes both in human and murine synovial tissues, enhancing their capability to proliferate, invade, migrate and, also, to promote the production of pro-inflammatory cytokines. Taken together, the results of these studies open new research areas in the field of RA pathogenesis. Basic science studies exist, that exploit the current advanced technologies for the better understanding of the functional mechanisms of synovitis. They usually make use of invasive mechanisms such as synovial biopsies, as recently demonstrated by a precision-medicine, randomized clinical trial (8). In fact, the integration of molecular pathology signatures into clinical algorithm is a convincing future perspective. We also want to encourage basic researchers to further develop translational studies in RA. In future, the combination of an integrated approach including laboratory-based studies, clinical scores and patient reported outcomes as well as personalized digital medicine tools has the potential to overcome the current unmet needs in RA. Author contributions SP wrote the first draft. SO edited and reviewed the draft. All authors approved the final version of the manuscript. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Firestein GS . Evolving concepts of rheumatoid arthritis. Nature. (2003) 423 :356-61. 10.1038/nature01661 12748655 2. McInnes IB Schett G . The pathogenesis of rheumatoid arthritis. N Engl J Med. (2011) 365 :2205-19. 10.1056/NEJMra1004965 22150039 3. Smolen JS Landewe RBM Bergstra SA Kerschbaumer A Sepriano A Aletaha D . EULAR recommendations for the management of rheumatoid arthritis with synthetic and biological disease-modifying antirheumatic drugs: 2022 update. Ann Rheum Dis. (2023) 82 :3-18. 10.1136/ard-2022-223356 36357155 4. Wientjes MHM Ulijn E Kievit W Landewe RBM Meek I den Broeder N . The added value of predictive biomarkers in treat-to-target strategies for rheumatoid arthritis patients: a conceptual modelling study. Rheumatology. (2022) 20 :keac709. 10.1093/rheumatology/keac709 36538875 5. Gravallese EM Robinson WH . PRIME time in rheumatoid arthritis. N Engl J Med. (2020) 383 :278-9. 10.1056/NEJMe2018218 32668119 6. Orange DE Yao V Sawicka K Fak J Frank MO Parveen S . RNA Identification of PRIME cells predicting rheumatoid arthritis flares. N Engl J Med. (2020) 383 :218-28. 10.1056/NEJMoa2004114 32668112 7. Cope AP . T cells in rheumatoid arthritis. Arthritis Res Ther. (2008) 10(Suppl. 1 ):S1. 10.1186/ar2412 19007421 8. Rivellese F Surace AE Goldmann K Sciacca E Cubuk C Giorli G . R4RA collaborative group. Rituximab versus tocilizumab in rheumatoid arthritis: synovial biopsy-based biomarker analysis of the phase 4 R4RA randomized trial. Nat Med. (2022) 28 :1256-68. 10.1038/s41591-022-01789-0 35589854 |
Mol Ther Nucleic Acids Mol Ther Nucleic Acids Molecular Therapy. Nucleic Acids 2162-2531 American Society of Gene & Cell Therapy S2162-2531(23)00038-0 10.1016/j.omtn.2023.02.018 Commentary Detecting blood clots with aptamers: A potentially lifesaving new tool in medicine Rossi John J. [email protected] 1* 1 Center for RNA Biology and Therapeutics, City of Hope, Monrovia, CA 91016, USA * Corresponding author: John J. Rossi, PhD, Center for RNA Biology and Therapeutics, City of Hope, Monrovia, CA 91016, USA. [email protected] 06 3 2023 14 3 2023 06 3 2023 31 730730 (c) 2023 The Author(s) 2023 This is an open access article under the CC BY license ). pmcBlood clots are a serious problem that can lead to death or serious disability following an ischemic stroke. Current methods detect reduced blood flow due to clots forming in an artery. The detection of clots before they block blood flow is important in the rapid treatment of patients undergoing surgical procedures or treatments for cancer. In this issue of Molecular Therapy - Nucleic Acids, Gray et al.1 describe an RNA aptamer targeting the clot-associated protein thrombin that has been adapted for detection of blood clots in real time. Aptamers are polynucleic acids that can fold into three-dimensional structures that bind ligands with high affinity.2 The process by which aptamers can be created is called SELEX (systematic evolution of ligands by exponential enrichment).2 Since the first description of this technique was published, thousands of aptamers have been evolved that bind to their ligands with sub-nanomolar affinity. Sullenger and colleagues have pioneered aptamer development for the treatment of cardiovascular diseases such as ischemic stroke.3 Moreover, their rationale for aptamers and blood clotting regulation was that the binding of aptamers to the target ligand could be rapidly reversed by treatment with antidotes consisting of single-stranded oligonucleotides, which bind to the aptamer via complementary base-pairing, thereby perturbing the aptamer structure sufficiently to reverse the binding.3 Gray et al.1 extended the anti-clotting aptamer concept. This study demonstrates that a non-therapeutic aptamer that selectively binds to thrombin can be used to visualize clot formation in vivo. Thrombin is only found associated with blood clots once it is cleaved from its precursor prothrombin. Early detection of a clot can lead to rapid anti-clotting treatments and save lives as well as major tissue destruction caused by reduced blood flow. The thrombin recognition is indicative of an active clot. These investigators labeled the thrombin aptamer with a near-infrared dye, facilitating detection of the thrombin-/clot-bound aptamer. Moreover, unbound aptamers were readily eliminated from circulation with the use of an antidote antisense oligonucleotide, which rapidly binds to the aptamer and disrupts its structure. The salient features of the aptamer are that it was evolved to selectively bind human thrombin, which is only present at the site of clot formation. Moreover, the human aptamer cross-reacted with murine thrombin, allowing in vivo visualization in mice induced to undergo thrombosis. They extended the testing of the thrombin clot detecting aptamer to porcine and non-human primate models. In clinical applications, this aptamer can be used during surgical procedures, which often trigger blood clot formation, and in patients with cancer undergoing chemotherapy with clotting risks. The complete reversal of the aptamer in circulation and at the clot itself with the antidote antisense oligonucleotide is an important aspect of this process. Real-time detection of clot formation can lead to rapid treatment with agents such as tissue plasminogen activator TPA, thereby saving lives and reducing the disabilities associated with ischemic strokes. Overall, this remarkable tool for detecting thrombosis once again demonstrates the power of nucleic acids as both diagnostic and therapeutic agents. References 1 Gray B.P. Kelly L. Steen-Burrell K.-A. Layzer J.M. Rempel R.E. Nimjee S.M. Cooley B.C. Tarantal A.F. Sullenger B.A. Rapid molecular imaging of active thrombi in vivo using aptamer antidote probes Mol. Ther. Nucleic Acids 2023 2 Tuerk c. Gold L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage DNA polymerase Science 249 1990 505 510 2200121 3 Bomplani K.M. Monroe D.M. Church F.C. Sullenger B.A. A high affinity,antidote controllable prothrombin and thrombin-binding aptamer inhibits thrombin generation and throbin activity J. Thrombin. Haemost. 10 2012 870 880 |
Front Microbiol Front Microbiol Front. Microbiol. Frontiers in Microbiology 1664-302X Frontiers Media S.A. 10.3389/fmicb.2023.1160288 Microbiology Editorial Editorial: Thermophilic and halophilic extremophiles in Eurasian environments, volume II Jiang Hongchen 1 2 * Li Wen-Jun 2 3 Birkeland Nils-Kre 4 Egamberdieva Dilfuza 5 6 1State Key Laboratory of Biogeology and Environmental Geology, China University of Geosciences, Wuhan, China 2State Key Laboratory of Desert and Oasis Ecology, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi, China 3State Key Laboratory of Biocontrol and Guangdong Provincial Key Laboratory of Plant Resources, School of Life Sciences, Sun Yat-sen University, Guangzhou, China 4Department of Biological Sciences, University of Bergen, Bergen, Norway 5Institute of Fundamental and Applied Research, National Research University Tashkent Institute of Irrigation and Agricultural Mechanization Engineers, Tashkent, Uzbekistan 6Faculty of Biology, National University of Uzbekistan, Tashkent, Uzbekistan Edited and reviewed by: Andreas Teske, University of North Carolina at Chapel Hill, United States *Correspondence: Hongchen Jiang [email protected] This article was submitted to Extreme Microbiology, a section of the journal Frontiers in Microbiology 28 2 2023 2023 14 116028807 2 2023 13 2 2023 Copyright 2023 Jiang, Li, Birkeland and Egamberdieva. 2023 Jiang, Li, Birkeland and Egamberdieva This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Thermophilic and halophilic extremophiles in Eurasian environments, volume IIsaline/hypersaline environments thermal environments microbial diversity adaptation pathways This work was supported by the Third Xinjiang Scientific Expedition Program (Grant No. 2022xjkk1200), the National Natural Science Foundation of China (Project Nos. 91951205, 92251304, and 92251302), and the Eurasia program of the Norwegian Directorate for Higher Education and Skills (HK-dir) (Project No. CPEA-LT-2017/10061). pmcSaline/hypersaline and geothermal ecosystems are typical extreme environments. Microbial diversity, ecological functions and adaptations in (hyper)saline and thermal ecosystems are receiving extensive attention, mainly because: (1) they have environmental conditions similar to that of some extreme environments on early Earth or other planets, so they are suitable environments for simulation research on the origin and evolution of life and the exploration of extraterrestrial life; (2) they have relatively low complexity of microbial communities, so they are often employed as model ecosystems to investigate microbially mediated element cycling and biogeochemical processes and their responses to environmental conditions (e.g., salinity, temperature); and (3) they are rich in microbial dark matter (a large number of microorganisms existing in nature that cannot be cultivated in the laboratory and are hardly known), so they are employed to obtain new microbial resources and discover new metabolic pathways. The saline/hypersaline and geothermal ecosystems in Eurasia have diverse and unique geological and physiochemical characteristics. Multi-omics techniques have enabled a series of new discoveries in microbial diversity, ecological functions and biogeochemistry of these environments. In 2019, we successfully organized and published one Research Topic consisting of 11 original research articles ) with the same title as the present one, which received a good reading feedback (7,000 downloads and 37,000 views) in the year after its publication. Therefore, Chief Editor Andreas Teske invited us to relaunch the Research Topic. We gladly accepted his invitation to organize this Research Topic. In the current Research Topic, we accepted and published eight research articles, including five and three articles on saline/hypersaline and geothermal ecosystems, respectively. We are grateful to all authors who contributed to this Research Topic. We are also grateful to all reviewers, handling editors and editorial staff who contributed during the editing and article production processes. Among the articles related to studies on saline/hypersaline ecosystems, Singh et al. disclosed that elevated inorganic carbon and salinity enhances photosynthesis and ATP synthesis in picoalga Picocystis salinarum as revealed by label free quantitative proteomics; Liu Q. et al. found that the diversity of carbohydrate-active enzymes (CAZy) and sulfur cycling genes decreased with increasing salinity, whereas nitrogen cycling gene diversity showed an opposite trend. Relative abundances of many CAZy, nitrogen and sulfur cycling gene categories decreased with increasing salinity, whereas some CAZy, nitrogen and sulfur gene categories showed an increasing trend. The compositions of CAZy, nitrogen, and sulfur cycling genes in the studied lake sediments were significantly (P < 0.05) affected by environmental factors such as salinity, total organic carbon, total nitrogen, and total phosphorus, with salinity having the greatest influence. Liu M. et al. identified the biosynthetic pathway of glycine betaine that is responsible for salinity tolerance in halophilic Thioalkalivibrio versutus D301. Yi et al. characterized and analyzed the genome of a novel halovirus infecting Chromohalobacter beijerinckii. Lin et al. found that rare taxa drive the response of soil fungal guilds to soil salinization in the Taklamakan Desert. Among the articles related to studies on geothermal ecosystems, Song et al. characterized the nifH gene expression and diversity in geothermal springs of Tengchong, China. Yuan et al. described different regulatory strategies of arsenite oxidation by two Thermus tengchongensis strains isolated from hot springs. Khomyakova et al. reported the first cultivated representatives, constituting a novel order Anaerosomatales. We are delighted to publish this Research Topic in Frontiers in Microbiology. We hope that this Research Topic will be interesting and useful to the readers of the journal, and broaden the knowledge of thermophilic and halophilic extremophiles in Eurasian Environments. The findings presented in this Research Topic are exciting, but still limited. In the future, the application of innovative research technologies and intensive and in-depth international collaboration will undoubtedly unveil more exciting aspects of thermophilic and halophilic extremophiles in Eurasian environments. Author contributions HJ organized this topic and wrote the editorial article. W-JL, N-KB, and DE are co-editors of the topic and discussed the writing. All authors contributed to the article and approved the submitted version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Surg Front Surg Front. Surg. Frontiers in Surgery 2296-875X Frontiers Media S.A. 10.3389/fsurg.2023.1139745 Surgery General Commentary Commentary: Risk factors for complications in elderly patients aged 85 years and over undergoing endoscopic biliary stone removal Mazzola Paolo 1 2 * Spedale Valentina 1 3 1 School of Medicine and Surgery, Universita Degli Studi di Milano-Bicocca, Monza, MB, Italy 2 Acute Geriatrics Unit, Fondazione IRCCS San Gerardo dei Tintori, Monza, MB, Italy 3 Nurse Educator Undergraduate Nursing Degree, Fondazione IRCCS San Gerardo dei Tintori, Monza, MB, Italy Edited by: Maurizio Gentile, Federico II University Hospital, Italy Reviewed by: Giovanni Cestaro, ASST Valle Olona, Italy * Correspondence: Paolo Mazzola [email protected] Specialty Section: This article was submitted to Visceral Surgery, a section of the journal Frontiers in Surgery 28 2 2023 2023 10 113974507 1 2023 01 2 2023 (c) 2023 Mazzola and Spedale. 2023 Mazzola and Spedale This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Biliary stone removal elderly ercp endoscopic retrograde cholangiopancreatography risk factors endoscopy pmcA Commentary on Risk factors for complications in elderly patients aged 85 years and over undergoing endoscopic biliary stone removal By Zhang DY, Zhai YQ, Zhang GJ, Chen SX, Wu L, Chen DX, et al. (2022) Front. Surg. 9:989061. doi: 10.3389/fsurg.2022.989061 Introduction We read with interest the paper by Zhang and colleagues (1) that explored the risk factors for complications among patients aged >=85 years who underwent endoscopic retrograde cholangiopancreatography (ERCP) for biliary stone removal. We recently investigated a similar issue among subjects aged >=65 years undergoing ERCP in an Italian hospital (2). Italy is experiencing a progressive and significant aging of its population (3), and potentially an increasing number of biliary stone cases and ERCP procedures as observed in many other countries. A recent multi-center Italian study on quality in ERCP showed that the procedures met overall good quality standards, with 93.1% success rate and 8.0% complication rate (4). However, this prospective study did not consider the age of subjects undergoing ERCPs. In 2018, our research group explored the safety of ERCP among geriatric subjects consecutively admitted to the Endoscopy Unit during a 2-year period (2). We compared two age groups (65-79 years vs. >=80 years) in terms of complications, and we found that the younger group had a higher rate of ERCP-related complications than the older one (13.2% vs. 10.0%, respectively) as well as a significantly higher Charlson Comorbidity Index (CCI) score. Findings According to Zhang et al. (1), we show the characteristics of patients aged >=85 years (N = 90, see Table 1). We found a mean age of 88.8 +- 3.2 years, with a prevalence of females (72.2%) and a median CCI of 1 (Interquartile range: 0.2). Interestingly, 71.1% of the population had a low comorbidity burden (CCI 0-1), while only 9 subjects had a relevant comorbidity burden (CCI >= 4). Most subjects were classified with the American Society of Anesthesiologist (ASA) physical status score as class II ("mild systemic disease," 57.8%) or III ("severe systemic disease," 40.0%). Urgent ERCPs were performed in 11 cases (12.2%). We observed a lower comorbidity burden in this group than in the younger group (65-79 years old), and similarly the complication rate was lower among subjects >=85 (8.9%). As expected from the low number of cases (n = 8), the univariate logistic regression analyses for the potential risk factors of complications in this age group did not show any significant association. Table 1 Characteristics of patients aged 85 years and older undergoing ERCP, and list of their ERCP-related complications. Characteristics Age >=85 years (N = 90) Mean age, years +- SD 88.8 +- 3.2 Gender, n (%) Male 25 (27.8) Female 65 (72.2) Charlson Comorbidity Index (CCI), median (IQR) 1 (0,2) CCI 0-1 64 (71.1) CCI 2-3 17 (18.9) CCI >= 4 9 (10.0) ASA physical status classification score, class I - II 52 (57.8) III 36 (40.0) IV 2 (2.2) V - Urgent ERCP, n (%) 11 (12.2) Indication CBD stones/ biliary colic 36 (40.0) Stenosis 13 (14.4) Acute Pancreatitis 5 (5.6) Stent placement or removal 18 (20.0) Cholangitis 15 (16.7) Other 3 (3.3) Procedures Sphincterotomy 22 (24.4) Stent placement or removal 30 (33.3) Sphincterotomy and stent placement 27 (30.0) Other 4 (4.4) Incomplete procedure 7 (7.8) Diagnosis CBD stones 39 (43.3) Stenosis 14 (15.6) Stent placement or removal 26 (28.9) Other 4 (4.4) Complications, number of cases Septic cholangitis 2 Cardiopulmonary 2 Bleeding 0 Acute Pancreatitis 2 Perforation 1 ERCP-Related death 1 Total number of complications (%) 8 (8.9) Data are presented as absolute number and percentage, i.e. n (%), unless otherwise specified. CBD, common bile duct; IQR, interquartile range; SD, standard deviation. Discussion We interpreted our findings considering a possible selection bias, i.e., the lack of a standardized comprehensive geriatric assessment (CGA) for elderly subjects accessing endoscopy service. Although the CCI is a validated and user-friendly index, we agree with Zhang et al. (1) that it cannot be the only tool considered because it cannot capture alone the clinical complexity of geriatric patients. In fact, although they may possess the criteria to undergo ERCP, elderly patients might be erroneously excluded from this procedure because of their comorbidity burden. Moreover, the ASA score itself is a classification system that mostly relies on clinical judgment since it does not encompass an absolute measure of the severity of the acute and chronic comorbid conditions. Our study also had limitations: the small sample size, the single-center design, and its retrospective nature that do not allow us to generalize the findings. Conversely, one of our strengths was the presence of a younger control group. As for present and future research aimed at improving the preoperative evaluation of geriatric subjects, we speculate that adding the assessment of frailty using validated tools might play a role in identifying patients at higher risk of ERCP-related complications. To date, very limited research about frailty in this setting is currently available. For example, a case report by Occhipinti et al. (5) described a 70-year-old man admitted to the Emergency Department with a diagnosis of acute pancreatitis in the presence of multiple gallbladder stones who underwent ERCP. The authors define him as "frail," but this judgment is based on clinical conditions and comorbidities rather than on specific frailty assessment. We think that Zhang et al. (1) significantly contributed to enlighten the potential risk factors of ERCP-related complications in the over 85 population, paving the path for further research in an age group characterized by complex health needs and a high burden of comorbidity. Nevertheless, we suggest including the assessment of frailty in the preoperative evaluation because of its prognostic significance in the geriatric population. Author contributions Both authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Zhang DY Zhai YQ Zhang GJ Chen SX Wu L Chen DX Risk factors for complications in elderly patients aged 85 years and over undergoing endoscopic biliary stone removal. Front Surg. (2022) 9 :989061.10.3389/fsurg.2022.989061 36303850 2. Galeazzi M Mazzola P Valcarcel B Bellelli G Dinelli M Pasinetti GM Endoscopic retrograde cholangiopancreatography in the elderly: results of a retrospective study and a geriatricians' point of view. BMC Gastroenterol. (2018) 18 (1 ):38. 10.1186/s12876-018-0764-4 29540171 3. Mazzola P Rimoldi SM Rossi P Noale M Rea F Facchini C Aging in Italy: the need for new welfare strategies in an old country. Gerontologist. (2016) 56 (3 ):383-90. 10.1093/geront/gnv152 26553737 4. Donato G Occhipinti P Correale L Spadaccini M Repici A Anderloni A A prospective study on quality in endoscopic retrograde cholangiopancreatography (ERCP): trend in Italy from the request study. Endosc Int Open. (2021) 9 (10 ):E1563-71. 10.1055/a-1531-4691 34540552 5. Occhipinti V Segato S Carrara A Orlando S Conte D . Ercp or no ercp: the case report of a frail patient. Intern Emerg Med. (2018) 13 (3 ):367-71. 10.1007/s11739-017-1732-7 28875255 |
Front Med (Lausanne) Front Med (Lausanne) Front. Med. Frontiers in Medicine 2296-858X Frontiers Media S.A. 10.3389/fmed.2023.1161123 Medicine Editorial Editorial: Ocular ultrasonography and optical coherence tomography in the optic nerve disease Rosa Nicola 1 Cennamo Gilda 2 De Bernardo Maddalena 1 * 1Eye Unit, Department of Medicine, Surgery and Dentistry, Scuola Medica Salernitana, University of Salerno, Salerno, Italy 2Department of Neuroscience, Reproductive Science and Odontostomatology, University of Naples Federico II, Naples, Italy Edited and reviewed by: Jodhbir Mehta, Singapore National Eye Center, Singapore *Correspondence: Maddalena De Bernardo [email protected] This article was submitted to Ophthalmology, a section of the journal Frontiers in Medicine 28 2 2023 2023 10 116112307 2 2023 15 2 2023 Copyright (c) 2023 Rosa, Cennamo and De Bernardo. 2023 Rosa, Cennamo and De Bernardo This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Ocular ultrasonography and optical coherence tomography in the optic nerve diseaseOCT optic nerve ultrasound papilledema optic disc drusen intracranial hypertension pmcSeveral disorders can affect the optic nerve and their differential diagnosis can be challenging, requiring expensive or uncomfortable tests. Most of them are characterized by optic disc discoloration or oedema. To differentiate optic disc oedema, particularly when the bulge is mild or unilateral, can be challenging (1). Nowadays the presence of OCT and ultrasound can represent useful tools to help the clinician in the differential diagnosis of this kind of abnormalities. Among the causes of optic disc oedema, there is the intracranial hypertension (2). Elucidation of its underlying disease and follow up may require expensive or uncomfortable tests or even invasive procedures like lumbar puncture. In particular, ultrasound has been widely used for this purpose, but it requires knowledge and skill to give reliable results (3-5). In this collection, the clinicians can find several articles that will help them to utilize ultrasound and OCT in the management of these cases. In particular, the three review articles on this topic can provide a useful tool to understand the role of ultrasound in the diagnosis and follow up of papilledema (Vitiello, De Bernardo et al.; De Bernardo et al.; Vitiello, Salerno et al.). In the article by Johnson et al., the performance of three ultrasound units, two pocket ultrasounds and one standard-sized portable ultrasound, will give information on their precision and accuracy (Johnson et al.). In the article by Wang et al., the usefulness of a multimodal imaging in the differential diagnosis of a disease, which could resemble an optic disc elevation, such as a morning glory disc anomaly (MGD) in a 7-year-old boy is described (Wang et al.). Optic tract lesions (OTL), another challenging topic usually caused by a tumor or aneurysm, less frequently due to trauma, inflammatory or demyelinating disease, are discussed in the article by Cohen-Sinai et al.. The authors present an algorithm to simplify the diagnosis of OTL based on findings derived by optic disc color photographs, visual fields, OCT scans, and MRI. This approach could simplify and improve the clinician's diagnostic capabilities in cases of suspected OTL (Cohen-Sinai et al.). Optical coherence tomography (OCT), including the measurements of circumpapillary retinal nerve fiber layer (cpRNFL) thickness and macular ganglion cell complex (GCC) (RNFL + ganglion cell layer [GCL] + inner plexiform layer [IPL]), is the primary diagnostic method for glaucoma. The study by Nakakura et al. investigates the effect of epiretinal membrane (ERM) and a new associated parameter, the space between the ERM and retinal surface, on ganglion cell complex thickness in eyes with glaucoma, based on a matched comparison of visual field defects (Nakakura et al.). Optical coherence tomography angiography (OCTA) is a promising new non-invasive ophthalmic imaging technology for visualizing and quantifying both peripapillary and parafoveal microvasculature, in particular it can visualize retinal vessels with the detection of motion contrast from the blood flow through the Superficial Capillary Plexus (SCP). In the article by Pugazhendhi et al. the authors, examining the peripapillary vascular structure in patients with non-arteritic anterior ischemic optic neuropathy, highlight how several vascular parameters could be good predictors of optic nerve and retinal changes (Pugazhendhi et al.). Overall, the eight articles in this Research Topic: Ocular Ultrasonography and Optical Coherence Tomography in the Optic Nerve Disease, provide a broad discussion of recent insights into optic nerve diseases that covers the cause of altered assoplasmic flow as well as the mechanism of vascular damage. We believe the collections are informative for basic researchers, clinical scientists, and patients who are affected by optic nerve diseases. Author contributions NR and MD compiled/wrote the first draft. GC contributed to the outline. All authors reviewed and edited for final revisions and approved the final version for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Rosa N De Bernardo M Abbinante G Vecchio G Cione F Capasso L . Optic nerve drusen evaluation: a comparison between ultrasound and OCT. J Clin Med. (2022) 11 :3715. 10.3390/jcm11133715 35806999 2. Rosa N De Bernardo M Di Stasi M Cione F Capaldo I . A-Scan Ultrasonographic evaluation of patients with idiopathic intracranial hypertension: comparison of optic nerves. J Clin Med. (2022) 11 :6153. 10.3390/jcm11206153 36294473 3. De Bernardo M Rosa N . Comment on "Invasive and noninvasive means of measuring intracranial pressure: a review". Physiol Meas. (2018) 39 :058001. 10.1088/1361-6579/aac540 29767627 4. De Bernardo M Rosa N . Optic nerve sheath diameter measurement in patients with idiopathic normal-pressure hydrocephalus. Eur J Neurol. (2018) 25 :e24. 10.1111/ene.13530 29356262 5. De Bernardo M Rosa N . Transorbital sonography to evaluate optic nerve in hypertensive encephalopathy. J Stroke Cerebrovasc Dis. (2018) 27 :1124. 10.1016/j.jstrokecerebrovasdis.2017.11.035 29284571 |
Front Neurol Front Neurol Front. Neurol. Frontiers in Neurology 1664-2295 Frontiers Media S.A. 10.3389/fneur.2023.1145823 Neurology Editorial Editorial: The role of gene mutations in the neuropathology of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD)- Progress and challenges Troakes Claire 1 * Conforti Francesca Luisa 2 * 1Department of Basic and Clinical Neuroscience, Institute of Psychiatry, Psychology and Neuroscience, King's College London, London, United Kingdom 2Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, Rende, Italy Edited and reviewed by: Anja Kovanda, University Medical Centre Ljubljana, Slovenia *Correspondence: Claire Troakes [email protected] Francesca Luisa Conforti [email protected] This article was submitted to Diagnostic and Forensic Neuropathology, a section of the journal Frontiers in Neurology 28 2 2023 2023 14 114582316 1 2023 17 2 2023 Copyright (c) 2023 Troakes and Conforti. 2023 Troakes and Conforti This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic The role of gene mutations in the neuropathology of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD)- Progress and challengesamyotrophic lateral sclerosis (ALS) frontotemporal lobar degeneration (FTLD) neuropathology gene mutation familial pmcOver the last decade, there has been an increase in research surrounding the specific pathologies related to gene mutations in ALS and FTLD. It has long been recognized that familial forms of these diseases can show hallmark pathologies related to mutations, e.g., ALS-FUS or FTLD-MAPT. This has been expanded recently by the identification of the C9orf72 expansion and its characteristic pathology (1). However, much remains to be understood regarding the relationship between gene mutations, disease pathology, and clinical manifestation. Some gene mutations result in aggregates of the protein product whereas others appear to cause a loss of function that alters downstream pathways and affects processes such as RNA biology. Thorough neuropathological assessment of common and rare or newly discovered gene mutations may lead to a further understanding of the disease processes in familial and sporadic diseases. Insights into gene-linked pathology may open new therapeutic targets for these currently untreatable diseases. An interesting example is provided by two recent works that describe three key proteins involved in the disease development of ALS and frontotemporal dementia caused by the C9orf72 mutation that can be targeted by drugs (2, 3). Furthermore, the flood of genetic information provided by exome and whole genome sequencing studies over the last 10 years, while useful, has also made distinguishing between truly disease-causing mutations and rare, non-pathogenic polymorphisms in newly identified genes (and indeed in known genes) an inherent challenge. As the majority of inherited and sporadic ALS cases possess a common downstream TDP-43 pathology, confidently determining true upstream genetic causes is critical. Clinicians are calling for more genetic testing in apparently sporadic ALS cases (4) and this, alongside continued expert neuropathological assessment, will expand the understanding of the pathological mechanisms of these diseases. We have therefore collected, in this Research Topic, a number of papers that cover various aspects of neuropathology, pathophysiology, biomarkers, and genetics related to ALS and FTD. Henderson et al. discuss the evolution of the frontal lobes, metabolic adaptations during human evolution, and the consequences of aging on neuronal processes, linking them to known ALS/FTD pathomechanisms, mainly those related to RNA/protein turnover. The authors propose that neurodegenerative processes affecting the frontal lobes, specifically ALS and FTD, may result from a mismatch between cellular and metabolic pathways and increasing lifespan within an evolutionary framework. A general overview of biological networks and complexity in early-onset Motor Neuron Diseases (MNDs) is given by Butchbach and Scott. They offer their perspective on novel conceptual frameworks which could help find common therapies for MNDs. They point out how research has so far mainly focused on investigating the pathomechanisms linking mutations in a gene to a certain MND and propose an alternative system biology approach to understand early-onset MNDs, paving the way for new therapeutic possibilities for these diseases. This Research Topic also concentrates on the role of causative genes shared in ALS and FTD, highlighting possible therapeutic approaches for these gene mutation-linked diseases. Scarian et al. report recent findings on the role of the valosin-containing protein (VCP) gene, an ATPase involved in many different biological functions including protein degradation, autophagy, and lysosomal and mitochondrial homeostasis. The authors report evidence of possible therapeutic approaches targeting the VCP pathway, describing the use of many different drugs already developed for the treatment of other diseases, such as VCP inhibitors able to: (i) prevent muscle cell death and restore muscle integrity and mitochondrial size in VCP mutants; (ii) increase the oxygen consumption rate of patient's fibroblasts; and (iii) reverse the mislocalization of TDP-43 and FUS in mutant motor neurons. Additionally, the field shows interest in studying the role of neurofilament light chain (NfL) as a biomarker in ALS that can provide a deeper understanding of the pathophysiological mechanisms and potentially effective therapies for this disease. In their prospective cross-sectional study, Zhang et al. investigate the correlation between serum NfL levels and the severity of lower motor neuron (LMN) axonal degeneration in patients with ALS, particularly in the early stages of the disease. The authors show that the use of NfL blood levels reflects the extent of limb LMN axonal damage but not upper motor neuron involvement among ALS patients, indicating that the use of this biomarker may have a profound effect on patient selection and efficacy monitoring of treatment in disease-modifying clinical trials. The four articles included in this Research Topic provide an overview of the current state-of-the-art research on the role of gene mutations in the neuropathology of ALS and FTD, ranging from characterizing the pathomechanisms related to a specific genetic variation to re-evaluating biomarkers useful for the stratification of patients and directing the search for disease-modifying therapies. Much has been done and much needs to be done to better describe the gene-linked pathology in ALS and FTD. Traditional and new technologies still show many limitations, for example, in detecting the correct size of large expansions of C9ORF72, and better biomarkers are needed. The next decade promises to shed light on new aspects of the relationship between gene mutations, disease pathology, and clinical manifestation in ALS and FTD, enabling improvements in treatment and the finding of effective cures for these devastating diseases. Author contributions Both authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Al-Sarraj S King A Troakes C Smith B Maekawa S Bodi I . p62 positive, TDP-43 negative, neuronal cytoplasmic and intranuclear inclusions in the cerebellum and hippocampus define the pathology of C9orf72-linked FTLD and MND/ALS. Acta Neuropathol. (2011) 122 :691-702. 10.1007/s00401-011-0911-2 22101323 2. Braems E Bercier V Van Schoor E Heeren K Beckers J Fumagalli L . HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS. Acta Neuropathol. (2022) 144 :465-88. 10.1007/s00401-022-02471-y 35895140 3. Guo W Wang H Kumar Tharkeshwar A Couthouis J Braems E Masrori P . CRISPR/Cas9 screen in human iPSC-derived cortical neurons identifies NEK6 as a novel disease modifier of C9orf72 poly(PR) toxicity [published online ahead of print, 2022 Aug 22]. Alzheimers Dement. (2022). 10.1002/alz.12760 35993441 4. Mehta PR Iacoangeli A Opie-Martin S van Vugt JJ Al Khleifat A Bredin A . The impact of age on genetic testing decisions in amyotrophic lateral sclerosis. Brain. (2022) 145 : 4440-7. 10.1093/brain/awac279 36162820 |
Front Neurosci Front Neurosci Front. Neurosci. Frontiers in Neuroscience 1662-4548 1662-453X Frontiers Media S.A. 10.3389/fnins.2023.1141376 Neuroscience Editorial Editorial: Saliva used as biological fluid to detect neurodegenerative and neurodevelopmental diseases Tartaglia Gianluca 1 2 * Connelly Stephen 3 1Department of Biomedical, Surgical and Dental Science, University of Milan, Milan, Italy 2UOC Complex Operative Unit of Dentistry and Maxillo-Facial Surgery, Foundation IRCCS Ca' Granda Ospedale Maggiore Policlinico, Milan, Italy 3San Francisco Veterans Affairs Health Care System, Department of Oral & Maxillofacial Surgery, University of California, San Francisco, San Francisco, CA, United States Edited and reviewed by: Mark P. Burns, Georgetown University, United States *Correspondence: Gianluca Tartaglia [email protected] This article was submitted to Neurodegeneration, a section of the journal Frontiers in Neuroscience 28 2 2023 2023 17 114137610 1 2023 20 1 2023 Copyright (c) 2023 Tartaglia and Connelly. 2023 Tartaglia and Connelly This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Saliva used as biological fluid to detect neurodegenerative and neurodevelopmental diseasessaliva neurodevelopmental disease neurodegenerative disease diagnostic autism spectrum disorders pmcNeurodegenerative and neurodevelopmental diseases represent neurological disorders that variably affect individuals and produce negative consequences, such as altered social interaction, restricted/repetitive behavior, and other medical and mental health conditions that result in lifelong functional and social impairments with high economic and social costs (Livingston et al., 2020). Elderly members of our increasingly aging population are more vulnerable to these neurological disorders and the high individual and societal costs are obvious (Bieleninik and Gold, 2021). Given the present and future challenges, it is important to focus our efforts on the early diagnosis and treatment of neurological diseases, as the initial biochemical pathophysiological drivers of these disorders occur far earlier than symptoms appear, at which point treatment alternatives are sparse and often futile (Bjerke and Engelborghs, 2018; Auso et al., 2020). Thus, the establishment of temporally relevant and robust diagnostic methods in the form of disease-specific biomarkers is urgently needed to impact disease development and progression. The ideal biochemical biomarker(s) should be low-cost and easily accessible. With those parameters in mind, saliva represents a huge opportunity. The sampling of saliva is non-invasive, time-efficient, and offers the possibility of biomarker identification and surveillance on a continual basis for a variety of systemic diseases, for which specific salivary biomarkers have already been identified and put to use. Saliva is a very complex matrix of fluids and proteins that is an accurate recapitulation of the proteins and other molecules present in circulating plasma. In the past, this complexity has presented challenges for those attempting to accurately measure its components. However, despite those past challenges, salivary bioscience has made significant strides in both academic and industry settings as recent technological advances in the measurement of saliva components have opened up a window of opportunity to use saliva to detect and track disease. This Research Topic on saliva-based diagnostic approaches for detecting and tracking diseases was launched with the intention of encouraging both the academic and industrial communities to continue developing and refining technologies that will make salivary biomarker detection ever more reliable and relevant. As acceptance of this mode of systemic sampling grows, it is anticipated that robust clinically relevant platforms will become commercially available. With regard to improving commercial viability, it will be important to establish salivary biomarker measurement as a "gold standard," with the same validity and acceptability as the common blood-based lab tests that are routinely used today. The advantages of salivary bio-sampling are clear: it is low-cost, simple, non-invasive, and offers high levels of sensitivity and specificity for the detection and surveillance of disease. A saliva-based platform would be particularly advantageous for studying diseases that require large sample sizes for statistically valid disease detection. This Research Topic includes a selection of original articles and systematic reviews about the salivary bioscience related to neurodegenerative and neurodevelopmental diseases, their determinants, and the impact of these conditions on quality of life. Additionally, the Research Topic features articles that discuss salivary biosensing as applied to preventive and therapeutic applications of neurological disease. We have a variety of publications: one mini review, two original feasibility studies, and two original research articles based on the technological aspects of neurological biomarker detection. The mini review entitled, "Saliva Based Diagnostic Methodologies for a Fast Track Detection of Autism Spectrum Disorder: A Mini-Review" discusses the rising prevalence of autism spectrum disorders (ASD) and presents a compelling argument in support of salivary biomarkers to diagnose this complex disorder, which currently relies solely on behavioral assessments (Sharma et al.). This mini review is followed by two original research articles. The first, entitled "Salivary MicroRNA Profiling Dysregulation in Autism Spectrum Disorder: A Pilot Study", demonstrates how saliva can help clinicians support the ASD diagnostic process through the standardization of conditions used to isolate biomarkers that can robustly detect disease in a more simple way (Kalemaj et al.). The second, entitled "Salivary Inflammatory Biomarkers are Predictive of Mild Cognitive Impairment and Alzheimer's Disease in a Feasibility Study," provides evidence for the feasibility of saliva as a valuable source of biomarkers for the early detection of cognitive impairment in individuals on the AD continuum and potentially other neurodegenerative diseases. The two remaining studies, "Non-Invasive Diagnosis and Monitoring Tool of Children's Mental Health: A Point-of-Care Immunosensor for IL-6 Quantification in Saliva Samples" (Cruz et al.) and "Multisite Dopamine Sensing with Femtomolar Resolution Using a CMOS Enabled Aptasensor Chip" (Sessi et al.) provide examples of how point-of-care (POC) biosensors can help societies fast track patient needs in the early diagnostic process. For instance, preliminary analysis of retrospective PoliBiobank data (UOC Unita operativa Complessa Chirurgia Maxillo-Facciale e Odontostomatologia, Fondazione IRCCS Ca Granda, Ospedale Maggiore Policlinico, Department of Medicine, Surgery and Dentistry, University of Milan) demonstrates that miRNA and inflammatory molecule biomarkers in saliva samples collected from healthy individuals and those diagnosed with neurodegenerative and neurodevelopmental diseases, using traditional techniques, can be detected via real-time PCR and the MSD platform, respectively (unpublished data). Finally, as we highlighted in Goldoni et al. (2022), our hope is that readers will find the diversity of the content published in this Research Topic interesting and valuable. We are happy to present reviews and original research articles for this promising area of research, ranging from population-based studies to patient-centered clinical studies evaluating the effectiveness of treatment and preventive regimens. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Auso E. Gomez-Vicente V. Esquiva G. (2020). Biomarkers for Alzheimer's disease early diagnosis. J. Personal. Med. 10 , 114. 10.3390/jpm10030114 32899797 Bieleninik L. Gold C. (2021). Estimating components and costs of standard care for children with autism spectrum disorder in Europe from a large international sample. Brain Sci. 11 , 1-9. 10.3390/brainsci11030340 33800056 Bjerke M. Engelborghs S. (2018). Cerebrospinal fluid biomarkers for early and differential Alzheimer's disease diagnosis. J. Alzheimer's Dis. 62 , 1199-1209. 10.3233/JAD-170680 29562530 Goldoni R. Dolci C. Boccalari E. Inchingolo F. Paghi A. Strambini L. . (2022). Salivary biomarkers of neurodegenerative and demyelinating diseases and biosensors for their detection. Ageing Res. Rev. 76 :101587. 10.1016/j.arr.2022.101587 35151849 Livingston G. Huntley J. Sommerlad A. Ames D. Ballard C. Banerjee S. . (2020). Dementia prevention, intervention, and care: 2020 report of the Lancet Commission. Lancet. 396 , 413-446. 10.1016/S0140-6736(20)30367-6 32738937 |
Front Neurorobot Front Neurorobot Front. Neurorobot. Frontiers in Neurorobotics 1662-5218 Frontiers Media S.A. 10.3389/fnbot.2023.1161652 Neuroscience Correction Corrigendum: Small target detection with remote sensing images based on an improved YOLOv5 algorithm Pei Wenjing 1 * Shi Zhanhao 2 Gong Kai 1 1The Seventh Research Division and the Center for Information and Control, School of Automation Science and Electrical Engineering, Beihang University (BUAA), Beijing, China 2School of Information Science and Engineering, Shandong Agriculture and Engineering University, Jinan, China Edited and reviewed by: Yimin Zhou, Shenzhen Institutes of Advanced Technology (CAS), China *Correspondence: Wenjing Pei [email protected] 28 2 2023 2023 28 2 2023 17 116165208 2 2023 13 2 2023 Copyright 2023 Pei, Shi and Gong. 2023 Pei, Shi and Gong This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on Small target detection with remote sensing images based on an improved YOLOv5 algorithm by Pei, W., Shi, Z., and Gong, K. (2023). Front. Neurorobot. 16:1074862. doi: 10.3389/fnbot.2022.1074862 small target detection remote sensing images YOLOv5s deep learning EIoU loss pmcIn the published article, there was an error in Figure 12, Figure 13, and Table 5 as published. The descriptions at the bottom of the Figure 12 and Figure 13 were deleted. In addition, the resolution of all the figures in Table 5 was not high enough. The corrected Figure 12, Figure 13, and Table 5 and their captions appear below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Figure 12 Comparison of the target detection of six different models on the Visdrone2019 dataset. Figure 13 Comparison of the target detection of six different models on the DIOR-VAS dataset. Table 5 Visual results of the small target detection on Visdrone2019 dataset. Categories Visual results of YOLOv5s Visual results of LCB-YOLOv5s The original images Backbone Prediction head 1 Prediction head 2 Prediction head 3 Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Neuroinform Front Neuroinform Front. Neuroinform. Frontiers in Neuroinformatics 1662-5196 Frontiers Media S.A. 10.3389/fninf.2023.1154835 Neuroscience Editorial Editorial: Machine learning methods for human brain imaging Yarman Vural Fatos Tunay 1 Newman Sharlene D. 2 * Cukur Tolga 3 Onal Ertugrul Itir 4 1Department of Computer Engineering, Middle East Technical University, Ankara, Turkey 2Alabama Life Research Institute, The University of Alabama, Tuscaloosa, IN, United States 3Department of Electrical and Electronics Engineering, Bilkent University, Ankara, Turkey 4Department of Information and Computing Sciences, Utrecht University, Utrecht, Netherlands Edited and reviewed by: Sean L. Hill, Krembil Centre for Neuroinformatics, CAMH, Canada *Correspondence: Sharlene D. Newman [email protected] 28 2 2023 2023 17 115483531 1 2023 10 2 2023 Copyright (c) 2023 Yarman Vural, Newman, Cukur and Onal Ertugrul. 2023 Yarman Vural, Newman, Cukur and Onal Ertugrul This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Machine learning methods for human brain imagingmachine learning deep learning artificial intelligence imaging MRI pmcThe use of artificial intelligence (AI) methods like machine learning (ML), including deep learning, to make sense of brain imaging data has exploded over the past 10 years. Some of the early work focused on classifying brain states measured with functional magnetic resonance imaging (Mitchell et al., 2004). Those studies were exciting and demonstrated the potential power of ML to classify brain states in a way that reveals something about human cognition. ML is used in multiple aspects of brain imaging including image acquisition, reconstruction, analysis, and reporting (Aggarwal et al., 2023). For example, there are numerous studies using ML to classify groups of patients to improve diagnosis of neurodevelopmental disorders (e.g., autism, Parlett-Pelleriti et al., 2022), psychological disorders (e.g., schizophrenia, Chilla et al., 2022; and depression, Bhadra and Kumar, 2022), the progression of dementia (Mirzaei and Adeli, 2022) and tumors (Soomro et al., 2022), among others. On the image analysis side, ML applications are numerous and include it being used to improve denoising of image data (Gregory et al., 2021) and image segmentation (Wang et al., 2020). The Research Topic, "Machine learning methods for human brain imaging," is a small sampling of 11 research articles that demonstrate the use of ML in multiple contexts and with multiple imaging modalities. The Research Topic includes two manuscripts (Alchihabi et al.; Fang et al.) that take different approaches to understanding cognitive networks one using multi-variate pattern dependencies between brain regions and another examining network dynamics during the execution of a task. There are also three studies designed to use AI to diagnose psychological disorders one using MRI to diagnosis defiant disorders in children (Menon and Krishnamurthy), one using EEG to classify brain states in schizophrenia patients and healthy controls (Plechawska-Wojcik et al.) and another classifying patients with obsessive-compulsive disorder and controls (Luo et al.). A third group of studies use ML to address analytic issues including one developing an open access tool for whole brain segmentation (Manjon et al.) and volumetric analysis of large datasets, one using fuzzy neural networks to improve 2D to 3D image transformations (Tavoosi et al.), and registration of multimodal 2D coronal section images of gene expressions in the mouse brain (Krepl et al.). One goal of AI is to create systems that function like the human brain (Hopgood, 2005). Current systems fall short and two of the manuscripts in this Research Topic attempt to address this issue (Matsui et al.; Zhang et al.). Deep learning systems, for example do a great job of mimicking human vision, to a point; their mapping from stimulus input to perceptual output are different with respect to adversarial images. Zhang et al. attempts to characterize the differences in how AI systems and human brains process these adversarial images by comparing artificial neural networks and human brain activation, using what is learned to improve AI performance. The use of ML in human brain imaging is only expected to increase. The power of deep learning methods makes them attractive for analyzing the growing number of large, publicly available datasets. However, it is important to slow down to evaluate their efficacy as well as to evaluate their weaknesses. One such weakness is addressed in the manuscript by Varotto et al. how to handle imbalanced datasets. Most large datasets do not have even distributions of minority populations (e.g., racial, socioeconomic, patient, etc.). This is only one such shortcoming that demonstrates the need for careful evaluation. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Aggarwal K. Jimeno M. M. Ravi K. S. Gonzalez G. Geethanath S. (2023). Developing and deploying deep learning models in brain MRI: a review. arXiv preprint arXiv:2301.01241. 10.48550/arXiv.2301.01241 Bhadra S. Kumar C. J. (2022). An insight into diagnosis of depression using machine learning techniques: a systematic review. Curr. Med. Res. Opin. 38 , 749-771. 10.1080/03007995.2022.2038487 35129401 Chilla G. S. Yeow L. Y. Chew Q. H. Sim K. Prakash K. B. (2022). Machine learning classification of schizophrenia patients and healthy controls using diverse neuroanatomical markers and Ensemble methods. Sci. Rep. 12 , 2755. 10.1038/s41598-022-06651-4 35177708 Gregory S. Cheng H. Newman S. Gan Y. (2021). HydraNet: a multi-branch convolutional neural network architecture for MRI denoising, in Medical Imaging 2021: Image Processing, Vol. 11596 (Washington, DC: SPIE), 881-889. 10.1117/12.2582286 Hopgood A. A. (2005). The state of artificial intelligence. Adv. Comput. 65 , 1-75. 10.1016/S0065-2458(05)65001-2 Mirzaei G. Adeli H. (2022). Machine learning techniques for diagnosis of Alzheimer disease, mild cognitive disorder, and other types of dementia. Biomed. Signal Process. Control 72 , 103293. 10.1016/j.bspc.2021.103293 Mitchell T. M. Hutchinson R. Niculescu R. S. Pereira F. Wang X. Just M. . (2004). Learning to decode cognitive states from brain images. Mach. Learn. 57 , 145-175. 10.1023/B:MACH.0000035475.85309.1b Parlett-Pelleriti C. M. Stevens E. Dixon D. Linstead E. J. (2022). Applications of unsupervised machine learning in autism spectrum disorder research: a review. Rev. J. Autism Dev. Disord. 1-16. 10.1007/s40489-021-00299-y Soomro T. A. Zheng L. Afifi A. J. Ali A. Soomro S. Yin M. . (2022). Image segmentation for MR brain tumor detection using machine learning: a review. IEEE Rev. Biomed. Eng. 16 , 70-90. 10.1109/RBME.2022.3185292 35737636 Wang J. Cheng H. Newman S. D. (2020). Sparse representation of DWI images for fully automated brain tissue segmentation. J. Neurosci. Methods 343 , 108828. 10.1016/j.jneumeth.2020.108828 32603811 |
Front Public Health Front Public Health Front. Public Health Frontiers in Public Health 2296-2565 Frontiers Media S.A. 10.3389/fpubh.2023.1164116 Public Health Correction Corrigendum: Delayed diagnosis and treatment of cancer patients during the COVID-19 pandemic in Henan, China: An interrupted time series analysis Liu Changpeng 1 Piao Heng 1 * Zhang Tao 2 Yang Dongjian 3 Li Xiaoyan 1 Tang Xiance 1 * 1Department of Medical Records, Office for DRGs (Diagnosis Related Groups), The Affiliated Cancer Hospital of Zhengzhou University, Henan Cancer Hospital, Zhengzhou, China 2Department of Epidemiology, School of Public Health, Fudan University, Shanghai, China 3Center for Medical Big Data, International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Heng Piao [email protected] Xiance Tang [email protected] This article was submitted to Public Health Policy, a section of the journal Frontiers in Public Health 28 2 2023 2023 28 2 2023 11 116411612 2 2023 17 2 2023 Copyright (c) 2023 Liu, Piao, Zhang, Yang, Li and Tang. 2023 Liu, Piao, Zhang, Yang, Li and Tang This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on Delayed diagnosis and treatment of cancer patients during the COVID-19 pandemic in Henan, China: An interrupted time series analysis by Liu, C., Piao, H., Zhang, T., Yang, D., Li, X., and Tang, X. (2022). Front. Public Health 10:881718. doi: 10.3389/fpubh.2022.881718 COVID-19 cancer ARIMA interrupted time series Henan pmcIn the original article, affiliation was incorrectly written "Department of Medical Records, Office for DRGs (Diagnosis Related Groups), Henan Cancer Hospital, Affiliated Cancer Hospital of Zhengzhou University, Zhengzhou, China." The correct affiliation should be corrected as follows: "Department of Medical Records, Office for DRGs (Diagnosis Related Groups), The Affiliated Cancer Hospital of Zhengzhou University, Henan Cancer Hospital, Zhengzhou, China" The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Light Sci Appl Light Sci Appl Light, Science & Applications 2095-5545 2047-7538 Nature Publishing Group UK London 1108 10.1038/s41377-023-01108-3 News & Views Viral inactivation by irradiation rays Liu Kai-Kai [email protected] Shan Chong-Xin [email protected] grid.207374.5 0000 0001 2189 3846 Henan Key Laboratory of Diamond Optoelectronic Materials and Devices, School of Physics and Microelectronics, Zhengzhou University, Zhengzhou, China 14 3 2023 14 3 2023 2023 12 72(c) The Author(s) 2023 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit Viral infection can lead to serious illness and death around the world, as exemplified by the spread of COVID-19. Using irradiation rays can inactive virions through ionizing and non-ionizing effect. The application of light in viral inactivation and the underlying mechanisms are reviewed by the research group of Dayong Jin from University of Technology Sydney. Subject terms X-rays Optics and photonics issue-copyright-statement(c) The Author(s) 2023 pmcVirus is a small, submicroscopic entity that contains only one type of nucleic acid (DNA or RNA), parasitizes live cells, and reproduces through the process of replication. Despite their tiny size, the viruses (such as human immunodeficiency virus (HIV), influenza viruses and COVID-19) can cause significant human diseases, and even lead to tens of millions death1,2. The battle between humans and viruses keeps ongoing for hundreds of years. Antiviral drugs can inactive virus to some extent3,4, but the harmful side effects and inadaptability to viral mutations severely limit their application. Alternatively, irradiation ray has been regarded as an effective tool to fight against viruses and infectious diseases caused by pathogens5,6. After years of endeavors, a detailed introduction on viral inactivation by irradiation rays will be effective in engineering tools for viral elimination with high efficacy, safety, and long-term application. In the recent article published in eLight7, Dayong Jin from the University of Technology Sydney and Esmaeil Biazar from Islamic Azad University reviewed irradiation-rays-dependent physical methods and the corresponding underlying mechanism related to the inactivation of viruses, especially enveloped viruses (such as HIV, influenza, or hepatitis) which are responsible for serious problems in humans. The irradiation rays from gamma-ray to infrared can effect on different segments of viruses and inactivate them, as shown in Fig. 1. Irradiation rays can inactivate pathogens by destroying the genome, either directly by radiolytic cleavage of genetic material or indirectly by the action of radicals on viral nucleic acids, while causing less damage to structural components, such as the protein membrane. Thus, various vaccines can be produced by illumination of irradiation rays8,9. In addition, X-ray, UVC (200-280 nm) can also damage the viral genome, the reports of damage to viral proteins should come into notice10,11. The ultraviolet (UV) radiation includes non-ionizing radiation and ionizing radiation, and low-energy UV irradiation is considered non-ionizing radiation. As a well-known method of viral inactivation, the effectiveness of UV photons as a disinfectant is highly dependent on their incident wavelength. Compared with ionizing radiation, studies on the selective inactivation of viruses using NIR sub-picosecond laser show promising results for the disinfection of viral pathogens in blood products and open novel approach for the treatment of blood-borne viral diseases in the clinic12. The anti-viral effect of ultra-short pulse laser at low mean irradiance employed via impulsive stimulated Raman scattering plays a key role in viral inactivation, while high-frequency resonance vibrations provoke sufficient mechanical vibrations to break non-covalent bonds and subsequently damaging virus13.Fig. 1 The virus inactivation and mutation by electromagnetic waves with different energies. The non-ionizing and ionizing effect caused by light with different wavelengths (top), and RNA strand broken, uracil dimmer formation and deamination during the interaction between photons and virus (bottom) The researchers reviewed the significant advances in viral inactivation by irradiation ray (including photons, electrons, and neutrons), and discussed the corresponding underlying mechanisms and key parameters. The productive experiments and limitations on viral inactivation by irradiation ray were demonstrated. The light-induced viral inactivation mechanism and investigation will provide an effective design scheme for developing viral inactivation tools. References 1. Parvez MK Parveen S Evolution and emergence of pathogenic viruses: past, present, and future Intervirology 2017 60 1 7 10.1159/000478729 28772262 2. Garcia-Blanco MA Cullen BR Molecular basis of latency in pathogenic human viruses Science 1991 254 815 820 10.1126/science.1658933 1658933 3. Almeida A Faustino MAF Neves MGPMS Antimicrobial photodynamic therapy in the control of COVID-19 Antibiotics 2020 9 320 10.3390/antibiotics9060320 32545171 4. Majiya H Photodynamic inactivation of non-enveloped RNA viruses J. Photochem. Photobiol. B Biol. 2018 189 87 94 10.1016/j.jphotobiol.2018.10.009 5. Anders JJ Lanzafame RJ Arany PR Low-level light/laser therapy versus photobiomodulation therapy Photomed. Laser Surg. 2015 33 183 184 10.1089/pho.2015.9848 25844681 6. El-Hussein A A review of chemotherapy and photodynamic therapy for lung cancer treatment Anticancer Agents Med. Chem. 2021 21 149 161 10.2174/18715206MTA1uNjQp3 32242788 7. Sadraeian M Viral inactivation by light eLight 2022 2 18 10.1186/s43593-022-00029-9 36187558 8. Choi JI Development of microalga Scenedesmus dimorphus mutant with higher lipid content by radiation breeding Bioprocess Biosyst. Eng. 2014 37 2437 2444 10.1007/s00449-014-1220-7 24871276 9. Seo HS Application of radiation technology in vaccines development Clin. Exp. Vaccin. Res. 2015 4 145 158 10.7774/cevr.2015.4.2.145 10. Montgomery A Regulatory approach for transitioning from gamma ray to X-ray radiation sterilization Biomed. Instrum. Technol. 2021 55 58 66 10.2345/0899-8205-55.s3.58 34153995 11. Simonet J Gantzer C Inactivation of poliovirus 1 and F-specific RNA phages and degradation of their genomes by UV irradiation at 254 nanometers Appl. Environ. Microbiol. 2006 72 7671 7677 10.1128/AEM.01106-06 17041164 12. Tsen KT Photonic approach to the selective inactivation of viruses with a near-infrared subpicosecond fiber laser J. Biomed. Opt. 2009 14 064042 10.1117/1.3275477 20059280 13. Tsen SWD Studies of inactivation mechanism of non-enveloped icosahedral virus by a visible ultrashort pulsed laser Virol. J. 2014 11 20 10.1186/1743-422X-11-20 24495489 |
Front Clin Diabetes Healthc Front Clin Diabetes Healthc Front. Clin. Diabetes Healthc. Frontiers in Clinical Diabetes and Healthcare 2673-6616 Frontiers Media S.A. 10.3389/fcdhc.2022.931125 Clinical Diabetes and Healthcare Editorial Editorial: Psychological Interventions to Improve Diabetes Self-Management Doherty Anne M. * Department of Psychiatry, University College Dublin/ Mater University Hospital, Dublin, Ireland Edited by: Joachim Voss, Case Western Reserve University, United States Reviewed by: Emma Berry, Queen's University Belfast, United Kingdom *Correspondence: Anne M. Doherty, [email protected] This article was submitted to Diabetes Self-Management, a section of the journal Frontiers in Clinical Diabetes and Healthcare 18 7 2022 2022 3 93112528 4 2022 16 5 2022 Copyright (c) 2022 Doherty 2022 Doherty This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research TopicPsychological Interventions to Improve Diabetes Self-Management diabetes - quality of life diabetes mellitus T1DM psychological therapies social support mental health pmcDiabetes is an increasingly common condition, and there is frequently a significant burden on the individual with diabetes due to the demands of self-managing a complex long-term condition (1). Many people with diabetes have difficulties in achieving optimal glycaemic control, and psychiatric and psychological factors may present barriers to effective self-management (2). Depression, for example is increasingly being regarded as a risk factor for mortality in diabetes, likely due to the impact of reduced motivation on the active self-management required for good diabetes control (3). Psychological interventions have an important role in the management of suboptimal diabetes care, and there have been a range of studies which have examined various facets of psychological intervention for diabetes optimization (4). There is evidence that specific psychological interventions such as cognitive behaviour therapy (CBT), motivational interviewing and attention control may be effective in reducing diabetes distress and improving diabetes management (5). Upsher et al. conducted a secondary meta-analysis of a pre-existing systematic review and meta-analysis which had included 67 randomized controlled trials (RCTs). The earlier systematic review and meta-analysis found that adults with type 2 diabetes (T2D) who received a psychological intervention experienced a significant reduction in HbA1c compared with those who did not receive the intervention (5). This secondary analysis was conducted with a view to identifying the "active ingredients" of these psychological interventions, to inform the development of future interventions. This paper reviewed the psychological interventions in studies included in the pre-existing review and identified the behaviour change techniques (BCTs) utilised in the individual studies. This study identified that 'social support' (n=50), 'problem solving' (n=38) and 'goal setting' (n=30) were the most frequently used BCTs, and all were associated with significant improvements in glycaemic control (HbA1c). On meta-analysis there were no significant associations between HbA1c and type of psychological intervention (p=0.84), or of the frequency of BCTs occurring within the intervention (p=0.29). This study identified that social support, problem solving, and goal setting may have potential in developing future psychological interventions for people with T2D. McGuigan et al. reported the design of a diabetes-focussed intervention to address psychological barriers to injectable treatments by utilising a behavioural change framework among people with T2D. Approximately 80% of patients discontinue or interrupt injectable regimens soon after commencement: suggesting that this issue is complex, related to broader adherence issues. Poor engagement and adherence are attributed to psychological barriers such as negative perceptions of injectables, depression, anxiety, feelings of shame, distress and perceived lack of control. The authors based this intervention on a systematic review which identified a need for structured diabetes education focussed on psychological constructs to inform effective interventions to improve the initiation of and persistence with injectable medication for T2D. This systematic review along with findings from focus groups were translated to develop an intervention for people with T2D transitioning to injectable therapies, named Overcoming and Removing Barriers to Injectable Treatment in T2D (ORBIT). This intervention comprised identifying the barriers to commencing injectables and pairing these with a broad range of techniques (including education, CBT techniques and utilising supports) to help the patient in overcoming the barriers. Lowry et al. described a novel intervention called D1 Now which was designed to support self-management and engagement in order to improve outcomes in young adults (18-25 years) living with type 1 diabetes (T1D). It has been developed using a user-centred approach, and incorporating theoretical elements resulting in a three-fold intervention. One of the central components of this intervention is the availability of a Support Worker to provide continuity and build relationships with young adults and their diabetes team. In this pilot RCT, the Support Worker provided an accessible point of contact for young adults, including conversations about distress, and developing goal setting and collaborative problem solving interventions. Diabetes distress was common in this population and was associated with challenges including cognitive distortions (e.g. 'all or nothing' thinking patterns) and disordered eating behaviours. The Support Worker advocated for the young person with T1D with the diabetes team by explaining the challenges and barriers to care elicited in their interactions. This pilot has identified that the role of the Support Worker was viewed positively from the perspective of young adults with T1D. O'Donnell et al. described the theoretical underpinnings and development of a psychological intervention for parents of young people with T1D aged 11-14. This theoretically informed intervention was designed in recognition of the higher incidence of disordered eating and clinical eating disorders in young people with T1D. Where present comorbid with T1d, disordered eating is associated with negative outcomes in physical and mental health, including repeated diabetic ketoacidosis and hyperglycaemia. There is growing evidence that disordered eating in T1D may be effectively prevented through psychological intervention. This is a manualised intervention and includes two online group workshops, supplemented by additional online materials intervention was co-developed with an expert advisory group of clinicians, and families of young people with T1D. The findings of the feasibility study will inform the future alignment of this intervention with routine diabetes care. This interventions has the potential to improve the psychological and physical wellbeing of young people with T1D. Conclusion These diverse papers demonstrate the range of psychological interventions which may be utilised to optimise the management of both T1D and T2D, and indicate that different psychological approaches may be required for different challenges, for example a support worker may be effective for the young adult population, but a population with disordered eating may require a more tailored intervention, and specific interventions to address individual-level barriers to commencing injectable therapies may have promise. Four papers do not of course offer a comprehensive overview of the area of psychological therapies in diabetes, but they provide a glimpse of emerging treatment. There is much work to be done in further refining the right intervention for the individual challenges that the person with diabetes may face, and these studies indicate that a person-centred approach to finding solutions to the individual's specific problems may be approaches which will shape the evidence in the future. Author Contributions The author confirms being the sole contributor of this work and has approved it for publication. Conflict of Interest The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's Note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1 Davidson P LaManna J Davis J Ojeda MM Hyer S Dickinson JK . The Effects of Diabetes Self-Management Education on Quality of Life for Persons With Type 1 Diabetes: A Systematic Review of Randomized Controlled Trials. Sci. Diabetes Self Manag Care (2022) 48 (2 ):111-35. doi: 10.1177/26350106211070266 2 Alexandre K Campbell J Bugnon M Henry C Schaub C Serex M . Factors Influencing Diabetes Self-Management in Adults: An Umbrella Review of Systematic Reviews. JBI Evid Synth (2021) 19 (5 ):1003-118. doi: 10.11124/JBIES-20-00020 3 Farooqi A Khunti K Abner S Gillies C Morriss R Seidu S . Comorbid Depression and Risk of Cardiac Events and Cardiac Mortality in People With Diabetes: A Systematic Review and Meta-Analysis. Diabetes Res. Clin. Pract. (2019) 156 :107816. doi: 10.1016/j.diabres.2019.107816 31421139 4 Chatterjee S Davies MJ . Current Management of Diabetes Mellitus and Future Directions in Care. Postgrad Med. J. (2015) 91 (1081 ):612-21. doi: 10.1136/postgradmedj-2014-133200 5 Winkley K Upsher R Stahl D Pollard D Brennan A Heller S . Systematic Review and Meta-Analysis of Randomized Controlled Trials of Psychological Interventions to Improve Glycaemic Control in Children and Adults With Type 1 Diabetes. Diabetes Med. (2020) 37 (5 ):735-46. doi: 10.1111/dme.14264 |
Front Psychol Front Psychol Front. Psychol. Frontiers in Psychology 1664-1078 Frontiers Media S.A. 10.3389/fpsyg.2023.1166258 Psychology Correction Corrigendum: A study of the factors influencing HIV-preventive intentions among "hookup" application users Li Mengyu 1 2 3 + Li Ning 4 * + 1College of Humanities and Development Studies, China Agricultural University, Beijing, China 2Faculty of Modern Languages and Communication, Universiti Putra Malaysia, Serdang, Selangor, Malaysia 3School of Journalism and Communication, Zhengzhou University, Zhengzhou, China 4Department of Media and Communication, Kangwon National University, Chuncheon-si, South Korea Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Ning Li [email protected] This article was submitted to Positive Psychology, a section of the journal Frontiers in Psychology +These authors have contributed equally to this work and share first authorship 28 2 2023 2023 28 2 2023 14 116625815 2 2023 16 2 2023 Copyright (c) 2023 Li and Li. 2023 Li and Li This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on A study of the factors influencing HIV-preventive intentions among "hookup" application users by Li, M., and Li, N. (2023). Front. Psychol. 13:1048226. doi: 10.3389/fpsyg.2022.1048226 social app health belief model planned behavior theory hooking up mindfulness SEM model HIV prevention pmcIn the published article, there was an error in the author list. Mengyu Li and Ning Li should share first authorship. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Clin Diabetes Healthc Front Clin Diabetes Healthc Front. Clin. Diabetes Healthc. Frontiers in Clinical Diabetes and Healthcare 2673-6616 Frontiers Media S.A. 10.3389/fcdhc.2023.1116879 Clinical Diabetes and Healthcare Editorial Editorial: Highlights in diabetes self-management 2021/22 Lamptey Roberta 1 2 3 * Berry Emma 4 Hermanns Norbert 5 Snoek Frank 6 1 Family Medicine Department, Korle Bu Teaching Hospital, Accra, Ghana 2 Jullius centre, University medical centre Utrecht, Utrecht, Netherlands 3 Department of Community Health, University of Ghana Medical School, University of Ghana, Accra, Ghana 4 School of Psychology, Queen's University Belfast, Northern Ireland, Belfast, United Kingdom 5 Research Institute of the Diabetes Acdemy Mergentheim (FIDAM), Bad, Mergentheim, Germany 6 Department of Medical Psychology, Amsterdam University Medical Center (UMC), Vrije Universiteit, Amsterdam, Netherlands Edited and Reviewed by: Thomas Kubiak, Johannes Gutenberg University Mainz, Germany *Correspondence: Roberta Lamptey, [email protected] This article was submitted to Diabetes Self-Management, a section of the journal Frontiers in Clinical Diabetes and Healthcare 13 1 2023 2023 4 111687905 12 2022 05 1 2023 Copyright (c) 2023 Lamptey, Berry, Hermanns and Snoek 2023 Lamptey, Berry, Hermanns and Snoek This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic: Highlights in diabetes self-management 2021/22 diabetes self-management education self-care - diabetes knowledge self-care (MeSH) pmcSelf-management is arguably the cornerstone and the most challenging aspect of diabetes care for people living with diabetes, irrespective of the type of diabetes. Self-management encompasses the routines necessary for managing glycaemic levels and includes; glucose monitoring, portioning meals/snacks, meal timing, physical activity, taking medication, healthy coping, and foot care. Self-care can be demanding for people living with diabetes, as it requires cognitive, emotional, and behavioural effort on a daily basis. Sustaining self-care routines over a lifetime is burdensome; however, this enduring effort is important in supporting long-term health and wellbeing. People living with diabetes should therefore have access to continuous diabetes self-management support. Unfortunately, this is often not the case, particularly in low-income countries. Even in well-resourced settings, access to self-management education and support is often limited and not provided on a structural basis. Clearly, person-centred self-management education and support deserves more attention, both in youth and adults with diabetes. Evidence from papers in this collection are summarised in the sections below. Playful communication and care: Exploring child-centred care of young children with type 1 diabetes through the framework of zone of proximal development Using qualitative methods specifically observation and interviews DeCosta et al examined established care practices which address the mental and social needs of young children living with type 1 diabetes (T1DM), by interviewing professionals from specialist centres in Denmark. Half of the professionals interviewed had up to 19 years of experience in paediatric endocrinology. Although their findings cannot be generalised they provide rare insights into approaches to diabetes self-management in children: very young children. Attention to immediate needs, child centeredness and participation, and communication style were themes emerging from their study. Delivering diabetes care using these strategies facilitated the process of drawing these young children into their self-care. Attention to immediate needs DeCosta et al. report a paradigm shift from the biomedical model to the biopsychosocial model, in providing care for children with T1DM. Deliberate effort now goes into improving a child's experience in hospital at the time of diagnosis. Consistent messaging from the same team of healthcare providers and predictability helps a child living with T1DM to build relationships and helps to create a safe environment for the child. Learning, including learning about diabetes and self-care happens when a child feels secure. At the time of diagnosis, the immediate needs of children living with T1DM should be and can be met by limiting change, limiting pain, and enhancing predictability. Child centeredness By removing the focus from diabetes to the child as a whole person and what matters to them the providers invest in the ability of the child to share diabetes self-care related challenges with clinicians in the future. Connecting to the child on matters unrelated to diabetes management provides a channel for effective diabetes self-management education and support. Child participation During consultations, clinicians prevent 'sugars' from getting in the way. Abstract numbers are complex for children and prevent them from getting involved in their care. Clinicians ensured that consultations were pleasant experiences by using several techniques to limit pain and fear. Role play improved child involvement; but more importantly helped them recover from unpleasant experiences. Playful communication Understanding the child's world and using positive feedback and gifts made it possible to earn children's corporation for unpleasant procedures. Medication intake, perceived barriers, and their correlates among adults with type 1 and type 2 diabetes: Results from diabetes MILES - The Netherlands Factors associated with self-reported medication taking may be modified to improve medication taking. Hogervorst et al. reported that depression and diabetes-related distress were negatively associated with medication taking in both T1DM and T2DM. Suggesting that in adults living with diabetes self-care is influenced by mental health. Furthermore, medication taking was associated with lower HbA1c values for all sub-types of diabetes. Adults living with diabetes on insulin therapy irrespective of sub-type of diabetes were shown to be taking their medication more often than adults living with diabetes who were not on insulin. However, the effect sizes were small. Importantly, among adults living with T1DM, fewer events of severe hypoglycaemia was associated with less frequent medication taking and more perceived barriers to taking medication, after adjusting for multiple confounders. This finding underlines the complexity of self-management in T1DM. In adults living with T2DM shorter duration of diabetes and mental health challenges remained positively associated with not taking medication and perceived barriers to medication taking. These findings underscore the need for clinicians to be alert to characteristics in adults living with T1DM and T2DM, which may pre-dispose persons living with diabetes to depression, not taking medication, and increased perceived barriers to medication taking. These factors should also addressed as part of modern individualised diabetes self-management education. The study population in this study were a non-representative sample of Dutch adults with self-reported diabetes participating in an online cross-sectional study. The generalisability of these findings may therefore be limited. Empowered by intertwined theory and practice - experiences from a diabetes sports camp for physically active adults with type 1 diabetes Self-management education does not always translate into improved self-care behaviours for multiple reasons. Wide variations in glycaemic levels can frustrate self-management efforts of physically active people. These challenges may be mitigated by empowering through education. Mattsson et al. employ qualitative techniques (telephone interviews) to study how new learnings become habits. The study population comprised of 15 people living with T1DM for a mean of 15 years, who participated in a 3-day diabetes sports camp. Self-reported increases in diabetes specific knowledge was observed after immersion in a sports camp. The presence of peers, and engagement with multi-disciplinary teams, practical sessions, timely individualised feedback including technology-assisted feedback, seemed to have facilitated the process of behaviour change. Making diabetes care fit are we making progress? This perspective piece by Ruissen et al. shed light on the overarching principle that diabetes care needs to be tailor-made. Unfortunately, one-size simply cannot fit all. It is not only impossible but also impractical to deliver tailor made diabetes self-management education and support without involving the patient and their support persons. Patient centeredness must be the guiding principle for all diabetes related encounters. The studies summarised above are reflective of the complexity of self-management in diabetes. They provide an insight into the determinants of self-management as well as potentially useful interventions to support self-management in a way that centres on the holistic needs of persons living with diabetes. Author contributions RL prepared the first draft. All authors made modifications and approved the final version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Clin Diabetes Healthc Front Clin Diabetes Healthc Front. Clin. Diabetes Healthc. Frontiers in Clinical Diabetes and Healthcare 2673-6616 Frontiers Media S.A. 10.3389/fcdhc.2022.1074162 Clinical Diabetes and Healthcare Editorial Editorial: Psychosocial repercussions of the Covid-19 pandemic for people living with or supporting others with diabetes Mocan Andreia S. 1 * Berry Emma 2 * Davies Mark 3 Joensen Lene Eide 4 Messina Rossella 5 1 Center for Diabetes, Nutrition and Metabolic Diseases, Emergency Clinical County Hospital, Cluj-Napoca, Cluj, Romania 2 School of Psychology, Queen's University Belfast, Belfast, Ireland 3 Belfast City Hospital, Clinical Psychology Department, Northern Ireland, United Kingdom 4 Steno Diabetes Center, Health Promotion Research, Gentofte, Denmark 5 Department of Biomedical and Neuromotor Sciences, Alma Mater Studiorum-University of Bologna, Bologna, Italy Edited and Reviewed by: Frank Jan Snoek, Academic Medical Center, Netherlands *Correspondence: Andreia S. Mocan, [email protected]; Emma Berry, [email protected] This article was submitted to Diabetes Self-Management, a section of the journal Frontiers in Clinical Diabetes and Healthcare 18 11 2022 2022 18 11 2022 3 107416219 10 2022 24 10 2022 Copyright (c) 2022 Mocan, Berry, Davies, Joensen and Messina 2022 Mocan, Berry, Davies, Joensen and Messina This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Psychosocial repercussions of the Covid-19 pandemic for people living with or supporting others with diabetes diabetes emotional distress depression anxiety COVID-19 pmcThe outbreak of the Coronavirus (COVID-19) pandemic has created a global health crisis and resulted in drastic changes in the way we perceive our world. Imposed restrictions such as lockdown and social distancing, and the promotion of safety behaviours were introduced to reduce the magnitude of infection (1). In-person appointments were suspended and people were encouraged to manage their diabetes largely by themselves often without the immediate support of the health care team. Both for people with diabetes and for the health care team, new problems emerged. In addition to the usual challenges of diabetes self-management, emotional stress and adaptation, the COVID pandemic added a larger and more inclusive problem: adaptation to a new world. A new world that incorporates a new type of social and work environment and relationships; new rules, habits and behaviours; new perceptions and emotions related to self-protection and protection of others against a new and unknown threat. Within this context, this special issue, entitled "Psychosocial repercussions of the COVID-19 pandemic for people living with or supporting others with diabetes", focussing on COVID-19 impact on diabetes was conceived. This Research Topic attracted thought-provoking and insightful manuscripts that fall into 4 categories: a) COVID-19 and healthcare providers; b) COVID-19 emotional burden in type 1 diabetes (T1D); c) self-care activities and diabetes distress in type 2 diabetes (T2D) and d) general aspects of diabetes management during the COVID-19 pandemic. The first category of research includes papers on professionals working in the field of diabetes. Hale et al. captures the concerns expressed by endocrine specialists and primary care providers about the well-being, psychosocial functioning, self-care routine, and financial challenges faced by the people living with diabetes (PWD) they care for. Lifestyle management interventions via tele medicine were used by the participating healthcare providers to offer support. Moreover, some of the participants helped PWD access financial programs when needed. A cross-sectional study by Wagner et al. found that half of the participating health care providers (n=123, 27 countries) experienced moderate to severe levels of mental stress, burnout, or other mental health issues because of the pandemic. Significant concerns were expressed about the lack of clear public health guidelines, delays in or the lack of COVID-19 testing, COVID-19 work exposure, safety concerns for themselves/staff/PWD, and about how PWD use technology and manage their diabetes. Isolation from colleagues was reported to be a moderate to serious problem for many participants in this study. A second category of research examined people living with T1D. A literature review by Bassi et al. showed that the majority of COVID-19 studies on T1D teenagers focused mostly on glycemic control. Protective or risk factors, specific prevention or/and supporting methods for psychological well-being were less likely to be considered. 'Positive lockdown effect' was discussed and was defined as a period of stable routine had a positive influence on glycemic control. Caregivers perceived increased burden in diabetes management and child-related worry during the pandemic. Telemedicine was suggested as a method to increase maintenance of healthy diabetes care and self-efficacy during pandemic. An ecological momentary assessment study by Schmid et al., spanning a 10-day period, showed no difference between pre-pandemic and during pandemic levels of diabetes distress and depression among middle-aged individuals living with T1D. Fears of COVID-19 and of becoming infected were associated with diabetes duration and were predicted by pre-pandemic diabetes distress and illness/diabetes acceptance. O'Donnell et al. investigated the psychosocial and diabetes management impact of COVID-19 on adolescents living with T1D and who had elevated diabetes distress. They found that social and family relationships, health practices, school routines, diabetes management behaviors, dietary behaviors, physical activity and medical appointments were all disrupted. Resilience, social support, faith and meaning making were all reported as being helpful and protective against pandemic impact. A third category of research focused on people living with T2D. A Scoping Review by Cummings et al. showed that the pandemic was in some ways detrimental to people living with T2D. Decreases in physical activity and no significant change in glucose monitoring and substance misuse were reported. However, positive effects were also found. Based on cross-sectional study of 1822 participants, Amerson et al. reported that during COVID-19 pandemic people living with T2D reported an increase in self-care activities, reductions in perceived distress and moderately lower diabetes distress, especially in vulnerable groups. The fourth category of research concentrated on the impact pandemic lockdowns had on diabetes management in general. Olesen et al. found in a one year follow-up study that PWD reported both negative changes (i.e. lower physical activity, eaten unhealthier, diabetes management was more difficult; higher blood pressure and more glucose variability) and positive changes (i.e. more physical active, more healthy food and easier diabetes management) compared to pre-pandemic life. Moreover, the authors found that higher diabetes distress at the beginning of the pandemic was a predictor for both positive and negative aspects of diabetes management. Holloway et al. showed that PWD were feeling burned out by the constant effort to manage their diabetes during the pandemic and that easing/relaxing the pandemic restrictions might help with diabetes specific emotional problems such as worry about COVID-19 and diabetes. For the members of the medical profession, the pandemic presented particular challenges about how to provide support to PWD to assist them to adapt whilst, at the same time, having to adapt themselves. Studies such as those published in this Special Issue, help to transform an unknown problem into a known one. Data derived from sound methodology, supports the development of conceptual frameworks upon which interventions to help PWD and healthcare professionals manage emotional struggles can be built. It should be noted that the studies presented in this issue tended to under-represent the views of men and of PWD from low and middle-income countries, where the experience of pandemic might be very different to those reported here. Nevertheless, the published studies are an important contribution to the understanding of the COVID-19 psychosocial and management impact on PWD. Author contributions AM, EB, MD, LJ, and RM contributed to the conception of the editorial. AM redacted the draft of the present editorial All authors contributed to manuscript revision, read, and approved the submitted version. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Reference 1 Bedford J Enria D Giesecke J Heymann DL Ihekweazu C Kobinger G . COVID-19: Towards controlling of a pandemic. Lancet (2020) 395 (10229 ):1015-8. doi: 10.1016/s0140-6736(20)30673-5 |
JMIR Dermatol JMIR Dermatol JDERM JMIR Dermatology 2562-0959 JMIR Publications Toronto, Canada v5i4e39952 10.2196/39952 Research Letter Research Letter The Evolution of Live Patient Viewing in the Era of COVID-19: Survey Study Dellavalle Robert Sivesind Torunn Samuel Lalitha Hertling Stefan Sally Rachel BA 1 Shaw Katharina MD 1 Ho Roger MS, MPH, MD 1Ronald O Perelman Department of Dermatology New York University Grossman School of Medicine 240 East 38th Street 12th Floor New York, NY, 10016 United States 1 212 263 5253 [email protected] 1 Ronald O Perelman Department of Dermatology New York University Grossman School of Medicine New York, NY United States Corresponding Author: Roger Ho [email protected] Oct-Dec 2022 18 10 2022 18 10 2022 5 4 e3995229 5 2022 28 9 2022 5 10 2022 6 10 2022 (c)Rachel Sally, Katharina Shaw, Roger Ho. Originally published in JMIR Dermatology ), 18.10.2022. 2022 This is an open-access article distributed under the terms of the Creative Commons Attribution License ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work, first published in JMIR Dermatology, is properly cited. The complete bibliographic information, a link to the original publication on as well as this copyright and license information must be included. COVID-19 pandemic live patient viewing dermatology education dermatology COVID-19 residency program residency dermatology residency medical education virtual education didactic pmcOver two years into the COVID-19 pandemic, the effects of this unprecedented crisis continue to unfold. Despite increasing vaccination rates and relaxation of "social distancing," avoiding extraneous person-to-person contact remains the gold standard, particularly in health care settings. In dermatology, where close examination of the skin is paramount, this policy has far-reaching consequences. Dermatology resident education has been particularly disrupted because live patient viewing sessions (LPVSs) a longstanding pillar of dermatology training have been infeasible when "distancing" is required. While much of dermatology education will likely return to baseline post pandemic, the fate of LPVSs remains unclear. We thus aimed to assess the baseline integration of LPVSs, identify pandemic modifications, and ascertain permanent pedagogical changes. In September 2020, an institutional review board-approved web-based survey was sent to 123 US dermatology residency programs (Multimedia Appendix 1). The survey queried demographics and curricular integration of LPVSs before, during, and after the pandemic. Of 123 contacted, 44 (35.8%) surveys were completed. Most programs hosted LPVSs prepandemic (n=39, 89%), and the majority supplemented these live sessions with virtual cases (n=35, 80%; Table 1). All programs canceled LPVSs at the onset of the pandemic, with most substituting virtual cases (n=40, 91%). Regarding LPVS resumption post pandemic, 13 (30%) reported they would restart, 25 (57%) were ambivalent at the time, and 6 (14%) reported LPVSs would not recommence. Fisher exact test revealed no significant relationship between geography and LPVS resumption (P=.21). Of the programs reporting that LPVSs would not resume, the majority believed virtual cases were sufficient to replace live sessions. All programs committed to restarting LPVSs will continue incorporating virtual cases. The 19th-century physician Osler revolutionized medical education with his emphasis on bedside training. His tradition of live patient viewing has been maintained by academic dermatology departments nationwide, as reflected by our results: prior to the COVID-19 pandemic, 39 (89%) dermatology programs hosted LPVSs, with the majority (n=40, 90%) during grand rounds, and over half (51%) hosting LPVSs several times a month. LPVSs are consistently ranked highly among residents, and our results suggest similar sentiments among program leadership, with 34 (77%) viewing LPVSs as integral to resident education and 36 (82%) believing LPVSs facilitate collaboration (Table 2) [2-5]. Yet despite the value of LPVSs to trainees and faculty alike, our results demonstrate a surfeit of uncertainty in reintroducing in-person sessions, with 25 (57%) respondents unsure about preserving LPVSs. At least 6 surveyed programs discontinued LPVSs altogether. Whether additional programs ultimately decide against readopting LPVSs remains uncertain. Our results suggest an overwhelming trend toward incorporating virtual patient conferences into didactic curricula. As vaccination rates increase and the COVID-19 pandemic wanes, the proportional fates of live and virtual patient viewing sessions within dermatology will doubtlessly declare themselves. As Osler wrote, "to study...the disease without books is to sail an uncharted sea, while to study books without patients is not to go to sea at all." Table 1 Demographic and curricular integration results (N=44). Participant responses Participants, n (%) Demographic characteristics Geographic location Northeast 10 (23) Southeast 9 (20) Midwest 13 (30) Northwest 4 (9) Southwest 8 (18) Program size (residents) <=8 8 (18) 9-18 27 (61) >=19 9 (20) Curricular integration Live PVSa Pre-COVID-19b 39 (89) During COVID-19c 0 (0) Anticipated return post COVID-19d 13 (30) Virtual PVS Pre-COVID-19b 35 (80) During COVID-19c 40 (91) Anticipated return post COVID-19d 17 (39) aPVS: patient viewing session. bPre-COVID-19 corresponds to prior to March 2020. cDefined as March 2020 to time of the survey distribution (September 2020). dA total of 25 participants were unsure at the time whether they would return to PVSs. Table 2 Live PVS needs assessment survey results (N=44). Strongly agree, n (%) Agree, n (%) Neutral, n (%) Disagree, n (%) Integral part of resident education 21 (47)a 13 (30)a 4 (9) 1 (2) Teach trainees morphology, differential diagnoses, and disease management 24 (55) 13 (30) 2 (5) 0 (0) Provide opportunities for clinicopathological correlation 23 (52) 14 (32) 2 (5) 0 (0) Useful for providing high-quality patient care 20 (45) 14 (32) 5 (11) 0 (0) Useful for seeking other dermatologists' opinions about diagnosis or management of difficult cases 26 (59)b 10 (23)b 3 (7) 0 (0) Conducted in a humanistic manner 21 (48) 14 (32) 2 (5) 2 (5) Has a set of rules/conduct guidelines that are consistently followed 17 (39) 16 (36) 3 (7) 3 (7) Patients generally feel comfortable with being seen by a group of physicians 11 (25) 19 (43) 7 (16) 2 (5) Patients view their participation in PVSsc as worthwhile 15 (34) 19 (43) 4 (9) 1 (2) Strengthen the physician-patient relationship 8 (18) 16 (36) 13 (30) 2 (5) aA total of 77% (n=34) of respondents agree or strongly agree that live patient viewing sessions are an integral part of resident education. bA total of 82% (n=36) of respondents agree or strongly agree that live patient viewing sessions help foster collaboration between physicians. cPVS: patient viewing session. Multimedia Appendix 1 Institutional review board-approved web-based survey via RedCap. Abbreviations LPVS live patient viewing session Conflicts of Interest: None declared. 1 Osler W The natural method of teaching the subject of medicine JAMA 1901 06 15 XXXVI 24 1673 10.1001/jama.1901.52470240001001 2 Callaghan DJ DeWitt CA Norton SA Survey on the format of dermatology grand rounds Association of Professors of Dermatology 2013 2022-10-13 3 Mehrabi D Cruz PD Educational conferences in dermatology residency programs J Am Acad Dermatol 2006 09 55 3 523 4 10.1016/j.jaad.2006.04.024 16908367 S0190-9622(06)01200-X 16908367 4 Freeman SR Greene RE Kimball AB Freiman A Barzilai DA Muller S Duke JK Dellavalle RP US dermatology residents' satisfaction with training and mentoring: survey results from the 2005 and 2006 Las Vegas Dermatology Seminars Arch Dermatol 2008 07 144 7 896 900 10.1001/archderm.144.7.896 18645141 144/7/896 18645141 5 Freiman A Barzilai DA Barankin B Natsheh A Shear NH National appraisal of dermatology residency training: a Canadian study Arch Dermatol 2005 09 141 9 1100 4 10.1001/archderm.141.9.1100 16172306 141/9/1100 16172306 |
Front Psychol Front Psychol Front. Psychol. Frontiers in Psychology 1664-1078 Frontiers Media S.A. 10.3389/fpsyg.2023.1150187 Psychology Correction Corrigendum: Impact of vitamin D on cognitive functions in healthy individuals: A systematic review in randomized controlled clinical trials da Silva Ana Beatriz Januario 1 2 * + Barros Waleska Maria Almeida 1 2 + da Silva Mayara Luclecia 2 3 + Silva Jose Mauricio Lucas 2 3 + Souza Ana Patricia da Silva 1 2 + da Silva Karollainy Gomes 1 2 + de Sousa Fernandes Matheus Santos 1 + Carneiro Antonietta Claudia Barbosa da Fonseca 2 + Toscano Ana Elisa 4 Lagranha Claudia Jacques 1 5 + 1Programa de Pos-graduacao em Neuropsiquiatria e Ciencias do Comportamento, Centro de Ciencias da Saude, Universidade Federal de Pernambuco, Recife, PE, Brazil 2Centro Integrado de Tecnologias em Neurociencia (CITENC), Centro Universitario Osman Lins (UNIFACOL), Vitoria de Santo Antao, PE, Brazil 3Programa de Pos-graduacao Multicentrico em Ciencias Fisiologicas, Centro Academico de Vitoria, Universidade Federal de Pernambuco, Vitoria de Santo Antao, Brazil 4Centro Academico de Vitoria, Universidade Federal de Pernambuco, Vitoria de Santo Antao, Brazil 5Laboratorio de Bioquimica Geral, Molecular e do Exercicio-Universidade Federal de Pernambuco, Centro Academico de Vitoria (CAV) UFPE, Vitoria de Santo Antao, PE, Brazil Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Ana Beatriz Januario da Silva [email protected] This article was submitted to Cognition, a section of the journal Frontiers in Psychology +ORCID: Ana Beatriz Januario da Silva orcid.org/0000-0001-7919-647X Waleska Maria Almeida Barros orcid.org/0000-0002-9033-8165 Mayara Luclecia da Silva orcid.org/0000-0002-0686-2635 Jose Mauricio Lucas Silva orcid.org/0000-0002-4508-3589 Ana Patricia da Silva Souza orcid.org/0000-0002-3144-2616 Karollainy Gomes da Silva orcid.org/0000-0003-0478-4327 Matheus Santos de Sousa Fernandes orcid.org/0000-0002-1066-9176 Antonietta Claudia Barbosa da Fonseca Carneiro orcid.org/0000-0002-2921-7858 Claudia Jacques Lagranha orcid.org/0000-0001-6883-9476 28 2 2023 2023 28 2 2023 14 115018723 1 2023 24 1 2023 Copyright (c) 2023 Silva, Barros, Silva, Silva, Souza, Silva, de Sousa Fernandes, Carneiro, Toscano and Lagranha. 2023 Silva, Barros, Silva, Silva, Souza, Silva, de Sousa Fernandes, Carneiro, Toscano and Lagranha This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on Impact of vitamin D on cognitive functions in healthy individuals: A systematic review in randomized controlled clinical trials by Silva, A. B. J. d., Barros, W. M. A., Silva, M. L. d., Silva, J. M. L., Souza, A. P. d. S., Silva, K. G. d., de Sousa Fernandes, M. S., Carneiro, A. C. B. d. F., Toscano, A. E., and Lagranha, C. J. (2022). Front. Psychol. 13:987203. doi: 10.3389/fpsyg.2022.987203 calcitriol cognition vitamin D deficiency cognition function child pmcIn the published article, there was an error in the author list as published. Author Viviane de Oliveira Nogueira Souza was erroneously included and author Ana Elisa Toscano was erroneously excluded. The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
BMC Health Serv Res BMC Health Serv Res BMC Health Services Research 1472-6963 BioMed Central London 9234 10.1186/s12913-023-09234-9 Correction Correction: The feasibility and acceptability of implementing video reflexive ethnography (VRE) as an improvement tool in acute maternity services McHugh Siobhan [email protected] 13 Sheard Laura 2 O'Hara Jane 1 Lawton Rebecca 3 1 grid.9909.9 0000 0004 1936 8403 Present Address: School of Healthcare, University of Leeds, Baines Wing, Leeds, LS2 9JT UK 2 grid.5685.e 0000 0004 1936 9668 Present Address: Department of Health Sciences, University of York, York, YO10 5DD UK 3 grid.9909.9 0000 0004 1936 8403 Present Address: School of Psychology, University of Leeds, Leeds, LS2 9JT UK 14 3 2023 14 3 2023 2023 23 249(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction to: BMC Health Services Research (2022) 22:1308. 10.1186/s12913-022-08713-9. Following publication of the original article , the authors reported missing information in the 'Acknowledgements' section. The statement in the 'Acknowledgements' section originally read: None. The statement in the 'Acknowledgements' section should read: The authors would like to thank Mr Dileep Wijeratne for his extensive support in both the set up and delivery of this research project. We would also like to thank all of the staff from Leeds Teaching Hospitals maternity services, in particular the clinical leads for anaesthetics, obstetrics and the head of midwifery for their time and support. The original article has been updated. The online version of the original article can be found at 10.1186/s12913-022-08713-9. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. McHugh The feasibility and acceptability of implementing video reflexive ethnography (VRE) as an improvement tool in acute maternity services BMC Health Serv Res 2022 22 1308 10.1186/s12913-022-08713-9 36324173 |
Trials Trials Trials 1745-6215 BioMed Central London 36915190 7219 10.1186/s13063-023-07219-x Correction Correction: The effect of a phytoestrogen intervention and impact of genetic factors on tumor proliferation markers among Swedish patients with prostate cancer: study protocol for the randomized controlled PRODICA trial Ahlin Rebecca [email protected] 1 Nybacka Sanna [email protected] 2 Josefsson Andreas [email protected] 345 Stranne Johan [email protected] 67 Steineck Gunnar [email protected] 1 Hedelin Maria [email protected] 18 1 grid.8761.8 0000 0000 9919 9582 Department of Oncology, Division of Clinical Cancer Epidemiology, Institute of Clinical Sciences, Sahlgrenska Academy at the University of Gothenburg, Box 423, 40530 Gothenburg, Sweden 2 grid.8761.8 0000 0000 9919 9582 Department of Molecular and Clinical Medicine, Institute of Medicine, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden 3 grid.8761.8 0000 0000 9919 9582 Department of Urology, Sahlgrenska Cancer Center, Institute of Clinical Sciences, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden 4 grid.12650.30 0000 0001 1034 3451 Wallenberg Center for Molecular Medicine, Ume University, Ume, Sweden 5 grid.12650.30 0000 0001 1034 3451 Department of Urology and Andrology, Institute of Surgery and Perioperative Sciences, Ume University, Ume, Sweden 6 grid.8761.8 0000 0000 9919 9582 Department of Urology, Institute of Clinical Sciences, Sahlgrenska Academy, University of Gothenburg, Gothenburg, Sweden 7 grid.1649.a 000000009445082X Department of Urology, Sahlgrenska University Hospital, Region Vstra Gtaland, Gothenburg, Sweden 8 grid.1649.a 000000009445082X Regional Cancer Center West, Sahlgrenska University Hospital, Region Vstra Gtaland, Gothenburg, Sweden 13 3 2023 13 3 2023 2023 24 187 The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement The Author(s) 2023 pmc Correction: Trials 23, 1041 (2022) The original publication of this article contained a typo on page 2. The incorrect and correct information is shown below. The original article has been updated. Incorrect In males diagnosed with intermediate-risk prostate cancer, the daily addition of 200 mg of phytoestrogen-rich foods to the diet for 6 weeks reduces prostate tumor proliferation compared to no addition of phytoestrogen-rich foods to the diet during the same period. Correct In males diagnosed with intermediate-risk prostate cancer, the daily addition of phytoestrogen-rich foods (~200 mg phytoestrogens) to the diet for 6 weeks reduces prostate tumor proliferation compared to no addition of phytoestrogen-rich foods to the diet during the same period. Reference 1. Ahlin R The effect of a phytoestrogen intervention and impact of genetic factors on tumor proliferation markers among Swedish patients with prostate cancer: study protocol for the randomized controlled PRODICA trial Trials 2022 23 1041 10.1186/s13063-022-06995-2 36544211 |
/2012/07000/Nasopharyngeal_Carcinoma_Presenting_With_Horner.9.aspx Man/68 Light-headed and nearly fainting; blurred vision and right arm tremors; hearing loss and otalgia in the left ear; low blood pressure; junctional rhythm Carotid sinus syndrome Intravenous and oral atropine sulfate; radiotherapy, oxygen therapy, and weekly infusions of perfluorocarbon emulsion No recurrence of syncope or hearing deficit; reduced tumor size; complete resolution of carotid sinus syndrome; patient dead three months later Man/69 Frequent and recurrent syncopal episodes lasting 3-4 min each during stress or emotional upset Right vagus nerve compressed by lymphadenopathy Chemoradiotherapy All syncope symptoms resolved Man/50 Intermittent fainting when tilting neck; bradycardia; hypotension Tumor in left nasopharynx extended to left carotid sheath space Chemoradiotherapy Disappearance of nasopharyngeal and neck masses; no recurrence of syncope Carotid sinus syndrome (CSS) occurs secondary to mechanical compression of the carotid sinus and is traditionally classified into three subgroups: the cardioinhibitory (CI) subtype (defined as asystole for > 3 s without a fall in arterial pressure), the vasodepressor subtype (defined as an isolated decline in systolic BP of > 50 mmHg), and mixed subtypes. The pathophysiology of CSS remains relatively obscure. Several pathophysiologic mechanisms have been considered, including atherosclerotic noncompliance, sternocleidomastoid proprioceptive denervation, and generalized autonomic dysfunction . In one study, CSS in an NPC patient was accompanied by norepinephrine secretion deficiency, which might give rise to vasodilation . NPC itself may not sensitize the carotid sinus; however, various biological and chemical mediators can do so . Head and neck tumors cramming into parapharyngeal space can also result in the development of syncope, which is known as parapharyngeal space syncope syndrome . The parapharyngeal space is close to the vagal, glossopharyngeal, and sublingual nerves; thus, a tumor may cause syncope by stimulating the vagus nerve or the glossopharyngeal nerve or both nerves to cause vasovagal or reflex syncope. In the present report, the syncope experienced by the patient was related to a long RR interval and hypotension, and cranial MRI and pathological tests led to a diagnosis of NPC. It was speculated that the patient's syncope was caused by hypersensitivity of the carotid sinus or tumor-induced irritation of the glossopharyngeal nerve, both of which are afferent to the medullary vasodepressor region, leading to increased vagal tone and decreased sympathetic tone. NPC-induced syncope is uncommon in clinic, but an early diagnosis determines the therapeutic outcome for patients. This specific condition should be distinguished from cardiac-origin syncope and OH syncope. The causes of cardiac syncope include arrhythmia and organic heart disease, and the diagnosis depends on ECG, transthoracic echocardiography, myocardial MRI, and coronary angiography. A diagnosis of OH syncope is based on BP variation in the supine or sitting position; the patient exhibits a decrease in systolic BP of 20 mmHg or in diastolic BP of 10 mmHg or a reduction in systolic BP to < 90 mmHg. The measurement of BP and heart rate in the supine and vertical positions facilitates the diagnosis of OH syncope. Nasopharyngeal carcinoma is usually diagnosed after a patient presents with a seemingly unrelated complaint. Symptom recognition, awareness of risk factors, and timely referral to an otorhinolaryngology service are essential for early diagnosis and intervention. Imaging usually includes computed tomography and MRI, with studies favoring MRI for both staging and follow-up. No consensus has been reached on the appropriate therapy for NPC-associated syncope. Two main treatments may be utilized, depending on the type of CSS. Firstly, midodrine serves as the main drug for vasodepressor CSS. Glucocorticoids, such as dexamethasone, increase blood volume through kidney sodium reabsorption, which can affect the sensitivity of baroreceptors. Glucocorticoids also enhance the effect of norepinephrine on vasoconstriction and, thus, reduce sympathetic activation, making them suitable for this type of vascular suppression. Secondly, a pacemaker implant, preferably a dual-chamber one, constitutes a common clinical practice for treating CI-CSS . Carotid sinus denervation, carotid endarterectomy, and cardiac ganglion plexus ablation have also been identified as modalities for treating CSS . Although promising, these approaches still need further validation, especially with respect to long-term effects. Syncopal symptoms can be improved after radiotherapy and chemotherapy , the mechanism of which might be related to tumor revision rather than only carotid sinus adjustment . Because of the limited recognition of a relationship between NPC and syncope, the physician in the present case ignored such a possibility. The patient was fitted with a pacemaker that mitigated the syncope initially, but it recurred five days after the operation. The authors speculate that the vasopressor type of syncope relates more to tumor-associated CSS than CI does. After radiotherapy and chemotherapy for the NPC, this patient experienced no further syncopal episodes. Syncope rarely occurs as the initial presentation of NPC. Carotid sinus syndrome is considered the potential intrinsic cause of syncope in patients with NPC. Hence, cranial imaging tests and nasopharyngoscopy may be needed for patients suspected of having NPC-associated syncope. Permanent pacing is often performed for CI-CSS. Patients with NPC who have CSS develop bradycardia and hypotension, so chemoradiotherapy may be a better choice for controlling their syncope. Physicians should attempt to identify the origin of recurrent syncope through an assessment of the patient's clinical condition and the performance of relevant tests, which will facilitate early diagnosis, precise treatment, and an improved prognosis. Abbreviations AF Atrial fibrillation BP Blood pressure CI Cardio inhibitory CSS Carotid sinus syndrome ECG Electrocardiogram MRI Magnetic resonance imaging NPC Nasopharyngeal carcinoma OH Orthostatic hypotensive Acknowledgements Not applicable. Authors' contributions ZLL drafted the manuscript, WL and GJ collected the data and performed the follow-up visit, and SSK reviewed and edited the paper. All authors read and approved the final manuscript. Funding Not applicable. Availability of data and materials All available information is contained within the present manuscript. Declarations Ethics approval and consent to participate This study was approved by the ethics committee of Huantai County People's Hospital. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Written informed consent was obtained from individual participants. Consent for publication Written informed consent for publication of their clinical details and/or clinical images was obtained from the patient on August 16,2021. A copy of the consent form is available for review by the Editor of this journal. Written informed consent was obtained from individual participants. Competing interests The authors declare no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
Arthritis Res Ther Arthritis Res Ther Arthritis Research & Therapy 1478-6354 1478-6362 BioMed Central London 3021 10.1186/s13075-023-03021-x Correspondence Response to "Similarities in clinical course and outcome between juvenile idiopathic arthritis (JIA)-associated and ANA-positive idiopathic anterior uveitis: data from a population-based nationwide study in Germany" Zhou Avery 12 Babiker Fatima 12 Philip Andrew M. 12 Anesi Stephen D. 12 Foster C. Stephen [email protected] 123 1 grid.490929.f 0000 0004 6014 521X The Ocular Immunology and Uveitis Foundation, Waltham, MA USA 2 grid.419472.d Massachusetts Eye Research and Surgery Institution, 1440 Main St. Ste. 201, Waltham, MA 02451 USA 3 grid.38142.3c 000000041936754X Department of Ophthalmology, Harvard Medical School, Boston, MA USA 14 3 2023 14 3 2023 2023 25 414 10 2022 27 2 2023 (c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. We have read the article entitled "Similarities in clinical course and outcome between juvenile idiopathic arthritis (JIA)-associated and ANA-positive idiopathic anterior uveitis: data from a population-based nationwide study in Germany" by Heiligenhaus et al. While we appreciate the work conducted by the authors, we have several comments we would like to address. First, the follow-up interval of 2 years is too short to conclude that the clinical course between two chronic pathologies is not significantly different. Second, remission status was determined by uveitis inactivity during the 2-year follow-up visit without any mention of flare frequency or length of remission, which is not a reliable measure of uveitis control. Third, ANA-positive idiopathic anterior uveitis is not a classification with a distinct clinical phenotype, and additional reports of serologic investigations would have been helpful. issue-copyright-statement(c) The Author(s) 2023 pmcDear Editor, We read, with great interest, the article by Heiligenhaus et al. . While we appreciate the work conducted by the authors, especially population-based data on relatively rare conditions, we wish to raise a few points. First, the study used a follow-up interval of 2 years to conclude that antinuclear antibody (ANA)-positive idiopathic uveitis and JIA-associated uveitis (JIA-U) do not significantly differ concerning the clinical course of uveitis, treatment, and response to corticosteroids and disease-modifying anti-rheumatic drugs (DMARDs). Although these pathologies may potentially behave similarly early in the disease course, this conclusion is potentially misleading because the clinical course of JIA-U is often much more chronic and stubborn than idiopathic anterior uveitis . Therefore, analysis over a longer period of time is necessary to more clearly elucidate differences in clinical course. Second, remission status was determined by uveitis activity, or lack thereof, at the 2-year follow-up visit. While this is an important data point, this is an imprecise way to gauge remission status. With the current methodology, a patient who had been in remission for the entire 2 years and a patient with recurrent flares but quiet at the 2-year visit would both be considered in remission. Within the 2-year follow-up period, the number of flares or the duration of quiescence since the most recent flare would be important data, as these data more completely portray remission status. Finally, ANA-positive idiopathic anterior uveitis is not a homogeneous classification with a distinct clinical phenotype. Among patients with idiopathic non-infectious anterior uveitis, ANA positivity is not known to produce a distinct clinical phenotype. The authors mention that human leukocyte antigen (HLA) B27 status was recorded, but there is no breakdown of its presence in the uveitis patients. HLA-B27-associated anterior uveitis has a known clinical phenotype, potentially adding to the heterogeneity of the ANA-positive idiopathic anterior uveitis group. Further presentation of serologic investigations would have been helpful. We thank this group for their research on an under-represented topic in the literature and look forward to future work from this group. Abbreviations ANA Antinuclear antibody DMARDs Disease-modifying anti-rheumatic drugs HLA Human leukocyte antigen JIA Juvenile idiopathic arthritis JIA-U Juvenile idiopathic arthritis-associated uveitis Acknowledgements Not applicable. Authors' contributions A.Z., F.B., & AMP contributed in writing the first draft. SDA & CFS contributed in revising the manuscript. All authors contributed in approving the final manuscript for submission. Funding Not applicable. Availability of data and materials Not applicable. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. Heiligenhaus A Klotsche J Niewerth M Horneff G Ganser G Haas JP Minden K Similarities in clinical course and outcome between juvenile idiopathic arthritis (JIA)-associated and ANA-positive idiopathic anterior uveitis: data from a population-based nationwide study in Germany Arthritis Res Ther 2020 22 1 81 10.1186/s13075-020-02166-3 32293540 2. Anesi SD Foster CS Importance of recognizing and preventing blindness from juvenile idiopathic arthritis-associated uveitis Arthritis Care Res (Hoboken) 2012 64 5 653 657 10.1002/acr.21599 22231857 3. Sen ES Ramanan AV Juvenile idiopathic arthritis-associated uveitis Clin Immunol 2020 211 108322 10.1016/j.clim.2019.108322 31830532 |
World J Surg Oncol World J Surg Oncol World Journal of Surgical Oncology 1477-7819 BioMed Central London 36915155 2979 10.1186/s12957-023-02979-x Correction Correction: Expression of EMT-related genes in lymph node metastasis in endometrial cancer: a TCGA-based study Li He 1 Wang Junzhu 2 Li Liwei 1 Zhao Luyang 1 Wang Zhiqi [email protected] 1 1 grid.411634.5 0000 0004 0632 4559 Department of Obstetrics and Gynecology, Peking University People's Hospital, No. 11 Xizhimen South Street, Xicheng District, Beijing, 100044 China 2 grid.11135.37 0000 0001 2256 9319 The Big Data and Public Policy Laboratory, School of Government, Peking University, Beijing, China 14 3 2023 14 3 2023 2023 21 97(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction: World J Surg Oncol 21, 55 (2023) Following publication of the original article , the authors identified an error in the author names of all authors. The given name and family name were erroneously transposed. The incorrect author names are: Li He, Wang Junzhu, Li Liwei, Zhao Luyang and Wang Zhiqi The correct author names are: He Li, Junzhu Wang, Liwei Li, Luyang Zhao and Zhiqi Wang The author group has been updated above and the original article has been corrected. Example Reference 1. Li H Wang J Li L Expression of EMT-related genes in lymph node metastasis in endometrial cancer: a TCGA-based study World J Surg Oncol 2023 21 55 10.1186/s12957-023-02893-2 36814242 |
Orphanet J Rare Dis Orphanet J Rare Dis Orphanet Journal of Rare Diseases 1750-1172 BioMed Central London 36915141 2646 10.1186/s13023-023-02646-0 Correction Correction: Ketogenic diet as a glycine lowering therapy in nonketotic hyperglycinemia and impact on brain glycine levels Shelkowitz Emily 1 Saneto Russell P. 2 Al-Hertani Walla 3 Lubout Charlotte M. A. 4 Stence Nicholas V. 5 Brown Mark S. 5 Long Patrick 1 Walleigh Diana 6 Nelson Julie A. 6 Perez Francisco E. 7 Shaw Dennis W. W. 7 Michl Emma J. 3 Van Hove Johan L. K. [email protected] [email protected] 1 1 grid.430503.1 0000 0001 0703 675X Section of Clinical Genetics and Metabolism, Department of Pediatrics, University of Colorado, Education 2 South, L28-4114, East 17th Avenue, Aurora, CO 80045 USA 2 grid.240741.4 0000 0000 9026 4165 Division of Pediatric Neurology, Department of Neurology, Center for Integrative Brain Research, Seattle Children's Research Institute, Seattle Children's Hospital, Seattle, WA 98105 USA 3 grid.38142.3c 000000041936754X Division of Genetics and Genomics, Boston Children's Hospital, Harvard Medical School, Boston, MA USA 4 grid.4494.d 0000 0000 9558 4598 Section of Metabolic Diseases, Beatrix Children's Hospital, University of Groningen, University Medical Center, Groningen, Groningen, The Netherlands 5 grid.430503.1 0000 0001 0703 675X Department of Radiology, University of Colorado, Aurora, CO USA 6 grid.430503.1 0000 0001 0703 675X Section of Child Neurology, Department of Pediatrics, University of Colorado, Aurora, CO USA 7 grid.34477.33 0000000122986657 Department of Radiology, Seattle Children's Hospital, University of Washington, Seattle, WA USA 13 3 2023 13 3 2023 2023 18 54(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmcCorrection : Orphanet Journal of Rare Diseases (2022) 17:423 10.1186/s13023-022-02581-6 Following publication of the original article , we have been notified that reference 33 has error in the published year. The correct reference should be as follows: 33. Bzduch V, Behulova D, Kolnikova M, Payerova J, Fabriciova K. Ketogenic diet in nonketotic hyperglycinemia. J Inherited Metab Dis. 2010;33(Suppl 1):S31. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Reference 1. Shelkowitz E Saneto RP Al-Hertani W Lubout CMA Stence NV Brown MS Long P Walleigh D Nelson JA Perez FE Shaw DWW Michl EJ Van Hove JLK Ketogenic diet as a glycine lowering therapy in nonketotic hyperglycinemia and impact on brain glycine levels Orphanet J Rare Dis 2022 17 423 10.1186/s13023-022-02581-6 36471344 |
Mol Cancer Mol Cancer Molecular Cancer 1476-4598 BioMed Central London 1758 10.1186/s12943-023-01758-2 Correction Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation Weisse Jonas 1 Rosemann Julia 1 Muller Lisa 2 Kappler Matthias 3 Eckert Alexander W. 4 Glass Markus 5 Misiak Danny 5 Huttelmaier Stefan 5 Ballhausen Wolfgang G. 6 Hatzfeld Mechthild 2 Haemmerle Monika 7 Gutschner Tony [email protected] 1 1 grid.9018.0 0000 0001 0679 2801 Junior Research Group 'RNA biology and pathogenesis', Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120 Halle, Germany 2 grid.9018.0 0000 0001 0679 2801 Institute of Molecular Medicine, Section for Pathobiochemistry, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120 Halle, Germany 3 grid.9018.0 0000 0001 0679 2801 Department of Oral and Maxillofacial Plastic Surgery, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120 Halle, Germany 4 grid.511981.5 Department of Cranio Maxillofacial Surgery, Paracelsus Medical University, 90471 Nuremberg, Germany 5 grid.9018.0 0000 0001 0679 2801 Institute of Molecular Medicine, Section for Molecular Cell Biology, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120 Halle, Germany 6 grid.9018.0 0000 0001 0679 2801 Institute of Molecular Medicine, Section for Molecular Oncology, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120 Halle, Germany 7 grid.9018.0 0000 0001 0679 2801 Institute of Pathology, Section for Experimental Pathology, Medical Faculty, Martin Luther University Halle-Wittenberg, 06112 Halle, Germany 14 3 2023 14 3 2023 2023 22 50(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction: Mol Cancer 20, 88 (2021) Following publication of the original article , the authors would like to correct the sequence information for two RT-qPCR primers (MMP1 forward; LCK forward) listed in Table 1.Table 1 List of RT-qPCR primers used in this study target direction sequence (5' > 3') MMP1 forward CACGCCAGATTTGCCAAGAG MMP1 reverse TTGTCCCGATGATCTCCCCT MMP2 forward CCAAGTGGTCCGTGTGAAGT MMP2 reverse GCCGTACTTGCCATCCTTCT ITGB1 forward GGTTGCCCTCCAGATGACAT ITGB1 reverse AAATGTCTGTGGCTCCCCTG FN1 forward GAGCTGAGTGAGGAGGGAGA FN1 reverse CAGGCGCTGTTGTTTGTGAA ING4 forward AAAGGCCGGACTCAAAAGGA ING4 reverse CACATCAGAGGGGTGGACAC CDH1 forward CGGGAATGCAGTTGAGGATC CDH1 reverse AGGATGGTGTAAGCGATGGC CDH2 forward AAGTGGCAAGTGGCAGTAAAAT CDH2 reverse CCAGTCTCTCTTCTGCCTTTGT VIM forward ATGCGTGAAATGGAAGAGAACT VIM reverse TGTAGGTGGCAATCTCAATGTC LAPTM5 forward GCTACCTCAGGATCGCTGAC LAPTM5 reverse GGGAACTTGGAGGAGCTAGC LCK forward GATGGGGTACTACAACGGGC LCK reverse ATGTAGATGGGCTCCTGGGT SERPINB2 forward GGTGAGAAGTCTGCGAGCTT SERPINB2 reverse GACAGCATTCACCAGGACCA RPLP0 forward GGCGACCTGGAAGTCCAACT RPLP0 reverse CCATCAGCACCACAGCCTTC PPIA forward GTCAACCCCACCGTGTTCTT PPIA reverse CTGCTGTCTTTGGGACCTTGT POLR2A forward CTTGCCCCGTGCCATGCAGA POLR2A reverse CTCGCACCCGGCCTTCCTTG The primer sequences (5' > 3') currently read: MMP1 forward: TGTGAGGCGGTAGTAGGACA LCK forward: GACAGCATTCACCAGGACCA The primer sequences (5' > 3') should read: MMP1 forward: CACGCCAGATTTGCCAAGAG LCK forward: GATGGGGTACTACAACGGGC The correction does not have any effect on the results or conclusions of the article. The authors would like to apologize for these errors and any confusion that these might have caused. Julia Rosemann and Lisa Muller contributed equally to this work. Reference 1. Weisse J Rosemann J Muller L Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation Mol Cancer 2021 20 88 10.1186/s12943-021-01384-w 34116687 |
Orphanet J Rare Dis Orphanet J Rare Dis Orphanet Journal of Rare Diseases 1750-1172 BioMed Central London 2647 10.1186/s13023-023-02647-z Correction Correction : Long-term safety and clinical outcomes of olipudase alfa enzyme replacement therapy in pediatric patients with acid sphingomyelinase deficiency: two-year results Diaz George A. [email protected] 1 Giugliani Roberto 2 Gufon Nathalie 3 Jones Simon A. 4 Mengel Eugen 5 Scarpa Maurizio 6 Witters Peter 7 Yarramaneni Abhimanyu 8 Li Jing 8 Armstrong Nicole M. 9 Kim Yong 10 Ortemann-Renon Catherine 8 Kumar Monica 8 1 grid.59734.3c 0000 0001 0670 2351 Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, 1 Gustave L. Levy Place, New York, NY 10029 USA 2 Medical Genetics Service HCPA, Department of Genetics UFRGS, DASA and Casa Dos Raros, Porto Alegre, Brazil 3 grid.413852.9 0000 0001 2163 3825 Reference Centre of Inherited Metabolic Disease in Femme Mere Enfant Hospital, Hospices Civils of Lyon, Lyon, France 4 grid.416523.7 0000 0004 0641 2620 Manchester University National Health Service Trust, St Mary's Hospital, Manchester, UK 5 Institute of Clinical Science for Lysosomal Storage Disorders, SphinCS GmbH, Mainz, Germany 6 grid.411492.b University Hospital of Udine, Udine, Italy 7 grid.410569.f 0000 0004 0626 3338 University Hospitals Leuven, Louvain, Belgium 8 grid.417555.7 0000 0000 8814 392X Sanofi, Bridgewater, NJ USA 9 grid.417555.7 0000 0000 8814 392X Sanofi, Cambridge, MA USA 10 grid.417924.d Sanofi, Paris, France 14 3 2023 14 3 2023 2023 18 55(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmcCorrection : Orphanet Journal of Rare Diseases (2022) 17:437 Following publication of the original article , we have been notified that Fig. 1 was published incorrectly. Correct Fig. 1 should be as per below:Fig. 1 Patient disposition Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Reference 1. Diaz et al. Long-term safety and clinical outcomes of olipudase alfa enzyme replacement therapy in pediatric patients with acid sphingomyelinase deficiency: two-year results 2022;17:437. 10.1186/s13023-022-02587-0 |
Implement Sci Commun Implement Sci Commun Implementation Science Communications 2662-2211 BioMed Central London 416 10.1186/s43058-023-00416-4 Correction Correction: Preferences Elicited and Respected for Seriously Ill Veterans through Enhanced Decision-Making (PERSIVED): a protocol for an implementation study in the Veterans Health Administration Ersek Mary [email protected] [email protected] 12 Sales Anne [email protected] 34 Keddem Shimrit [email protected] 15 Ayele Roman [email protected] 67 Haverhals Leah M. [email protected] 67 Magid Kate H. [email protected] 6 Kononowech Jennifer [email protected] 4 Murray Andrew [email protected] 8 Carpenter Joan G. [email protected] 89 Foglia Mary Beth [email protected] 1011 Potter Lucinda [email protected] 10 McKenzie Jennifer [email protected] 12 Davis Darlene [email protected] 13 Levy Cari [email protected] 67 1 grid.410355.6 0000 0004 0420 350X Center for Health Equity and Promotion, Corporal Michael J. Crescenz VA Medical Center, 3900 Woodland Avenue, Annex Suite 203, Philadelphia, PA 19104 USA 2 grid.25879.31 0000 0004 1936 8972 University of Pennsylvania Schools of Nursing and Medicine, Philadelphia, PA USA 3 grid.134936.a 0000 0001 2162 3504 Sinclair School of Nursing and Department of Family and Community Medicine, University of Missouri, Columbia, MO USA 4 grid.413800.e 0000 0004 0419 7525 Center for Clinical Management Research, VA Ann Arbor Healthcare System, Ann Arbor, MI USA 5 grid.25879.31 0000 0004 1936 8972 Department of Family Medicine and Community Health, University of Pennsylvania Perelman School of Medicine, Philadelphia, USA 6 grid.422100.5 0000 0000 9751 469X Rocky Mountain Regional VA Medical Center, Aurora, CO USA 7 grid.430503.1 0000 0001 0703 675X University of Colorado Anschutz Medical Campus, Aurora, CO USA 8 grid.410355.6 0000 0004 0420 350X Corporal Michael J. Crescenz VA Medical Center, Philadelphia, PA USA 9 grid.411024.2 0000 0001 2175 4264 University of Maryland School of Nursing, Baltimore, MD USA 10 VA National Center for Ethics in Health Care, Washington, D.C USA 11 grid.34477.33 0000000122986657 Department of Bioethics and Humanities, School of Medicine, University of Washington, Seattle, WA USA 12 VA Purchased Long-Term Services and Supports, Geriatrics and Extended Care, Washington, D.C USA 13 Home-Based Primary Care Program, Office of Geriatrics and Extended Care, Washington, D.C USA 14 3 2023 14 3 2023 2023 4 26(c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. issue-copyright-statement(c) The Author(s) 2023 pmc Correction: Implement Sci Commun 3, 78 (2022) Following the publication of the original article the authors requested to update the "Competing interests" section as follows: "The authors declare that Anne Sales is co-Editor-in-Chief of the journal." Reference 1. Ersek M Preferences Elicited and Respected for Seriously Ill Veterans through Enhanced Decision-Making (PERSIVED): a protocol for an implementation study in the Veterans Health Administration Implement Sci Commun 2022 3 78 10.1186/s43058-022-00321-2 35859140 |
Crit Care Critical Care 1364-8535 1466-609X BioMed Central London 36915126 4358 10.1186/s13054-023-04358-0 Correspondence Only the new beginning of VAP quality control Ding Xin 1 Ma Xudong 2 Zhou Xiang [email protected] 13 1 grid.506261.6 0000 0001 0706 7839 Department of Critical Care Medicine, State Key Laboratory of Complex Severe and Rare Diseases, Peking Union Medical College Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, 100730 China 2 Department of Medical Administration, National Health Commission of the People's Republic of China, Beijing, 100044 China 3 grid.506261.6 0000 0001 0706 7839 Information Center Department, State Key Laboratory of Complex Severe and Rare Diseases, Peking Union Medical College Hospital, Peking Union Medical College & Chinese Academy of Medical Sciences, Beijing, 100730 China 13 3 2023 13 3 2023 2023 27 1077 2 2023 14 2 2023 (c) The Author(s) 2023 Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit The Creative Commons Public Domain Dedication waiver ) applies to the data made available in this article, unless otherwise stated in a credit line to the data. National High Level Hospital Clinical Research Funding2022-PUMCH-B-115 2022-PUMCH-B-115 Ding Xin Zhou Xiang CAMS Innovation Fund for Medical Sciences2021-I2M-1-062 Zhou Xiang National Key R&D Program of China, Ministry of Science and Technology of the People's Republic of China2021YFC2500801 Zhou Xiang Beijing Municipal Natural Science Foundation M21019 Zhou Xiang The 2020 CMB Open Competition ProgramNo. 20-381 Zhou Xiang issue-copyright-statement(c) The Author(s) 2023 pmcDear editor: We would like to thank to Dr Wang and colleagues for their interest and comments about our article . Before we respond to their comments, we have to explain that the data from the National Clinical Improvement System were uploaded by hospitals and were the descriptive data of the hospital profile rather than individual cases, which was mentioned as one of the limitations in our article . Therefore, the information of other factors such as ventilator days, age, gender, and comorbidities of every case were not included in the database. As the number of cases diagnosed and died of VAP among different hospitals were counting data, which were approximately following Poisson distribution, Poisson regression model was better to answer the questions such as what factors can influence the VAP incidence rate and mortality in this case. Regarding the first question about the ventilator days, it is the fact that patient transfer between hospitals is very common. As the VAP incidence rate is used as one of the ICU quality control indicators, it is defined as the number of cases diagnosing VAP divided by the ventilator days during the same period in the ICU. The ventilator days of the patients transferred from other hospital with endotracheal intubation before admission were calculated in the previous hospitals. The authors mentioned the heterogeneity of different specialized ICU and different hospital levels. First, as the data were collected by the China-National Critical Care Quality Control Center (China-NCCQC), although the ICUs in specialized hospitals such as Gynecologic and Obstetric hospital were included, specialized ICUs such as Respiratory ICU in general hospital were not included. As the doctors in specialized ICU received less training on nosocomial infection and were allocated with less resource, VAP incidence rate and mortality may be worse in these ICUs . Although it is generally believed that tertiary hospitals are usually more adequately staffed and equipped compared to secondary hospitals, which may lead to a lower rate of nosocomial infections, it is not the case at least for VAP . Considering the heterogeneity of development between different regions, the level of hospital may not be the unique standard to estimate the quality. For example, the ICUs in secondary hospitals from high GDP level area may be better than these in tertiary hospitals from low GDP level area. We are glad to find that our research can raise the attention on VAP in ICU specialists, and this study was only the beginning of the VAP quality control. New research based on individual cases is on the way, and we hope the results could bring us more satisfactory answers to all those questions. Acknowledgements Not applicable. Author contributions XD, XDM and XZ wrote the main manuscript text. All authors reviewed the manuscript. All authors read and approved the final manuscript. Funding This study is supported by National High Level Hospital Clinical Research Funding (2022-PUMCH-B-115), CAMS Innovation Fund for Medical Sciences (CIFMS) from Chinese Academy of Medical Sciences (2021-I2M-1-062); National Key R&D Program of China, Ministry of Science and Technology of the People's Republic of China (2021YFC2500801); Beijing Municipal Natural Science Foundation (M21019); The 2020 CMB Open Competition Program (No. 20-381). Availability of data and materials Not applicable. Declarations Ethical approval and consent for participants Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. References 1. Wang M Huang L Huang X Letter to the Editor regarding "Effect of ICU quality control indicators on VAP incidence rate and mortality: a retrospective study of 1267 hospitals in China" Crit Care 2023 27 1 30 10.1186/s13054-023-04324-w 36670460 2. Ding X Ma X Gao S Su L Shan G Hu Y Chen J Ma D Zhang F Zhu W Effect of ICU quality control indicators on VAP incidence rate and mortality: a retrospective study of 1267 hospitals in China Crit Care 2022 26 1 405 10.1186/s13054-022-04285-6 36581952 3. Liu YN Cao B Wang H Chen LA She DY Zhao TM Liang ZX Sun TY Li YM Tong ZH Adult hospital acquired pneumonia: a multicenter study on microbiology and clinical characteristics of patients from 9 Chinese cities Zhonghua Jie He He Hu Xi Za Zhi 2012 35 10 739 746 23289990 4. Li Z Ma X Gao S Li Q Luo H Sun J Du W Su L Wang L Zhang Q Association between hospital and ICU structural factors and patient outcomes in China: a secondary analysis of the National Clinical Improvement System Data in 2019 Crit Care 2022 26 1 24 10.1186/s13054-022-03892-7 35062981 |
Front Health Serv Front Health Serv Front. Health Serv. Frontiers in Health Services 2813-0146 Frontiers Media S.A. 10.3389/frhs.2023.1082261 Health Services Opinion Improving healthcare workforce diversity Zou Yang * Department of Medical Ethics and Health Policy, Perelman School of Medicine, University of Pennsylvania, Watkinsville, GA, United States Edited by: Andrea Cioffi, University of Foggia, Italy Reviewed by: Qian Luo, George Washington University, United States * Correspondence: Yang Zou [email protected] Specialty Section: This article was submitted to Health Policy and Management, a section of the journal Frontiers in Health Services 13 2 2023 2023 3 108226101 11 2022 12 1 2023 (c) 2023 Zou. 2023 Zou This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. diversity healthcare workforce patient care healthcare policies pmcThe world is increasingly becoming a global village, resulting in an increasingly diversified patient population. Ideally, given the ease of movement, patients seek healthcare outside their countries of origin. This has created an urgent need to develop a diversified workforce to cater to this changing demographic (1). By improving healthcare workforce diversity, stakeholders can offer a complete range of services and meet the needs of an increasingly diverse patient population. Various sources of diversity will need to be explored if a truly diverse workforce is to be developed. In a global environment, all stakeholders must share the responsibility for improving diversity within the healthcare workforce. Diversity and inclusion are two key features that are frequently mentioned in the delivery of quality healthcare services. Healthcare practitioners will nearly always play a role in addressing diversity issues, including cultural sensitivity and awareness within their service provision (2). Some of the sources of diversity they have to contend with include language, which is the most important factor when it comes to comprehending and communicating with the patient, then there is a culture which is a highly variable construct that can have a significant impact on healthcare experience, and these factors will affect the ability of the healthcare practitioner to deliver optimal care (3). Consequently, there is a need to develop a culturally competent workforce that can appreciate these differences and incorporate them during patient care. Other issues that emerge as a result of the increased diversity of patients in the healthcare setting include sexuality, faith claims, and gender identity. Sexuality affects the ability of the healthcare practitioner to deliver care sensitively, in addition to potentially hurting the patient's clinical care (4). Gender identity and sexuality are seen as significant issues that need to be addressed by healthcare practitioners as part of their role, which the experience of transsexual healthcare workers can evidence. Finally, an individual's faith and spirituality can sometimes impact how they accept and understand the illness, thus impacting their healthcare experience (4). Ultimately these factors play a crucial role in patient outcomes creating a need for a diverse workforce. The creation of Diversity in the Healthcare Workforce promotes the inclusion of all members of society to practice medicine and take ownership of their communities. Inclusion is one aspect that should be emphasized as it prepares the healthcare workforce for patients with diverse backgrounds (5). Improving healthcare workforce diversity will encourage providers to increase awareness of these issues and empower them with the necessary skills to respond holistically to the demands of an increasingly diversified patient population (5). Moreover, healthcare providers and their institutions must address the needs of the specific patient populations that are not being served and promote inclusion to create a more fulfilling relationship between them and their patients. Through this approach, the healthcare organization can improve patient outcomes through a holistic treatment approach. Various strategies have been developed and adopted to improve diversity within the healthcare industry. These strategies have, however, varied in their approach, scope, and effectiveness. Some of these strategies include sensitivity training for healthcare providers, a common strategy used to improve diversity in the healthcare workforce (1). The main aim of this strategy is to improve cultural sensitivity within the community by providing prospective healthcare providers with the knowledge and skills necessary to meet the needs of their diverse patients (5). This is achieved by increasing awareness on various issues such as race, ethnicity, sexual orientation, gender identity, and body stature, among several others. Orientation programs are also used to promote diversity in the healthcare workforce. These programs focus on individual development, which covers professional issues such as credentialing; there are also personal development skills that help a newcomer adapt to the new setting. Finally, policies and legislation that aim to eliminate discrimination and ensure that the healthcare system is inclusive of all people have been developed to encourage inclusion and diversity within the healthcare workforce. These policies. These remedies are, however, normative as such, are limited in their effectiveness. Some of the weaknesses of the proposed strategies include the fact that they are not culturally specific (4). Healthcare providers need to develop knowledge, awareness, and skills to respond to the needs of various clientele, which is limited in implementation. The strategies also lack a clear framework that should be adopted, which makes them challenging to implement (4). The diversity in the healthcare workforce should be approached cautiously by the healthcare industry as a whole since the creation of this initiative can lead to unintended negative impacts on their working practices (3). Finally, these measures are not easily adaptable to various situations that demand diversity within the healthcare sector. The local government in various jurisdictions should be held accountable for developing and adopting policies that will support diversity and inclusion within the various healthcare institutions under its care. Given the government's oversight role in the healthcare industry, it is better placed to support the creation of a diverse healthcare workforce that can deliver quality healthcare services to the community (1). Local governments should, however, be cognizant of certain considerations when creating appropriate policies that will ensure inclusion and diversity within the various healthcare institutions within their jurisdictions. Such considerations include the following: laws that prohibit healthcare discrimination; policies that promote an inclusive environment; and ensuring that senior providers and decision-makers in various institutions acknowledge the issue and respond to it. Overall, improving healthcare workforce diversity is not an easy endeavor for the healthcare industry. Many factors need to be considered and addressed to achieve this goal. Strategies developed by the healthcare sector should incorporate policy and legislative measures and culturally specific programs (1). Moreover, these policies should be in line with existing legislation since they directly impact the operation of these organizations, in addition to creating a sense of inclusion within the healthcare workforce. These policies' success depends on their mode of implementation and cultural diversity, so these strategies must be implemented effectively and consistently to avoid any negative impact on their working standards. These strategies should be re-evaluated and modified as necessary to ensure a successful result. Finally, the healthcare industry should be held accountable for the implementation of these strategies and be expected to demonstrate the necessary commitment to diversity in the workforce. Author contributions YZ is the primary and the only author who contributed to this article. All author contributed to the article and approved the submitted version. Conflict of interest The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Borkowski M Borkowski P . The role and tasks of the local government in the promotion of public health. Zeszyty Naukowe Gdanskiej Szkoly Wyzszej. (2018) 18 (1 ):9-16. 10.24426/zngsw.v18i1.15 2. Darker CD Nicolson GH Carroll A Barry JM . The barriers and facilitators to the implementation of National Clinical Programmes in Ireland: using the MRC framework for process evaluations. BMC Health Serv Res. (2018) 18 (1 ):1-10. 10.1186/s12913-018-3543-6 29291745 3. Petkovic J Riddle A Akl EA Khabsa J Lytvyn L Atwere P Protocol for developing guidance for stakeholder engagement in health and healthcare guideline development and implementation. Syst Rev. (2020) 9 (1 ):1-11. 10.1186/s13643-020-1272-5 31907078 4. Rotenstein LS Reede JY Jena AB . Addressing workforce diversity a quality-improvement framework. N Engl J Med. (2021) 384 (12 ):1083-6. 10.1056/NEJMp2032224 33764706 5. Stanford FC . The importance of diversity and inclusion in the healthcare workforce. J Natl Med Assoc. (2020) 112 (3 ):247-9. 10.1016/j.jnma.2020.03.014 32336480 |
Front Health Serv Front Health Serv Front. Health Serv. Frontiers in Health Services 2813-0146 Frontiers Media S.A. 10.3389/frhs.2022.1014393 Health Services Editorial Editorial: Women in health services: Health policy and management 2021 Ponzo Jacqueline 1 2 * van den Akker Marjan 3 4 5 1Departamento de Medicina Familiar y Comunitaria, Facultad de Medicina, Universidad de la Republica, Montevideo, Uruguay 2Escuela de Graduados, Facultad de Medicina, Universidad de la Republica., Montevideo, Uruguay 3Institute of General Practice, Faculty of Medicine, Goethe University Frankfurt, Frankfurt, Germany 4Academic Center for General Practice, Department of Public Health and Primary Care, KU Leuven, Leuven, Belgium 5Department of Family Medicine, Maastricht University, Maastricht, Netherlands Edited and reviewed by: Jose M. Martin-Moreno, University of Valencia, Spain *Correspondence: Jacqueline Ponzo [email protected] This article was submitted to Health Policy and Management, a section of the journal Frontiers in Health Services 09 9 2022 2022 2 101439308 8 2022 16 8 2022 Copyright (c) 2022 Ponzo and van den Akker. 2022 Ponzo and van den Akker This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Women in health services: Health policy and management 2021women health management & policy health service research development-innovation research pmcFaced with some of the articles in this edition of Frontiers on the topic "Women in Health Services: Health Policy and Management 2021," readers may wonder, where are the women? given that the research problem is not limited only to people of this gender in several of the included studies. If you look closely, you will find that women are on both sides of the investigation. They appear explicitly as a research subject in only one of the papers (Health-Related Challenges and Coping Strategies Among Women During Pandemics), but they are as researchers in all of them (Sahay et al.). This introduces us to a new necessary perspective of critical reading: the analysis of authors with a gender perspective. Although a large and increasing part of students at medical faculties are female, their roles as first, second and last authors are still lagging behind. A similar gender gap is visible in health research funding, resulting in a disproportionate part of young female professionals leaving the academic field. The collection of papers in this special issue facilitates women in their role of leading academics and as such support them as role models. A review of this selection shows that the femininity index in the set of 20 authors is 1.86. It is also interesting to note that in all cases the first author is a woman. Two of them are undergraduate medical students, two are doctoral students, and one is a researcher at a research center run by another woman. Is this important? Can research have a gender? What is important in solving problems is the incorporation of the diversity of views. Not only because it is a matter of rights and therefore it is necessary to ensure access to research and publication opportunities , but also because the place of the gaze changes what is seen. The hegemonic science that has dominated the field of health has not considered this aspect for many decades, as if reality were a neutral and "celibate" matter. But in the field of health as in any other, although perhaps more than others , nothing is neutral. It is not about assigning sex or gender to the investigation, but about integrating perspectives. The gender perspective is necessary, it enriches. This small collection of articles is proof of that. The issue that crosses these articles is the policy and management of health services. Within this, the dominant characteristic of the group is heterogeneity: the objects/subjects of study are diverse (a new quality indicator of the health system based on the general practitioners time available per patient per year, the relationship between burnout, workload in health professionals and the psychosocial safety climate, tools to improve communication with people with intellectual and developmental disabilities for equity in access to health, the lessons learned at the first level of care in the care of COVID-19 or coping strategies for women during this pandemic. The countries and areas where research was developed are also varied (the studies come from India, Switzerland, Benin, United Arab Emirates/United Kingdom and United States), although the first level of care and the community setting are repeated in almost all of them. Into this diversity, there is also homogeneity. Research problems are, in all cases, peculiar in the sense that they are "small," silent, "interstitial." Perhaps that is where the gender perspective is most noticeable, women and health services, women looking at and investigating health services, the deep look, capable of investigating "small" things, those typical of social reproduction, those that are usually devoid of value in the market, but so necessary for life, as well as for health. Another characteristic by omission worth noting: the absence of Latin American studies. This regional quota is provide in this topic by one of the editors also the author of this editorial, but it is noteworthy that this advance in the visibility of the academic production of women, of their research on "interstitial" issues, of their work in community scenarios, emerging, often marginal to health systems, which occurs in many parts of the planet and this topic shows it , still does not cover Latin America in the same way. The language surely influences, although it is probably not the only thing. The proposal remains as a concern, to invite reflection, which allows us to continue advancing. Meanwhile, it is worth pausing to observe some of the contributions made by these works. In General Practitioner Time Availability Per Inhabitant Per Year: A New Indicator to Measure Access to Primary Care (led by student Beer et al.), the proposed indicator is as simple as it is powerful. It synthesizes with simple and easily accessible data, aspects of structure and process of the health system. How much time can a GP devote to each person each year? A simple twist in the use of data generates a measure that allows the complexity of the system to be summarized and the center to be relocated to an issue that matters: the encounter, the listening. Barbara Starfield provided extensive evidence to document the benefits of a health system based on primary health care (1). Her "Primary Care Assessment Tool" (PCAT) remains current and is being updated to better assess health services (2). The proposed new indicator may be complementary to the powerful tool developed by Starfield. "Lessons Learnt From the Experiences of Primary Care Physicians Facing COVID-19 in Benin" studied the working climate in primary health care in Benin, during the first year of the COVID-19 pandemic and reported high levels of stress and anxiety, as well as feelings of lacking training and coordination (Bello et al.). The insufficiencies found were not necessarily new ones, but became more prominent during the COVID-19 crisis. The systematic review (qualitative studies) "Health-Related Challenges and Coping Strategies Among Women During Pandemics" takes a broader look: how the COVID-19 pandemic (and other pandemics) influence health-related challenges in female patients and female health care workers (Sahay et al.). Also here, we see the sharp increase in stress and anxiety, avoidance of reproductive care. At the same time women show high levels of resilience and adaptive capacities. For the continuity and quality of care, this is hopeful, since 70% of healthcare workers are female. "Psychosocial Safety Climate Moderates the Effect of Demands of Hospital Accreditation on Healthcare Professionals" is an interesting study that explores job demands and resources and burnout/work engagement during hospital accreditation (Alshamsi et al.). This management process was found associated with the effects in health workers. More research is needed in this field. The information transfer between patients, their caregivers, and their healthcare providers is associated with the disparities in health. The persons with intellectual and developmental disabilities (IDD) live 20 fewer years than the average person. "Roadmap for Creating Effective Communication Tools to Improve Health Equity for Persons With Intellectual and Developmental Disabilities" studies this problem and some tools developed for improving it (Dharampuriya and Abend). We hope these publications will inspire you, for further research, policy and care with and for women, men and gender differences all over the world. Author contributions JP developed the first draft. MvdA reviewed it, approved, and added her view in several paragraphs. Both commented the articles of the topic and added reflections about the role of the women in the health services and in research. Both reviewed the final version and agreed. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Starfield B Shi L Macinko J . Contribution of primary care to health systems and health. Milbank Q. (2005) 83 :457-502. 10.1111/j.1468-0009.2005.00409.x 16202000 2. Pinto LF Silva VSTM . Primary care assessment TOOL (PCAT): developing a new baseline for evaluating Brazilian health services. Cien Saude Colet. (2021) 26 :651-6. 10.1590/1413-81232021262.42552020 33605341 |
Front Health Serv Front Health Serv Front. Health Serv. Frontiers in Health Services 2813-0146 Frontiers Media S.A. 10.3389/frhs.2022.1054214 Health Services Editorial Editorial: Women in health services: Mental health services 2022 Cabieses Baltica 1 * Cheng Chiachen 2 Obach Alexandra 1 1Programa de Estudios Sociales en Salud, Instituto de Ciencias e Innovacion en Medicina (ICM), Facultad de Medicina Clinica Alemana, Universidad del Desarrollo, Santiago, Chile 2Division of Clinical Sciences, Section of Psychiatry, Northern Ontario School of Medicine University, Thunder Bay, ON, Canada Edited and reviewed by: Carolyn Dewa, University of California, Davis, United States *Correspondence: Baltica Cabieses [email protected] This article was submitted to Mental Health Services, a section of the journal Frontiers in Health Services 29 11 2022 2022 2 105421426 9 2022 10 11 2022 Copyright (c) 2022 Cabieses, Cheng and Obach. 2022 Cabieses, Cheng and Obach This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Women in health services: Mental health services 2022mental health women services research health services pmcAs editors of this Research Topic, we are very pleased to present four high-quality manuscripts to showcase the extraordinary work of women researchers around the world who contribute knowledge in mental health systems research. This Research Topic has two goals: firstly, to produce an issue in which those researchers who identify as women might present their work, with focus on early career researchers, and secondly to celebrate research about mental health services. Promoting women in academia and research is a global challenge. The full potential of women creativity, flexibility and unique contributions are often not realized because women more often than men leave their research careers. Reasons are multiple and complex, yet gender inequities in science continues to exist (1). While progress has been, and continues to be made, in reducing gender inequality in research and academia, change may come about slowly and is subject to significant variation according to country, research field and other factors (1-3). According to the UNESCO Institute of Statistics (UIS) data, less than 30% of the world's researchers are women. Other studies have found that women in STEM fields publish less, are paid less for doing research, and are not promoted as often in their careers compared to men (4). Informed by these gaps, we chose to highlight research conducted by women. We hope to open windows of opportunity that may otherwise not exist for their important work. The global incidence and severity of mental health disorders has been established, as well as knowledge about pervasively insufficient mental health services available to people who need these services. According to the Global Burden of Disease Study 2010, the economic burden associated with mental disorders exceed those associated with each of four other major categories of noncommunicable disease: diabetes, cardiovascular diseases, chronic respiratory disease, and cancer (5). Major depressive disorder was the second leading cause of years lost to disability (YLD) globally and ranked among the four largest contributors to YLDs in each of the socially diverse regions spanning six continents (6). Anxiety disorders, drug-use disorders, alcohol-use disorders, schizophrenia, bipolar disorders, and persistent depressive disorders also ranked the 20 conditions contributing to the largest global share of YLDs. In the latest Global Burden of Disease Study, this trend continues along with musculoskeletal problems, and cardiovascular diseases (7). Despite this compelling evidence, mental health services are not meeting the clinical quality and quantity of service needs required in every country and region. In all, advances in efforts to alleviate the human and social costs of mental disorders have been both too slow and too few (8). The paper by Stewart et al. was completed in Canada and focused on the well-being of caregivers of children and youth. The well-being of caregivers has significant implications for healthy development in children and youth. Although caregiver distress is typical, it can become problematic if caregivers have difficulty identifying and responding to their child's needs. Hence, the purpose of this study was to develop and validate an algorithm for identifying caregivers who are at the greatest risk of experiencing distress. Study results indicated that nearly half of the caregivers who were experiencing distress at baseline continued to experience distress at time two. Further, 13.4% of caregivers who were not experiencing distress at the beginning of the study, were indeed experiencing distress at the follow up assessment. This paper addresses a key public health matter that impacts caregivers, children, and youth. With focus on pediatric chronic pain and resilience, the study by Young et al. was also conducted in Canada. The authors identified risk factors for chronic pain and exploration of how young people negotiate such risk and express resilience. They hypothesized that children and youth with chronic pain would report greater prevalence of mental health disorders than the general population; those demonstrating greater resilience would have less psychiatric comorbidity. They found that female sex, family history, and lower socioeconomic status were associated with chronic pain. Also, psychiatric conditions were more prevalent in chronic pain patients than in the general population. In all, this innovative original paper addresses the need to approach chronic pain from a more holistic mind-body perspective. More research is required to improve quality of health services in this complex global issue. The manuscript by Singh et al. was an original evaluation based in United States (US). Their study assessed the development and implementation of guidelines proposed by a task force for best practices in delivering Measurement-Based Care (MBC) in Post-Traumatic Stress Disorder (PTSD). Based on the Strategic Action Field Framework for policy implementation research, they found that major barriers to implementation included, the difficulty to establish bottom-up processes, inability to reach the entire field, and limited diversity in the workgroup. Facilitators for guideline implementation included using consensus to make decisions, support provided to workgroup members by national operations partners, and collaboration and mutual respect among workgroup members. This original implementation science study suggests that a hybrid model of implementation in current complex and pandemic contexts provides a process through which frontline workers can inform policy development and implementation. Finally, the aim of the study conducted by Kristjanson et al. in Canada, was to understand the experiences of perinatal women randomized to the waitlist condition of a randomized controlled trial. This relevant, original study recognizes that pregnant and postpartum women are at a heightened risk for the development or worsening of mental health problems, especially mood and anxiety disorders. In this sense, timely access to mental health support is critical during the perinatal period (spanning pregnancy to 1-year post-partum) to mitigate potential negative impacts on mother and child. As the authors hypothesized, they found the need for timely access to mental health supports during the perinatal period. They offered several recommendations including providing more frequent waitlist status updates, providing more direct access to intermediate interventions, and triaging patients based on clinical need. Research has found in general adult populations, the association between being waitlisted for mental health services with deterioration in mental health. Hence the relevance of this study is substantial as it sheds a new light to this field and challenges health service delivery for perinatal care. To conclude, it was our honor to be editors of this Research Topic on women researchers in health and mental health services research. We hope readers will enjoy these four selected studies that Frontiers in Health Services have published. Our goal was to be innovative in the way in which women health researchers and mental health services research are understood and interpreted today. This Research Topic exemplifies more holistic and complex approach to ongoing research. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. League of European Research Universities (LERU). Women, Research and Universities: Excellence Without Gender Bias. LERU Gender Working Group (2012). Available online at: (accessed September 25, 2022). 2. McKinsey & Company. The Power of Parity: Advancing Women's Equality in Africa. McKinsey Global Institute (MGI) (2019). Available online at: /media/mckinsey/featured%20insights/gender%20equality/the%20power%20of%20parity%20advancing%20womens%20equality%20in%20africa/mgi-the-power-of-parity%20advancing%20womens%20equality%20in%20africa.pdf (accessed September 25, 2022). 3. European Commission Directorate-General for Research Innovation. She Figures 2021: Gender in Research and Innovation: Statistics and Indicators. (2021). Available online at: (accessed September 25, 2022). 4. Unesco Institute for Statistics, UIS. Women in Science. (2019). Available online at: (accessed September 25, 2022). 5. Bloom DE Cafiero ET Jane-Llopis E . The Global Economic Burden of Non-Communicable Diseases. Geneva: World Economic Forum (2011). Available online at: (accessed September 25, 2022). 6. Vos T Flaxman AD Naghavi M Lozano R Michaud C Ezzati M . Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990-2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet. (2012) 380 :2163-96. 10.1016/S0140-6736(12)61729-2 23245607 7. GBD 2019 Viewpoint Collaborators . Five insights from the global burden of disease study 2019. Lancet. (2020). 396 :1135-59. 10.1016/S0140-6736(20)31404-5 33069324 8. Becker A Kleinman A . Mental health and the global agenda. N Engl J Med. (2013) 369 :66-73. 10.1056/NEJMra1110827 23822778 |
Front Health Serv Front Health Serv Front. Health Serv. Frontiers in Health Services 2813-0146 Frontiers Media S.A. 10.3389/frhs.2022.964489 Health Services General Commentary Commentary: Bridging the silos: A comparative analysis of Implementation Science and Improvement Science Vackerberg Nicoline 1 2 Andersson Ann-Christine 1 3 * 1Jonkoping Academy for Improvement of Health and Welfare, School of Health and Welfare, Jonkoping University, Jonkoping, Sweden 2Qulturum, Center for Learning and Innovation in Healthcare, Jonkoping, Sweden 3Department of Care Science, Faculty of Health and Society, Malmo University, Malmo, Sweden Edited by: Ann Catrine Eldh, Linkoping University, Sweden Reviewed by: Danielle D'Lima, University College London, United Kingdom; Lisa Hirschhorn, Northwestern University, United States *Correspondence: Ann-Christine Andersson [email protected] This article was submitted to Implementation Science, a section of the journal Frontiers in Health Services 21 9 2022 2022 2 96448908 6 2022 31 8 2022 Copyright (c) 2022 Vackerberg and Andersson. 2022 Vackerberg and Andersson This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A Commentary on Bridging the silos: A comparative analysis of Implementation Science and Improvement Science Nilsen, P., Thor, J., Bender, M., Leeman, J., Andersson-Gare, B., and Sevdalis. N. (2022). Front. Health Serv. 1:817750. doi: 10.3389/frhs.2021.817750 Improvement Science Implementation Science quality improvement pragmatism positivism pmcThe commented paper offers a comparative analysis of Implementation Science and Improvement Science, aiming to identify if these fields could benefit from and enrich each other. The method used is a systematic literature review. In this article, the authors recognize that both fields have different origins and draw on different bodies of knowledge, however they claim that both Implementation Science and Improvement Science can be positioned within a positivistic tradition with some interpretive features. We challenge this claim, as positivism has ties to natural science and works within a very standardized context (1, 2), an objective methodology seeking to discern what is true or false. Implementation Science can probably be defined as partly positivistic, aiming at introducing evidence-based practice, which in turn is dependent on positivistic studies, verifying a hypothesis using experimental designs (2), mainly RCT. Implementation Science is trying to understand and explain the conditions for implementation, relying on existing theories or developing new ones from evidence-based facts. Improvement Science, on the other hand, examines whether quality improvement in health and welfare settings results in better clinical practice, patient, and population outcomes (3), with a focus on usefulness. Improvement Science attempts to develop and test program theories that can improve the understanding of assumptions and increasing awareness of what is done and why (4). Therefore, Improvement Science is more aligned to pragmatism, where the focus is not just on producing knowledge but on trying to adapt and transform knowledge in different contexts to make clinical practice better, to achieve usefulness. We argue that it is important to view the distinction between the somewhat more positivistic Implementation Science and the truly pragmatic Improvement Science due to methodological issues. Evidence of QI benefits is sometimes criticized for lack of rigor (3) and not being based in RCT methodology. To gain an understanding of what value Improvement Research contributes, it must be seen from a pragmatic lens. We argue that Improvement Science therefore demonstrates a more a pragmatic than positivistic view, focusing on what works for whom, where, and when (5). One can also argue that there are elements of a social constructivist view in both Implementation and Improvement Research. Trying out better ways of working, new routines, and implementing them, are constructions by persons in the system, and require structured methods to evaluate the outcome. In both fields, context is influencing the result, which also challenges the positivistic positioning of the authors, since natural science tries to eliminate any circumstances that could bias the studies. Another challenge to the authors' stance is that theories in Implementation and Improvement Sciences are developed from a range of research fields like psychology, nursing, organizational behavior, and sociology. These fields focus on objective facts while taking human factors, like change psychology, into account and relate much more to social constructivism and pragmatism than to positivism. There are similarities between positivism and pragmatism, but also large differences. An important difference, as we interpret it, is the origin of knowledge (ontology and epistemology). In the positivistic tradition, there is a strong belief in what is right or true (1, 2). This belief resonates more with Implementation Science, wanting to implement the already known most evidence-based way of doing things. Improvement Science, on the other hand, relies more on describing what works for whom, where and when (5), even if that description is not taken to be the truth at least not an overarching truth everywhere. This focus also implies that Improvement Research needs more interactive research approaches (6) to contribute to immediate usefulness in practice, which also corresponds more to a pragmatic view. In light of the discussion above, we are wondering why the authors position themselves in the tradition of positivism. Could it be that there still is a believe that positivism is highly "ranked" in the medical world, where improvement and implementation will contribute? If so, we think that improvement and implementation researchers need to do even more research to show that the pragmatic usefulness is important when improving quality and patient safety in health and welfare (3). We believe the commented paper adds some interesting comparisons and reflections about the connection between Implementation and Improvement Science, but think it is unhelpful to position them in the positivistic natural science tradition. Instead, these two research areas need to be understood in their complexity and their value tied to their ability to combine evidence-based facts with change management and behavioral theories. It requires an openness concerning contextual, cultural, and individual details and variation. Therefore, we argue that Implementation Science and especially Improvement Science are better positioned in the pragmatic tradition, where focus is not just to produce knowledge but trying to explain the usefulness of knowledge in different contexts in order to improve practice and outcomes. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Ladyman J . Understanding Philosophy of Science: London; New York, NY: Routledge (2002). 2. Park YS Konge L Artino AR Jr . The positivism paradigm of research. Acad Med. (2020) 95 :690-4. 10.1097/ACM.0000000000003093 31789841 3. Dixon-Woods M . How to improve healthcare improvement an essay. BMJ. (2019) 366 :I5514. 10.1136/bmj.l5514 31575526 4. Davidoff F Dixon-Woods M Leviton L Michie S . Demystifying theory and its use in improvement. BMJ Qual Safe. (2015) 2015 :1-11. 10.1136/bmjqs-2014-003627 25616279 5. Walshe K . Understanding what works-and why-in quality improvement: the need for theory-driven evaluation. Int J Qual Health Care. (2007) 19 :57-9. 10.1093/intqhc/mzm004 17337518 6. Ellstrom P-E Elg M Wallo A Berglund M Kock H . Interactive research: concepts, contributions and challenges. J Manufact Technol Manag. (2020) 2020 :1741-038X. 10.1108/JMTM-09-2018-0304 |
Front Health Serv Front Health Serv Front. Health Serv. Frontiers in Health Services 2813-0146 Frontiers Media S.A. 10.3389/frhs.2023.1154164 Health Services Editorial Editorial: Supporting the pandemic response? Implementation science in the time of COVID-19 Sevdalis Nick 1 * Davis Rachel 1 Rabin Borsika Adrienn 2 3 Stadnick Nicole A. 2 4 5 1 Centre for Implementation Science, King's College London, London, United Kingdom 2 Altman Clinical and Translational Research Institute Dissemination and Implementation Science Center, University of California San Diego, La Jolla, CA, United States 3 Herbert Wertheim School of Public Health and Longevity Science, University of California San Diego, La Jolla, CA, United States 4 Department of Psychiatry, University of California San Diego, La Jolla, CA, United States 5 Child and Adolescent Services Research Center, San Diego, CA, United States Edited and Reviewed by: Jose M. Valderas, National University of Singapore, Singapore * Correspondence: Nick Sevdalis [email protected] Specialty Section: This article was submitted to Implementation Science, a section of the journal Frontiers in Health Services 23 2 2023 2023 23 2 2023 3 115416430 1 2023 03 2 2023 (c) 2023 Sevdalis, Davis, Rabin and Stadnick. 2023 Sevdalis, Davis, Rabin and Stadnick This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. pandemic (COVID19) implementation research implementation science (MeSH) implementation theory implementation practice Wellcome Trust219425/Z/19/Z, R01MD017222, U01MD018308 National Institutes of HealthR34MH120190, R01MD017222, U01MD018308 NIHRUniversity of California San DiegoNS' research is supported by the National Institute for Health Research (NIHR) Applied Research Collaboration (ARC) South London at King's College Hospital NHS Foundation Trust. NS is a member of King's Improvement Science, which offers co-funding to the NIHR ARC South London and is funded by King's Health Partners (Guy's and St Thomas' NHS Foundation Trust, King's College Hospital NHS Foundation Trust, King's College London and South London and Maudsley NHS Foundation Trust), and Guy's and St Thomas' Foundation. RD's research is supported by the Wellcome Trust (219425/Z/19/Z). BAR's research is supported by the National Institutes of Health grants R01MD017222 and U01MD018308 and the University of California San Diego ACTRI Dissemination and Implementation Science Center. NAS' research is supported by the National Institutes of Health grants R34MH120190, R01MD017222, U01MD018308, and the University of California San Diego ACTRI Dissemination and Implementation Science Center. pmcEditorial on the Research Topic Supporting the pandemic response? Implementation science in the time of COVID-19 In 2021, we initiated a call for papers for a Frontiers in Health Services Research Topic entitled "Supporting the Pandemic Response? Implementation Science in the Time of COVID-19". The Research Topic was launched in collaboration with the 4th Annual UK Implementation Science Research Conference, organised by the National Institute for Health Research Applied Research Collaboration, South London and hosted by King's College London. The call was open to papers presented at this conference as well as submissions from individuals who did not attend the conference but were undertaking relevant research. Building upon the conference theme, the Research Topic aimed to showcase implementation research that directly informed the response of health systems globally to the COVID-19 pandemic. The Research Topic further aimed to include research and evaluation work that is more broadly relevant. For example, research supporting long-term changes in clinical practice or public health policy that the pandemic sparked. Another example is the implementation of remote working and consultations across healthcare services. The impact of COVID-19 on individuals, healthcare, healthcare systems and societies remain far-reaching, worldwide. Implementation science as a field has much to offer in helping to understand some of the challenges that we face now and will continue to face in the future because of the pandemic. We envisaged that the Research Topic would facilitate the emergence of an understanding within our field of what we can to do to help overcome both long-standing challenges and inequalities in care delivery - some of which were exacerbated during the pandemic. We also sought to understand and address fresh problems that also capitalize on opportunities for potential innovation at scale that the pandemic triggered. Our intention was to be self-critical of the science - asking not only how implementation science has helped the pandemic response, but also how it may have done more, what it may have done differently and what lessons can we take from this in developing the field in the future. Here, we provide an overview of the papers included in the Research Topic. Each one of these, in a different manner, documents how implementation science has been used to address the needs and priorities created by the COVID-19 pandemic. The seven accepted manuscripts included five Original Research articles, one Brief Research Report, and one Perspective piece. These manuscripts reported on implementation efforts in response to the COVID-19 pandemic using a breadth of qualitative, quantitative, and mixed methods approaches within the United Kingdom, United States, Sweden, and South Africa. Two papers focused on community engagement. Stadnick et al. described a pragmatic and replicable method for documenting resources for community engagement activities in health equity implementation research. Casillas et al. used mixed methods to summarize activities, initial impacts, and generalizable insights from the Share, Trust, Organize, Partner COVID-19 California Alliance (STOP COVID-19 CA), a network of 11 universities and community partners across the state of California. Several papers offered a focus on different care pathways impacted by the pandemic and how services adapted to address the pandemic challenge. Roman et al. used a cross-sectional survey design to understand determinants of implementing remote sign language interpreting across US-based service sectors during the pandemic. Duby et al. characterized the extent to which the COVID-19 pandemic impacted implementation of an HIV, sexual, and reproductive health intervention for adolescent girls and young women in South Africa, with a specific focus on the adaptive strategies implementers employed to mitigate the pandemic effects. Pestoff et al. reported initial patient and provider implementation outcomes of telegenetic counseling in a regional Swedish healthcare system, in response to the COVID-19 pandemic limiting in-person healthcare service delivery. Lastly, some papers focused on innovation efforts in supporting the pandemic response. Conceptually driven by an existing framework and with the motivation to support vaccination programme delivery, Pilar et al. convened a global COVID-19 implementation workgroup. The group critically applied the Implementation Outcomes Framework [Proctor et al. 2011 (1)] and reviewed implementation strategies to promote global COVID-19 vaccine implementation. Ziemann et al. examined the rapid approaches to implementing innovations of Academic Health Science Networks (AHSNs) in the English National Health System in response to the COVID-19 pandemic. AHSNs are essentially vehicles for spread and adoption of innovation, hence well-placed to respond rapidly to the fresh needs that the pandemic brought to the fore. The qualitative case study design applied in this study allowed interesting case-comparisons for managing the innovation process. As of the writing of this editorial, across the seven accepted papers there were over 11,000 views and over 750 downloads. Visitors/readers were from North America, Europe, Asia, Australia, Africa, and South America (in decreasing order of numbers). The Research Topic offers a collection of global case studies of pandemic-driven impacts and also innovations - in doing so, we feel that it highlights the breadth of early implementation research that was triggered by COVID-19. The included papers cover several countries and care pathways; have applied a range of different conceptual and methodological approaches to the study of implementation processes; and have offered perspectives ranging from micro (i.e., focused on individual providers) to macro (i.e., focused on entire states or countries). As more implementation studies appear in the literature motivated by the ongoing impacts of the COVID-19 pandemic, we would call upon our colleagues to report on the sustainability and spread of pandemic-driven innovations, both where they were originally implemented and beyond; and to consider and analyse the factors and strategies that are associated with success or failure of such innovations in the longer-term. Reporting on naturally occurring experiments during the pandemic and to-date may offer a fruitful and cost-effective approach to study design that generates learning and hypotheses for further controlled investigations - thereby driving the field forward. Author contributions All authors contributed equally to the conceptualisation, drafting and critical review of the editorial article. All authors contributed to the article and approved the submitted version. Conflict of interest NS is the director of the London Safety and Training Solutions Ltd., which offers training in patient safety, implementation solutions and human factors to healthcare organisations and the pharmaceutical industry. The other authors have no conflicts of interest to declare. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Reference 1. Proctor E Silmere H Raghavan R Hovmand P Aarons G Bunger A Outcomes for implementation research: conceptual distinctions, measurement challenges, and research agenda. Adm Policy Ment Health. (2011) 38 :65-76. 10.1007/s10488-010-0319-7 20957426 |
Front Netw Physiol Front Netw Physiol Front. Netw. Physiol. Frontiers in Network Physiology 2674-0109 Frontiers Media S.A. 1076702 10.3389/fnetp.2022.1076702 Network Physiology Editorial Editorial: Coupling in biological systems: Definitions, mechanisms, and implications Schmal et al. 10.3389/fnetp.2022.1076702 Schmal Christoph 1 * Hong Sungho 2 Tokuda Isao T. 3 Myung Jihwan 4 5 * 1 Institute for Theoretical Biology, Humboldt University, Berlin, Germany 2 Computational Neuroscience Unit, Okinawa Institute of Science and Technology, Okinawa, Japan 3 Department of Mechanical Engineering, Ritsumeikan University, Shiga, Japan 4 Graduate Institute of Mind, Brain and Consciousness (GIMBC), Taipei Medical University, Taipei, Taiwan 5 Brain and Consciousness Research Centre (BCRC), TMU-Shuang Ho Hospital, New Taipei City, Taiwan Edited and reviewed by: Plamen Ch. Ivanov, Boston University, United States *Correspondence: Christoph Schmal, [email protected]; Jihwan Myung, [email protected] This article was submitted to Systems Interactions and Organ Networks, a section of the journal Frontiers in Network Physiology 13 12 2022 2022 2 107670221 10 2022 30 11 2022 Copyright (c) 2022 Schmal, Hong, Tokuda and Myung. 2022 Schmal, Hong, Tokuda and Myung This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Coupling in biological systems: Definitions, mechanisms, and implications circadian clock coupling biological network entrainment zeitgeber suprachiasmatic nucleus (SCN) CS acknowledges support from the Deutsche Forschungsgemeinschaft (DFG) through grant SCHM3362/2-1 Project-ID 414704559. JM is financially supported by the Higher Education Sprout Project by the Ministry of Education (MOE) and in part by National Science and Technology Council (NSTC) in Taiwan under grants 110-2311-B-038-003, 110-2314-B-038-162, and 111-2314-B-038-008. pmcBiological systems exhibit an enormous complexity. Their temporal evolution ubiquitously depends on non-linear interactions between non-identical, heterogeneous entities such as molecules, cells, tissues, organs, or organisms. As a result, the observed dynamics at the ensemble level show emergent phenomena that can only occur at the macroscopic scale and cannot be understood solely from the intrinsic behavior of its individual constituents, limiting the success of traditional reductionist approaches (Wolkenhauer and Green, 2013). The entities involved can exist in different positions of space and time and may span across various scales. The process of interaction or information exchange between two or more entities in a given physical, biological or chemical system is often referred to as "coupling". Using mathematical parlance, the dynamical evolution of a given part in a coupled system depends on the present or former state of other parts in the overall system. In multicellular systems of neurons, the emergent dynamics is the neural network computation , governed by schemes of synaptic coupling (i.e., connectome). Likewise, the macroscopic output of physiology is a result of multi-organ coupling throughout the body . At the organismic level, coupling between the environment and the body enables adaptation . On the lowest end of the biological hierarchy, coupling among molecular components creates feedback networks within a single cell . FIGURE 1 Multiscale organization of circadian clock networks. Circadian clocks exist in all scales of biology, and so does the coupling among them. The scale spans from the whole organism (far left) to molecules within a single cell (bottom right). In this Research Topic, we are particularly interested in coupled biological oscillators, i.e., systems composed of constituents that show rhythmically recurring patterns. Circadian oscillation is a ubiquitous biological phenomenon well suited for studying coupling across spatiotemporal scales. These self-sustained rhythms, with a period of approximately 1 day, are maintained in neuronal and non-neuronal systems at both cellular and organ levels. An organism's circadian rhythm must synchronize with the daily cycle most strongly defined by ambient light (called Zeitgeber, or "time-giver"). This uni-directional coupling between a Zeitgeber and a forced pacemaker is the simplest form of coupling, yet it can yield an astonishing variety of dynamical phenomena (Heltberg et al., 2021), in particular in response to seasonal variations of day length and luminosity (Schmal et al., 2020; Burt et al., 2021). Healy et al. extend the concept of Zeitgeber to include non-photic cues such as sleep, feeding-fasting cycles, or physical activity. A host of molecular pathways are suggested, which can independently and/or synergistically entrain the clock through different molecular components such as PER1/2, CRY1/2, BMAL1/CLOCK, and DBP. Grabe et al. mathematically explore this in a two-oscillator system simultaneously entrained by photic and non-photic Zeitgebers. The molecular circadian clock network is composed of two main loops of transcriptional-translational feedback: One centers on transcriptional regulation of E-box (controls, notably, Per/Cry) and the other on RRE (drives transcription of Bmal1) elements. Mammals have a central circadian clock that resides in the hypothalamic suprachiasmatic nucleus (SCN), which receives light signals directly from the retina. Using an evolutionary game theoretic framework, Spencer et al. seek for coupling topologies of the SCN that sustain circadian synchronization at minimal "cost". The evolutionary mechanism can drive the SCN network to adopt sparse coupling against the metabolically expensive all-to-all coupling. Gu et al. consider the heterogeneous structure of the SCN network that can be divided into a dorsomedial (DM; shell) and a ventrolateral (VL; core) subregion. The authors suggest the possibility that the sparse network of the SCN can attain synchronization through small-world/scale-free coupling. The brain contains several circadian clock loci outside the SCN. Chrobok et al. discuss coupling in one stream of these clocks along the subcortical visual system (SVS). The SVS exhibits various timescales of neural firing, and circadian coupling is thought to enable multiplexing different frequency bands. The circadian system provides an ideal context to study coupling in biological systems, which maintain oscillations in various scales of space and time. Although coupling is often a conceptualization of indirect interactions that simplifies a series of underlying processes, its consequence can be directly explored through mathematical modeling to produce experimentally testable predictions. Mathematical modeling can also provide a platform to classify the strength, directionality, and polarity of coupling in a wide range of spatiotemporal dynamics of biology while being neutral to exact details. We thank Anna-Marie Finger for the initial arrangements of the Research Topic. Author contributions CS and JM drafted the manuscript. CS created the figure and JM revised it. All authors reviewed and agreed on the manuscript. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Burt P. Grabe S. Madeti C. Upadhyay A. Merrow M. Roenneberg T. (2021). Principles underlying the complex dynamics of temperature entrainment by a circadian clock. iScience 24 (11 ), 103370. 10.1016/j.isci.2021.103370 34816105 Heltberg M. L. Krishna S. Kadanoff L. P. Jensen M. H. (2021). A tale of two rhythms: locked clocks and chaos in biology. Cell Syst. 12 (4 ), 291-303. 10.1016/j.cels.2021.03.003 33887201 Schmal C. Herzel H. Myung J. (2020). Clocks in the wild: entrainment to natural light. Front. Physiol. 11 , 272. 10.3389/fphys.2020.00272 32300307 Wolkenhauer O. Green S. (2013). The search for organizing principles as a cure against reductionism in systems medicine. FEBS J. 280 , 5938-5948. 10.1111/febs.12311 23621685 |
Front Netw Physiol Front Netw Physiol Front. Netw. Physiol. Frontiers in Network Physiology 2674-0109 Frontiers Media S.A. 1038239 10.3389/fnetp.2022.1038239 Network Physiology Editorial Editorial: Advancing our understanding of the impact of dynamics at different spatiotemporal scales and structure on brain synchronous activity Manos et al. 10.3389/fnetp.2022.1038239 Manos Thanos 1 2 * Antonopoulos Chris G. 3 Batista Antonio M. 4 5 6 Iarosz Kelly C. 6 7 8 1 Laboratoire de Physique Theorique et Modelisation, CY Cergy Paris Universite, CNRS, Cergy-Pontoise, France 2 Equipes Traitement de l'Information et Systemes (ETIS), CNRS, Cergy Paris Universite, Cergy-Pontoise, France 3 Department of Mathematical Sciences, University of Essex, Colchester, United Kingdom 4 Department of Mathematics and Statistics, State University of Ponta Grossa, Ponta Grossa, Brazil 5 Science Graduated Program, State University of Ponta Grossa, Ponta Grossa, Brazil 6 Oscilations Control Group, Institute of Physics - University of Sao Paulo, University City, Sao Paulo, Brazil 7 Exact Sciences, Natural and Engineering, University Center FATEB, Sao Paulo, Brazil 8 Chemical Engineering Graduate Program, Federal University of Technology Parana, Parana, Brazil *Correspondence: Thanos Manos, [email protected] Edited and reviewed by: Francoise Argoul, Centre National de la Recherche Scientifique (CNRS), France This article was submitted to Fractal Physiology, a section of the journal Frontiers in Network Physiology 06 10 2022 2022 2 103823906 9 2022 20 9 2022 Copyright (c) 2022 Manos, Antonopoulos, Batista and Iarosz. 2022 Manos, Antonopoulos, Batista and Iarosz This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Advancing our understanding of the impact of dynamics at different spatiotemporal scales and structure on brain synchronous activity brain dynamics neural networks plasticity synchronization collective activity neuron models pmcIn the last decades, complex networks have been used extensively in neuroscience and other fields by employing networks to model interactions among system's components (Sporns et al., 2005). Moreover, there is cross-breeding between mathematical neuroscience and clinical neuroimaging techniques (Popovych et al., 2019). This interaction helps improve existing dynamical models or derive new ones which can then reproduce more accurately healthy and pathological brain activity. Consequently, they can help better detect underlying causes, and lead to testing treatment strategies in simulated environments (Jirsa et al., 2017). The human brain is a prime example of a complex system that can self-organise into different emergent states, crucial for healthy, abnormal functioning, and cognition (see e.g. (Majhi et al., 2019), for a recent review). These originate from certain types of synchronous neural activity. Brain disorders such as Parkinson's disease, epilepsy, etc. are associated with abnormal neural synchrony. A common research theme in the study of complex networks is that of the determination of the role and impact of network topology on the emerging properties due to interactions and dynamics. How structural properties in brain regions affect neural dynamics or how do they differ in healthy and diseased subjects? How different types of plasticity affect the dynamics of neural activity in a network? This Research Topic contributes to better understand the impact of dynamics at different spatiotemporal scales, structure and plasticity on brain synchronous activity. To this end, it hosts interdisciplinary analytical and computational works from different fields, such as from complex systems, biophysics, systems biology, and computational neuroscience. The first paper, by Liu et al., aims to better understand the effect of the amyloid b peptide (Ab) which is hypothesized to be the major factor driving Alzheimer's disease (AD) pathogenesis. To this end, the authors derived and investigated a concise mathematical model for Ab-mediated multi-pathway astrocytic intracellular Ca2+ dynamics. They investigated several interventions, such as ion channel blockers or receptor antagonists and demonstrated that a "combination therapy" targeting multiple pathways simultaneously is more effective towards the treatment of AD. Cambell et al. investigated the fractal dynamics of blood oxygen level-dependent (BOLD) signals during naturalistic conditions. They implemented fractal analysis to quantify scaling behavior using the Hurst exponent (H) in data from the Human Connectome Project to compare H values across movie-watching and rest. Their results showed that movie-watching induces fractal signal dynamics and markedly different than dynamics observed during conventional tasks. van der Vlag et al. introduced a new computational tool called RateML that enables users to generate whole brain network models from a succinct declarative description, in which the mathematics of the model are described without specifying how their simulation should be implemented. With RateML, the end user describes the model's mathematics once and generates and runs code for different languages/platforms, targeting both CPUs for fast single simulations and GPUs for parallel ensemble simulations (e.g. explore broader parameter fitting workflows, support studies on larger cohorts, etc). Lei et al. introduced a new type of burst-oscillation mode (BOM), i.e. an alternating transition between two distinct phases (one with multiple short spikes and another with a long interval). BOM was derived by extensively investigating the response dynamics of a one-dimensional (1D) paced excitable system with unidirectional coupling. These findings may facilitate a deeper understanding of bursts in nature and will have a useful impact in related fields. Shi et al. proposed a deep attributed network representation learning with community awareness (DANRL-CA) framework and two variants, i.e., DANRL-CA-AM and DANRL-CA-CSM, which incorporate the community information and attribute semantics into node neighbours with different methods. They designed a neighbourhood enhancement autoencoder module to capture the 2-step relations between node pairs. They conducted comparisons for node classification and link prediction and found that DANRL-CA-CSM can more flexibly coordinate the role of node attributes and community information in the process of network representation learning, and shows superiority in the networks with sparse topological structure and node attributes. Madadi Asl et al. employed a computational model to show that inhibitory spike-timing-dependent plasticity (iSTDP) at pallido-subthalamic synapses can account for pathological strengthening of pallido-subthalamic synapses in Parkinson's disease (PD) by further promoting correlated neuronal activity in the globus pallidus (GPe) - subthalamic nucleus (STN) network. Their results may shed light on how abnormal reshaping of GPe-STN connectivity by synaptic plasticity during parkinsonism is related to PD pathophysiology and contribute to the development of therapeutic brain stimulation techniques targeting plasticity-induced rewiring of network connectivity. Zheng et al. studied the emergence of spatiotemporal patterns in a general networked Hindmarsh-Rose (HR) model. Furthermore, they investigated stability properties, namely they obtained conditions leading to Turing instability in networks without delays and showed that there is a difference between the collected current and the outgoing current affecting the neuronal activity, which is relevant in the generation mechanism of short-term memory. Li et al. investigated the dynamics of networks of identical coupled oscillators in a setting where coherent oscillations coexist with incoherent ones, the so-called chimera state. They showed that stable and breathing chimera states in the original two coupled networks typically have very small basins of attraction. Then, they studied the emergence of chimera states by stimulating brain regions and quantified it using the order parameter and chimera index. These two indices were found to be weakly and negatively correlated. Author contributions TM drafted the first version of the editorial. All authors revised the first draft and made contributions about papers they edited. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Jirsa V. K. Proix T. Perdikis D. Woodman M. M. Wang H. Gonzalez-Martinez J. (2017). The virtual epileptic patient: Individualized whole-brain models of epilepsy spread. Neuroimage 145 , 377-388. 10.1016/j.neuroimage.2016.04.049 27477535 Majhi S. Bera B. K. Ghosh D. Perc M. (2019). Chimera states in neuronal networks: a review. Phys. Life Rev. 28 , 100-121. 10.1016/j.plrev.2018.09.003 30236492 Popovych O. V. Manos T. Hoffstaedter F. Eickhoff S. B. (2019). What can computational models contribute to neuroimaging data analytics? Front. Syst. Neurosci. 12 , 68. 10.3389/fnsys.2018.00068 30687028 Sporns O. Tononi G. Kotter R. (2005). The human connectome: a structural description of the human brain. PLoS Comput. Biol. 1 , e42. 10.1371/journal.pcbi.0010042 16201007 |
Front Netw Physiol Front Netw Physiol Front. Netw. Physiol. Frontiers in Network Physiology 2674-0109 Frontiers Media S.A. 961339 10.3389/fnetp.2022.961339 Network Physiology Editorial Editorial: Network Physiology, Insights in Dynamical Systems: 2021 Scholl Editorial: Network Physiology, Insights Scholl Eckehard 1 2 3 * 1 Institut fur Theoretische Physik, Technische Universitat Berlin, Berlin, Germany 2 Potsdam Institute for Climate Impact Research, Potsdam, Germany 3 Bernstein Center for Computational Neuroscience Berlin, Humboldt-Universitat, Berlin, Germany Edited and reviewed by: Wei Lin, Fudan University, China *Correspondence: Eckehard Scholl, [email protected] This article was submitted to Networks of Dynamical Systems, a section of the journal Frontiers in Network Physiology 15 7 2022 2022 2 96133904 6 2022 20 6 2022 Copyright (c) 2022 Scholl. 2022 Scholl This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Network Physiology, Insights in Dynamical Systems: 2021 dynamical systems complex networks network physiology synchronization coupled oscillators This work was supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation, project Nos. 163436311 SFB 910, 429685422 and 440145547). pmcThe field of network physiology considers all aspects of collective dynamics of and on complex networks with application to functions and mechanisms in living systems (Ivanov, 2021; Scholl, 2021; Gosak et al., 2022). Complex networks are an ubiquitous paradigm in nature, with a wide field of applications ranging from physics, chemistry, biology, neuroscience, physiology, medicine to socio-economic systems. The human organism is an integrated network of organ systems, individual organs, cells, biomolecules, which all interact with each other on various levels. Rather than attempting to study the individual, isolated parts, the network perspective of dynamical systems focusses on the interaction between the different units which leads to the emergence of novel collective behavior not present in the isolated systems. Central to the physiological functioning are nonlinear, dynamic or adaptive biophysical and biochemical interactions, control mechanisms, communication and information exchange between cells and organs. This applies to the normal physiological state as well as to pathological states including diseases. Recent research on dynamical networks has revealed a plethora of collective dynamic phenomena. Synchronization is an important universal feature of the dynamics in networks of coupled nonlinear oscillators. Various synchronization patterns are known, like cluster synchronization where the network splits into groups of synchronous elements, or partial synchronization patterns such as chimera states where the system splits into coexisting domains of coherent (synchronized) and incoherent (desynchronized) states. Phase transitions and critical phenomena in nonlinear dynamical systems far from thermodynamic equilibrium have been investigated since the 1970s and 1980s, and concepts from thermodynamics and statistical physics have been applied to describe self-organization, spatio-temporal pattern formation, phase coexistence, critical phenomena, and first and second order nonequilibrium phase transitions (Schlogl, 1972; Haken, 1978; Scholl, 1987). But only in recent times, phase transitions and critical phenomena have been studied in dynamical networks, where synchronization transitions may arise, giving birth to a plethora of partial synchronization patterns and complex collective behavior. These recent developments include connections of tipping transitions, explosive synchronization, nucleation, critical slowing down, critical correlations and fluctuations, critical exponents, etc. with nonequilibrium thermodynamics. This Research Topic of Frontiers in Network Physiology - Networks of Dynamical Systems, is focused on new insights, novel developments, current challenges, latest discoveries, recent advances and future perspectives in the field. It features contributions from leading experts that describe the state of the art, outlining recent developments and major accomplishments that have been achieved and that need to occur to move the field forward. They deal with healthy as well as pathological states in brain networks, in general multistable networks, and in physiological networks describing the interaction of organs and the immune system, and are linked up with data-driven network approaches. In the first contribution by Jifan Shi et al. it is suggested that criticality plays an important role in the healthy brain. The brain exhibits remarkable robustness under various types of noise and flexibility under various environments. However, how the brain works is still a mystery. The authors support the critical brain hypothesis by a dynamical network analysis using an electroencephalography dataset obtained from patients with psychotic disorders, ultra-high risk individuals, and healthy controls. The authors show that the brain of healthy controls remains around a critical state, whereas that of patients with psychotic disorders falls into more stable states. The brain of ultra-high risk individuals is similar to that of psychotic disorders in terms of entropy, but is analogous to that of healthy controls in causality patterns. These results not only provide evidence for the criticality of the normal brain but also highlight the practicability of using an analytic biophysical tool to study the dynamical properties of mental diseases. Tobias Fischer et al. propose a data-driven estimation of resilience in multistable networked dynamical systems as a versatile testbed for normal and aberrant states. Estimating resilience of adaptive, networked dynamical systems remains a challenge for the analysis of empirical data, such as for example time series of physiological observables of the human organism. Resilience refers to the ability to absorb disturbances and still retain essentially the same functioning. The authors develop a data-driven approach and test it with a network of networks of diffusively coupled FitzHugh-Nagumo oscillators by modifying resilience in a controlled manner. For this purpose they simulate a multistable system with a number of system states and with self-induced switching between them. The testbed also enables generation of multivariate time series of system observables to evaluate the suitability of data-driven estimators of resilience. M. Madadi Asl et al. consider Parkinson's disease as a multi-systemic neurodegenerative brain disorder. Motor symptoms of Parkinson's disease are linked to significant dopamine loss followed by basal ganglia circuit dysfunction. Increasing experimental and computational evidence indicates that synaptic plasticity plays a key role in the emergence of Parkinson's disease-related pathological changes. Spike-timing-dependent plasticity (STDP) mediated by dopamine provides a mechanistic model for synaptic plasticity to modify synaptic connections within the basal ganglia according to the neuronal activity. This paper reviews experimental pre-clinical, clinical, and computational findings on the modulatory effect of dopamine on STDP as well as other plasticity mechanisms and discusses their potential role in Parkinson's disease pathophysiology from the viewpoint of network dynamics. This review may provide further insights into the abnormal structure-function relationship within the basal ganglia contributing to the emergence of pathological states in Parkinson's disease. Specifically, this review is intended to provide detailed information for the development of computational network models for Parkinson's disease, serving as testbeds for the development and optimization of invasive and non-invasive brain stimulation techniques. Computationally derived hypotheses may accelerate the development of therapeutic stimulation techniques and potentially reduce the number of related animal experiments. The last paper by Rico Berner et al. presents a novel approach to modeling healthy and pathological states in a functional physiological network of organs and the immune system. In this work, they propose a dynamical systems perspective on the modeling of sepsis and its organ-damaging consequences. They develop a functional two-layer network model for sepsis based upon the interaction of parenchymal cells and immune cells via cytokines, and the coevolutionary dynamics of parenchymal, immune cells, and cytokines. By means of the simple paradigmatic model of adaptively coupled phase oscillators, the emergence of organ threatening interactions between the dysregulated immune system and the parenchyma is analyzed. It is demonstrated that the complex cellular cooperation between parenchyma and stroma (immune layer) either in the physiological or in the pathological case can be related to dynamical patterns of the network, i.e., either a healthy frequency synchronized state, or a pathological multifrequency cluster state. Thus insight is provided into the complex stabilizing and destabilizing interplay of parenchyma and stroma by determining critical interaction parameters. Moreover, the simulated probability for the emergence of pathological states is compared with empirical data for the hospitalization incidence of sepsis in Germany as a function of age. Author Contributions The author confirms being the sole contributor of this work and has approved it for publication. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's Note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References Gosak M. Milojevic M. Duh M. Skok K. Perc M. (2022). Networks behind the Morphology and Structural Design of Living Systems. Phys. Life Rev. 41 , 1-21. 10.1016/j.plrev.2022.03.001 35339047 Haken H. (1978). Synergetics, an Introduction: Nonequilibrium Phase Transitions and Self-Organization in Physics, Chemistry, and Biology. Berlin: Springer. Ivanov P. C. (2021). The New Field of Network Physiology: Building the Human Physiolome. Front. Netw. Physiol. 1 , 711778. 10.3389/fnetp.2021.711778 Schlogl F. (1972). Chemical Reaction Models for Non-equilibrium Phase Transitions. Z. Phys. 253 , 147. Scholl E. (1987). Nonequilibrium Phase Transitions in Semiconductors. Berlin: Springer. Scholl E. (2021). Partial Synchronization Patterns in Brain Networks. Epl 136 , 18001. Perspective article. 10.1209/0295-5075/ac3b97 |
Front Netw Physiol Front Netw Physiol Front. Netw. Physiol. Frontiers in Network Physiology 2674-0109 Frontiers Media S.A. 1018142 10.3389/fnetp.2022.1018142 Network Physiology Editorial Editorial: Network physiology, insights into the brain system: 2021 Lehnertz 10.3389/fnetp.2022.1018142 Lehnertz Klaus 1 2 3 * 1 Department of Epileptology, University of Bonn Medical Centre, Bonn, Germany 2 Helmholtz Institute for Radiation and Nuclear Physics, University of Bonn, Bonn, Germany 3 Interdisciplinary Center for Complex Systems, University of Bonn, Bonn, Germany Edited and reviewed by: Peter A. Tass, School of Medicine, Stanford University, United States *Correspondence: Klaus Lehnertz, Klaus [email protected] This article was submitted to Networks in the Brain System, a section of the journal Frontiers in Network Physiology 11 10 2022 2022 2 101814212 8 2022 29 9 2022 Copyright (c) 2022 Lehnertz. 2022 Lehnertz This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Network physiology, insights into the brain system: 2021 brain network brain dynamics brain pathologies biological rhythms sleep network models neuron models synchronization pmcDue to its intricate structure and its tremendous functionality, the human brain is one of the most complex and fascinating dynamical systems in nature. The highly interconnected networks in the brain, which are neither random nor entirely regular, span multiple spatial scales, from individual cells and synapses via cortical columns to (sub)cortical areas. These networks support a rich repertoire of behavioral and cognitive functions, and in the case of brain pathologies, normal and abnormal functions and/or structures can coexist. Over the last 2 decades, concepts and quantitative methods of network science have significantly contributed to reveal fundamental principles of brain structure and function. By the same token, conceptualizing the brain as a network has led to a paradigm shift in establishing neurological and psychiatric disorders as network disorders, possibly paving the way to a better understanding of brain disorders and to more efficient treatment options. Still, network studies of the human brain, alongside with its aberrances, remain at an early stage. Limitations that may result from an isolated view of the brain are currently being addressed within the field of network physiology, that uses concepts and quantitative methods of network science to improve our understanding how organ systems dynamically interact. The goal of this special edition Research Topic of Frontiers in Network Physiology-Networks in the Brain System section, is to shed light on the progress made in the past decade in the Networks in the Brain System field and on its future challenges. This article collection-consisting of five original research articles, one hypothesis and theory article, and one perspective article-features contributions from leading experts that describe the state of the art, outlining recent developments and major accomplishments that have been achieved and that need to occur to move the field forward. The contribution by Czarnecki et al.. provides insight into how new neurons are recruited into memory traces during sleep. By means of in silico modeling of neuronal networks with scale-free coupling topology the authors identified a dichotomous network reorganization-mediated by the neuromodulator acetylcholine (ACh) that can facilitate different aspects of memory formation and consolidation. The authors demonstrate a striking, state-dependent change in information flow throughout the network, with highly active hub cells integrating information in a high-ACh state, and transferring it to rest of the network in a low-ACh state. This result is corroborated by frequency-dependent frequency changes observed in vivo experiments. Lehnertz et al. demonstrate the influence of ultradian and circadian rhythms on temporal changes of various characteristics of human brain dynamics: higher-order statistical moments and interaction properties of multiday, multichannel EEG signals as well as local and global characteristics of EEG-derived evolving functional brain networks. Their findings emphasize the need to take into account the impact of various biological rhythms in order to avoid erroneous statements about brain dynamics and about evolving functional brain networks. Sawicki et al. report on the influence of music in a simulated network of FitzHugh-Nagumo oscillators with empirical structural connectivity obtained from healthy human subjects. The authors observe a frequency-dependent increase of coherence between the global network dynamics and the input signal induced by a specific music song, which compares to experimental findings of a global neural synchronization between different brain regions in the gamma-band and its increase immediately before transitions between different parts of the musical form. These findings may help to unravel the general modalities of the influence of music on the human brain. Tripathi and Gluckman develop coarse-grained models of neural cell group activity (in the form of mechanistic neural mass models) that can reflect environmental input and experimentally measurable parameters, and reproduce normal and pathological dynamics. The developed neural mass models are parametrized through simple mathematical functions, show physiologically interpretable behaviors and dynamical transitions from one state to another, as a function of key parameters of the neural environment. The paper demonstrates the method and reveals key dynamics in small networks that are basic elements of epilepsy. Tufa et al. report on a possible non-invasive biomarker of risk of sudden unexpected death in epilepsy (SUDEP), which is the leading seizure-related cause of death in people with epilepsy. The authors explored topological properties of cross-frequency functional brain networks derived from electroencephalograms recorded prior to, during and after seizures from people with epilepsy subdivided into SUDEP and non-SUDEP cohorts. Findings suggest a higher connectivity and more efficient flow of information in seizure networks from the SUDEP cohort. The Hypothesis and Theory article by Goodfellow et al. discusses advancements in physical and mathematical modeling as well as in data analysis techniques that have potential to further advance our understanding of brain structure and function. The authors argue that progress in these fields could benefit from closer cross-disciplinary links in the cycle of model refinement and checking. They then offer two other concrete examples of neuroscience-inspired research that could make a reciprocal contribution back to neuroscience, namely research into photonic neurons as well as into chimera states. The Perspective article by Sinha et al. centers around epilepsy as a network disease. Epilepsy is the most common chronic brain disease affecting more than 50 million people worldwide. It is characterized by seizures (either focal or generalized) that arise from aberrant activity in a distributed, large-scale network. The authors summarize the current state of knowledge and address several important challenges that could help to improve our understanding of the human brain in epilepsy. I am confident that this article collection will inspire, inform and provide direction and guidance to researchers in the field. Author contributions The author confirms being the sole contributor of this work and has approved it for publication. Conflict of interest The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
JMIR Med Educ JMIR Med Educ JME JMIR Medical Education 2369-3762 JMIR Publications Toronto, Canada v9i1e46366 36802457 10.2196/46366 Corrigenda and Addenda Corrigenda and Addenda Correction: Personalized Precision Medicine for Health Care Professionals: Development of a Competency Framework Martin-Sanchez Fernando PhD 1Department of Biomedical Informatics and Digital Health National Institute of Health Carlos III C de Sinesio Delgado, 10 Madrid, 28029 Spain 34 918 22 20 00 [email protected] Lazaro Martin MD 2 Lopez-Otin Carlos PhD 3 Andreu Antoni L PhD, MD 4 Cigudosa Juan Cruz PhD 5 Garcia-Barbero Milagros MD, PhD 6 1 Department of Biomedical Informatics and Digital Health National Institute of Health Carlos III Madrid Spain 2 Department of Medical Oncology, University Hospital Complex of Vigo Vigo Spain 3 Department of Biochemistry, University of Oviedo Oviedo Spain 4 European Infrastructure for Translational Medicine Amsterdam Netherlands 5 Department of University, Innovation and Digital Transformation, the Government of Navarra Navarra Spain 6 Faculty of Medicine, Miguel Hernandez University Alicante Spain Corresponding Author: Fernando Martin-Sanchez [email protected] 2023 21 2 2023 21 2 2023 9 e463668 2 2023 8 2 2023 (c)Fernando Martin-Sanchez, Martin Lazaro, Carlos Lopez-Otin, Antoni L Andreu, Juan Cruz Cigudosa, Milagros Garcia-Barbero. Originally published in JMIR Medical Education ), 21.02.2023. 2023 This is an open-access article distributed under the terms of the Creative Commons Attribution License ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work, first published in JMIR Medical Education, is properly cited. The complete bibliographic information, a link to the original publication on as well as this copyright and license information must be included. pmcIn "Personalized Precision Medicine for Health Care Professionals: Development of a Competency Framework" (JMIR Med Educ 2023;9:e43656), the authors noted several errors. In the originally published paper, a typographical error in the corresponding author's email address, formatted as: [email protected] This has been changed to: [email protected] In the last paragraph of the "Introduction" section, the authors noted that one reference was not included in the original manuscript. A new citation (numbered 7) has been added to the list of references and cited in the following sentence: Accordingly, this project aimed to define a proposal of common domains and competencies for today's health care professionals, as well as those who will emerge in the future . The citation added to the reference list is as follows: Fundacion Instituto Roche. Competency Personalized Precision Medicine for healthcare professionals. 2021. URL: Final_Report_Competencies_PPM_DEF1.pdf [accessed 2023-02-08] The addition of this citation modified the order of the rest of the citations. In Table 2, an acronym was originally typed incorrectly as "OLPPDGDR". This has been corrected to "OLPDPGDR" both in row "D2.11" and in the corresponding footnote "c". The same error occurred in Figure 4, which has also been updated accordingly. An error was also noted in the first paragraph of the "Acknowledgments" section. The sentence: We are grateful to the working group for aiding the development of this project, contributing to the preparation of this document, and sharing their perspectives on the key elements and training needs for the definition of competencies in the areas of interest of personalized precision medicine. Has been changed to: We are grateful to the Fundacion Instituto Roche and the working group for aiding the development of this project, and sharing their perspectives on the key elements and training needs for the definition of competencies in the areas of interest of personalized precision medicine. The correction will appear in the online version of the paper on the JMIR Publications website on February 21, 2023, together with the publication of this correction notice. Because this was made after submission to full-text repositories, the corrected article has also been resubmitted to those repositories. 7 Fundacion Instituto Roche Competency Personalized Precision Medicine for healthcare professionals 2021 2023-02-08 |
Front Mol Neurosci Front Mol Neurosci Front. Mol. Neurosci. Frontiers in Molecular Neuroscience 1662-5099 Frontiers Media S.A. 10.3389/fnmol.2023.1162689 Molecular Neuroscience Editorial Editorial: The role of GABA-shift in neurodevelopment and psychiatric disorders Neuwirth Lorenz S. 1 2 * El Idrissi Abdeslem 3 4 * Fukuda Atsuo 5 * Kilb Werner 6 * 1Department of Psychology, SUNY Old Westbury, Old Westbury, NY, United States 2SUNY Neuroscience Research Institute, SUNY Old Westbury, Old Westbury, NY, United States 3Center for Developmental Neuroscience, The College of Staten Island (CUNY), Staten Island, NY, United States 4Department of Biology, The College of Staten Island (CUNY), Staten Island, NY, United States 5Department of Neurophysiology, Hamamatsu University School of Medicine, Hamamatsu, Japan 6Institute of Physiology, University Medical Center, Johannes Gutenberg University, Mainz, Germany Edited and reviewed by: Clive R. Bramham, University of Bergen, Norway *Correspondence: Lorenz S. Neuwirth [email protected] Abdeslem El Idrissi [email protected] Atsuo Fukuda [email protected] Werner Kilb [email protected] This article was submitted to Neuroplasticity and Development, a section of the journal Frontiers in Molecular Neuroscience 28 2 2023 2023 16 116268909 2 2023 10 2 2023 Copyright (c) 2023 Neuwirth, El Idrissi, Fukuda and Kilb. 2023 Neuwirth, El Idrissi, Fukuda and Kilb This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic The role of GABA-shift in neurodevelopment and psychiatric disordersGABA GABAA receptor (GABAAR) KCC2 NKCC1 pmcThe main inhibitory neurotransmitter in the mature brain, GABA, has the unique feature that post-synaptic responses upon it's interaction with GABAA receptors can change their direction in response to alterations in the intracellular . This GABA-shift plays an important role during early neurodevelopment and has been implicated in a variety of neuropathological conditions. The mechanisms behind the GABA-shift are mediated by changes in the expression and functions of key transporters for bicarbonate, in particular, NKCC1 (i.e., mediating ) and KCC2 (i.e., mediating ). The current Research Topic sought to provide a forum for reviewing recent progress in this fascinating field and to collect recent studies investigating the role of the GABA-shift in neurodevelopment and in the etiology of neurological diseases. The current Research Topic comprises five review articles and seven original research articles. The review articles provide an update on features of the GABA-shift, spanning from the structural basis of its regulation, via its role during neurodevelopment up to new perspectives for the etiology and treatment of neurological disorders. The original research articles focus on the role of under physiological conditions or in neurological disorders and present new experimental methods to determine the reversal potential of GABA. A thorough introduction into the molecular basis of and regulation is provided by the review article of Hartmann and Nothwang, which provides an update on the structural basis underlying the regulation of KCC2 and NKCC1. The authors characterize phosphorylation sites on both transporters and describe the functional consequences of phosphorylation/dephosphorylation at these sites. They conclude that the intracellular loop between the a8 and a9 helix represents a region of particular importance for the functional regulation of KCC2. The review article by Kilb emphasizes that depolarizing GABAergic responses are not excitatory per se and provides a theoretical framework and experimental findings determining whether GABAergic depolarizations are inhibitory or excitatory. A more global review on GABAergic neurodevelopment is provided by Warm et al., summarizing the role of GABAergic interneuron populations in the functional maturation of the cerebral cortex and further describing the mutual interaction between maturation of the GABAergic system and cortical network activity. The remaining two review articles focus on the role of the GABA-shift in neurological and neuropsychiatric diseases. Hui et al. discusses how the developmental shift from excitatory-to-inhibitory GABAergic actions is altered in neurodevelopmental and neuropsychiatric disorders. They concentrate on the cell signaling and regulatory mechanisms underlying this GABA-shift and discuss how the GABA-shift influences interactions between GABAergic interneurons and other cell types in the developing brain and thereby contributes to neurodevelopment. Finally, they briefly outline recent progress on targeting NKCC1 and KCC2 as a therapeutic strategy against neurodevelopmental and neuropsychiatric disorders. More specifically, Huang et al. concentrated on the role of the GABAergic system in post-traumatic stress disorders (PSTD) and reviewed changes of the GABAergic system in PTSD based on imaging and pharmacological results from both preclinical and clinical studies and derived putative pharmacological targets that might be helpful in the future treatment of PTSD. The original research article of Vazetdinova et al. reported the accuracy of cell-attached recordings to determine important cellular physiological parameters, which established that cell-attached recordings of cortical and hippocampal neurons can be used to reliably determine the GABA reversal potential and other physiologically relevant parameters. Therefore, cell-attached recordings can be used to investigate the GABA-shift, because they don't artificially disturb the intracellular . Two original research reports deal with the role of hyperpolarized GABAergic responses in GABAergic interneurons for the control of cortical excitability. Zavalin et al. reported that depletion of KCC2 in Dlx5-lineage neurons, which targets several types of GABAergic interneurons including parvalbumin-positive interneurons (PV-INs), induces a massive change in the distribution of GABA interneuron subpopulations, a high incidence of spontaneous seizures, and a high rate of premature death in juvenile animals. In contrast to their initial hypothesis, they did not observe migration deficits or disturbed laminar organization of interneurons, indicating that the adverse effects should occur later. Alternatively, they observed a milder phenotype in mice if KCC2 expression was obsolete only in PV-INs. In line with this, Herrmann et al. reported that a Cre-mediated disruption of KCC2 specifically in PV-INs led to the expected shift in the GABA reversal potential and a higher frequency of inhibitory post-synaptic potentials, indicating a disinhibition of PV-INs. In addition, these animals displayed a reduced seizure threshold with the occurrence of increased spontaneous seizures and an upregulation of pro-apoptotic genes in parvalbumin-positive interneurons. At several locations in the adult brain, the developmental GABA-shift does not occur and GABA maintains a depolarizing action until adulthood. One of these regions is the hypothalamic medial eminence, involved in the hypothalamic-pituitary-adrenal (HPA) axis of corticosterone release. Yesmin et al. investigated the GABAergic network in this area and observed that a subpopulation of GABAergic neurons directly project to the axon terminals from CRH neurons. The conditional deletion of NKCC1 from the CRH axon terminals results in significantly lower corticosterone levels, demonstrating the important role of depolarizing GABAergic responses in the HPA axis and may serve as an early pathological trigger for later psychiatric issues. Three additional articles revealed that modification of GABAergic system elements can led to persisting alterations in the excitability unrestricted to the GABAergic system. Sinha et al. reported that a depletion of WNK3, a developmentally expressed member of the WNK-family that regulates via phosphorylation of NKCC1 and KCC2, results in slightly higher intracellular . However, the authors observed that other neuronal properties determining excitability (e.g., K+-channel expression) are also altered in the WNK3 knockout animals, but that this effect can be ameliorated by an overexpression of KCC2, suggesting that the interactive function of WNK3 is probably the maintenance and development of both intrinsic and synaptic excitabilities. A comparable interaction between the GABAergic synaptic system and intrinsic neuronal excitability was reported by Hosoi et al., who investigated the role of taurine, an important agonist of the GABAergic system during early development and a modulator of WNK and hence , on the excitability of matured neurons. They report an obvious alteration of firing properties in differentiated Layer 2/3 pyramidal neurons of taurine-depleted animals. Lastly, Qin et al. discloses that inhibition of , an orphan-receptor associated to depression-like phenotypes, reduces the expression of the GABAA receptor subunits a1, a2, b2, and b3 in the nucleus accumbens. The resulting reduction in GABAergic transmission contributes to the impaired long-term depression and a depression-like phenotype in these mice. In summary, the current Research Topic summarizes recent opinions on advancing our understanding of the mechanisms and functional consequences of the GABA-shift from the last three decades, but also provides evidence that changes in the GABAergic responses, either acute or during early developmental stages, can lead to persistent functional changes in the nervous system by affecting the GABA-shift and other subsequent processes that move beyond the GABAergic system completing the full integration of the mature brain. Author contributions All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Front Oncol Front Oncol Front. Oncol. Frontiers in Oncology 2234-943X Frontiers Media S.A. 10.3389/fonc.2023.1164081 Oncology Editorial Editorial: Advances in the treatment of Hodgkin lymphoma Mei Matthew 1 * Perini Guilherme 2 Ramchandren Radhakrishnan 3 1 Department of Hematology and Hematopoietic Cell Transplantation, City of Hope, Duarte, CA, United States 2 Hospital Israelita Albert Einstein, Sao Paulo, Brazil 3 Division of Hematology/Oncology, University of Tennessee Health Science Center, Knoxville, TN, United States Edited and Reviewed by: Alessandro Isidori, AORMN Hospital, Italy *Correspondence: Matthew Mei, [email protected] This article was submitted to Hematologic Malignancies, a section of the journal Frontiers in Oncology 28 2 2023 2023 13 116408112 2 2023 14 2 2023 Copyright (c) 2023 Mei, Perini and Ramchandren 2023 Mei, Perini and Ramchandren This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Editorial on the Research Topic Advances in the treatment of Hodgkin lymphoma Hodgkin lymphoma stem cell transplantation brentuximab vedotin chemotherapy elderly pmcRecent years have seen numerous advances in classical Hodgkin lymphoma (cHL) both from the standpoint of understanding its unique disease biology and in clinical practice, with an increasing number of patients treated effectively with novel combinations across multiple lines of therapy. For instance, incorporation of brentuximab vedotin (BV) in the frontline setting has now been shown to extend overall survival as compared to ABVD (1), and second-line regimens incorporating programmed cell death-1 (PD-1) blockade have delivered unprecedented response rates (2-4). However, in spite of the fact that the large majority of patients with newly diagnosed cHL are ultimately cured, the notion that cHL has been solved is false, and there remains significant room for further innovation. This Frontiers special section on Advances in the Treatment of Hodgkin Lymphoma includes five manuscripts that highlight some of the progress made as unmet needs remain in cHL. Song et al. report on the outcomes of penpulimab, a novel anti-PD-1 monoclonal antibody, in patients with relapsed/refractory (r/r) cHL. In distinction to other approved anti-PD-1 therapies in cHL (nivolumab, pembrolizumab in the U.S.; tislelizumab,sintilimab, and camrelizumab in China) which are IgG4 monoclonal antibodies, penpulimab uses an IgG1 construct. Moreover, it is further engineered with an Fc mutation that eliminates the Fc receptor, which prevents antibody-dependent cell-mediated cytotoxicity. The overall response rate (89%) in pre-treated patients who had at least two prior lines of therapy compares favorably to other anti-PD-1 agents; notably, no patient had prior BV, however. Toxicity (grade 3+ irAE of 4.3%) also seemed low compared to other checkpoint inhibitors in use, and a randomized phase 3 trial of penpulimab vs. investigator's choice therapy is underway in China. Li et al. report on a single fascinating case of a child with a germline titin (TTN) mutation and severely depressed ejection fraction at the time of being diagnosed with advanced stage cHL. As pathogeneic TTN mutations appear to be highly correlated with anthracycline-induced cardiotoxicity, he was treated with an anthracycline-free regimen including BV and subsequently achieved CR, which had been sustained for 11 months at the time of the writing of the manuscript. Delivery of curative therapy without anthracycline use remains elusive in cHL; yet, with a growing appreciation of the long-term cardiotoxic risk of anthracycline exposure (5), this remains an unmet need and an important goal. Barrett and Collins provide an excellent summary on challenges relating to the treatment of older persons with cHL and the difficult decision-making regarding the optimal choice of therapy in this population as delivery of curative therapy is fraught with baseline comorbidities, yet undertreating the disease in an effort to avoid toxicity also results in poor outcomes. Minimizing the use of bleomycin, the judicious use of intensive salvage therapies such as autologous stem cell transplantation (autoHCT) in eligible patients, and the unmet need for improved therapies for truly unfit patients are all highlighted. Maranzano and Mead review data and strategies surrounding stem cell transplantation in cHL. They discuss novel salvage therapies as incorporation of BV and/or anti-PD-1 agents has resulted in an unprecedented number of patients proceeding to potentially curative autoHCT in complete remission as well as the role of maintenance therapies after autoHCT. Allogeneic stem cell transplantation (alloHCT) still plays a role in patients who relapse after prior autoHCT but is associated with significant toxicity, particularly when performed shortly after recent anti-PD-1 exposure. Finally, Ullah et al. comprehensively review the treatment landscape of cHL with a focus on novel therapies and approaches. In addition to reviewing existing approved therapies, they also discuss newer data on epigenetic treatments in cHL, the potentially emerging role of alternative immune checkpoint inhibitors directed against LAG-3 and TIGIT, and cellular therapies including chimeric antigen receptor T-cell (CAR T-cells) and natural killer (NK) cell therapy, both of which have demonstrated clinical efficacy in early phase trials. Author contributions MM conceptualized and wrote the first draft of the manuscript. All authors edited the manuscript and approved the final version. Conflict of interest MM declares consultancy with Novartis, SeaGen, CTI, Janssen, and EUSA; speakers' bureau with SeaGen and Morphosys; research funding from BMS, BeiGene, and Morphosys. GP declares consultancy with Abbvie, Janssen, and Takeda. RR declares a research funding from Merck and Seagen and consultancy with Merck and Seagen. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1 Ansell SM Radford J Connors JM Dlugosz-Danecka M Kim WS Gallamini A . Overall survival with brentuximab vedotin in stage III or IV hodgkin's lymphoma. New Engl J Med (2022) 387 (4 ):310-20. doi: 10.1056/NEJMoa2206125 2 Moskowitz AJ Shah G Schoder H Ganesan N Drill E Hancock H . Phase II trial of pembrolizumab plus gemcitabine, vinorelbine, and liposomal doxorubicin as second-line therapy for relapsed or refractory classical Hodgkin lymphoma. J Clin Oncol (2021) 39 (28 ):3109-17. doi: 10.1200/JCO.21.01056 3 Mei MG Lee HJ Palmer JM Chen R Tsai NC Chen L . Response-adapted anti-PD-1-based salvage therapy for Hodgkin lymphoma with nivolumab alone or in combination with ICE. Blood (2022) 139 (25 ):3605-16. doi: 10.1182/blood.2022015423 4 Ding K Liu H Ma J Yang H Cao L Wang H . Tislelizumab with gemcitabine and oxaliplatin in patients with relapsed or refractory classic Hodgkin lymphoma: A multicenter phase II trial. Haematologica (2023). doi: 10.3324/haematol.2022.282266 5 Larsen CM Garcia Arango M Dasari H Arciniegas Calle M Adjei E Rico Mesa J . Association of anthracycline with heart failure in patients treated for breast cancer or lymphoma, 1985-2010. JAMA Netw Open (2023) 6 (2 ):e2254669-e. doi: 10.1001/jamanetworkopen.2022.54669 |
Front Nutr Front Nutr Front. Nutr. Frontiers in Nutrition 2296-861X Frontiers Media S.A. 10.3389/fnut.2023.1154894 Nutrition Correction Corrigendum: The association between diet and cardio-metabolic risk on cognitive performance: A cross-sectional study of middle-aged Australian adults Gauci Sarah 1 2 * Young Lauren M. 1 2 Arnoldy Lizanne 1 Scholey Andrew 1 3 White David J. 1 Lassemillante Annie-Claude 4 5 Meyer Denny 6 Pipingas Andrew 1 1Centre of Human Psychopharmacology, Swinburne University, Melbourne, VIC, Australia 2Food and Mood Centre, School of Medicine, Barwon Health, Institute for Mental and Physical Health and Clinical Translation, Deakin University, Geelong, VIC, Australia 3Nutrition Dietetics and Food, School of Clinical Sciences, Monash University, Melbourne, VIC, Australia 4Department of Health and Medical Sciences, Swinburne University, Melbourne, VIC, Australia 5Department of Health Professions, Swinburne University, Melbourne, VIC, Australia 6Department of Health Science and Biostatistics, Centre for Mental Health, Swinburne University, Melbourne, VIC, Australia Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland *Correspondence: Sarah Gauci [email protected] This article was submitted to Nutrition, Psychology and Brain Health, a section of the journal Frontiers in Nutrition 28 2 2023 2023 28 2 2023 10 115489431 1 2023 09 2 2023 Copyright (c) 2023 Gauci, Young, Arnoldy, Scholey, White, Lassemillante, Meyer and Pipingas. 2023 Gauci, Young, Arnoldy, Scholey, White, Lassemillante, Meyer and Pipingas This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. A corrigendum on The association between diet and cardio-metabolic risk on cognitive performance: A cross-sectional study of middle-aged Australian adults by Gauci, S., Young, L. M., Arnoldy, L., Scholey, A., White, D. J., Lassemillante, A.-C., Meyer, D., and Pipingas, A. (2022). Front. Nutr. 9:862475. doi: 10.3389/fnut.2022.862475 diet cognition cardio-metabolic risk mediterranean diet MIND diet DASH diet pmcIn the published article, there was an error in Table 1, Dietary scores for MedDiet, DASH, and MIND as published. There were some typos and errors in the serves per day for the MedDiet, DASH and MIND dietary patterns. The corrected Table 1. Dietary scores for MedDiet, DASH, and MIND and its caption appear below. Table 1 Dietary scores for MedDiet, DASH, and MIND. Food group MedDiet DASH MIND Item Serves Score Item Serves Score Item Serves Score Oil and fat Olive oil,% < 50% 0 % kcal from fat >=33 0 Olive oil < 50% 0 kcal from oil and fats >=50% 1 >30 to < 33 0.5 >=50% 1 fats and oils <= 30 1 fats and oils Olive oil < 13.5 g 0 % kcal from saturated >=13 0 >=13.5 g 1 fatty acids >10 to < 13 0.5 <= 10 1 Fruit and vegetables Vegetables < 2 0 Vegetables < 2 0 Green leafy vegetables <= 0.29 0 >=2 1 >=2 to < 4 0.5 >0.29 to < 0.86 0.5 >=4 1 >=0.86 1 Fruit < 3 0 Fruits < 2 0 Other vegetables < 0.71 0 >=3 1 >=2 to < 4 0.5 >=0.71 to < 1 0.5 >=4 1 >=1 1 Berries < 0.14 0 >=0.14 to < 0.29 0.5 >=0.29 1 Meat Red meat, hamburger, >1 0 Meats, poultry and fish >=4 0 Red meat and products >=1 0 and meat products <= 1 1 >2 to < 4 0.5 >=0.57 to < 1 0.5 <= 2 1 < 0.57 1 Chicken,% kcal from <= 50% 0 Fish < 0.033 0 meat intake >50% 1 >=0.033 to < 0.14 0.5 >=0.14 1 Fish and shellfish < 0.43 0 Poultry < 0.14 0 >=0.43 1 >=0.14 to < 0.29 0.5 >=0.29 1 Dairy Butter, margarine >1 0 Dairy < 1 0 Butter and margarine >2 0 and cream <= 1 1 >=1 to < 2 0.5 >=1 to <= 2 0.5 >=2 1 < 1 1 Cheese >=1 0 >=0.14 to < 1 0.5 < 0.14 1 Nuts and legumes Nuts < 0.43 0 Nuts, seeds, and < 0.29 0 Nuts < 0.033 0 >=0.43 1 dry beans >=0.29 to < 0.57 0.5 >=0.033 to < 0.71 0.5 >=0.57 1 >=0.71 1 Legumes < 0.43 0 Beans < 0.14 0 >=0.43 1 >=0.14 to <= 0.43 0.5 >0.43 1 Grains Total grain intake < 5 0 Whole grains < 1 0 >=5 to < 7 0.5 >=1 to < 3 0.5 >=7 1 >=3 1 Whole grain intake < 1 0 >=1 to < 2 0.5 >=2 1 Other Sofrito < 0.29 0 Sodium (mg/d) >2,401 0 >=0.29 1 >1,500 to <= 2,401 0.5 <= 1,500 1 Discretionary food Commercial sweets or >=0.43 0 Sweets >=1.14 0 Pastries, sweets >=1 0 pastries < 0.43 1 >0.71 to < 1.14 0.5 >=0.71 to < 1 0.5 <= 0.71 1 < 0.71 1 Sweet carbonated >=1 0 Fast/fried foods >=0.57 0 beverages < 1 1 (times/day) >=0.14 to < 0.57 0.5 < 0.14 1 Alcohol Wine < 1 0 Wine >1 or 0 0 >=1 1 >0 to < 1 0.5 1 1 All in serves per day except those labeled differently. Definition of a serve was based on the original scoring of the diet, for serving sizes not reported in the original score, the USDA National Nutrient Database for Standard Reference dietary guidelines (2015-2020) was used to define a serve or the NIAA for alcohol (a more detailed description of scoring will be published elsewhere). The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated. Publisher's note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.