Split (1)

train · 186k rows

text string	id string	dump string	url string	date string	file_path string	offset int64	token_count int64	language string	page_average_lid string	page_average_lid_score float64	full_doc_lid string	full_doc_lid_score float64	per_page_languages list	is_truncated bool	extractor string	page_ends list
Master’s Thesis Evaluation of Machine Translations from Google Translate, eTranslation and DeepL: A Quality Assessment of the Machine Translations from English to Danish and vice versa Supervisor: Bolette Sandford Pedersen Submitted on: 3rd of April 2022 No. of characters: 130569 No. of pages: 53 Acknowledgments I would like to thank my supervisor Bolette Sandford Pedersen for her advice, feedback and for helping establish contact to Claus Thornby Larsen and the Agency of Digitalisation, where I was able to sit at an office space for most of the writing period. In this context, I would like to thank Christian Plaschke, Josephine Worm Andersson and Carl Frederik Bach Kirchmeier for their sparring and general helpfulness and for letting me ask the obvious questions and them answering the questions. Also, a big thank you to Claus Thornby Larsen who has enlightened me on the curiosities of machine translations in the EU. I would also like to extend my gratitude to Mathias Ennegaard Asmussen for his helpfulness and patience, not to be forgotten. Also, Natalie Sørensen who helped read and provide feedback on various parts of the thesis. Finally, I would like to thank my family and friends for their lovely support during the production of my thesis. Abstract The purpose of this study is to benchmark Danish to English machine translations and vice versa and to estimate if eTranslation could be a viable alternative to Google Translate or DeepL. Stakeholders within Danish NLP have identified automatic translation as an area that can be improved and yield great value in return. I have therefore evaluated the quality of machine translations from eTranslation, Google Translate and DeepL using two evaluation metrics namely the BLEU and TER score and a custom error typology. This was done in an attempt to disprove the narrative that Danish machine translation is low quality and has not seen the same rise in quality as other languages since the introduction of neural networks in 2015. The comparison was made on four different domains to ensure a broad quality estimation. My findings indicate that Danish machine translations produced are high-quality. The three tools are quite similar in quality across domains and languages, but differ in other areas such as certain error types and post-editing effort. Given the similar high quality of the three tools, a user’s decision can then be made on factors around the translation system, such as values and data security. # Content 1 Introduction .................................................................................................................. 6 1.1 Motivation ........................................................................................................... 6 2 Background in NLP and Machine Translation ............................................................ 9 2.1 NLP in Denmark and beyond ............................................................................... 9 2.2 Related work – State of the art .......................................................................... 12 2.3 Translation tools ................................................................................................. 14 2.3.1 eTranslation ............................................................................................... 14 2.3.2 Google Translate ....................................................................................... 15 2.3.3 DeepL ......................................................................................................... 16 3 Evaluation methodology ............................................................................................. 16 3.1 Evaluation metrics .............................................................................................. 16 3.1.1 BLEU score ............................................................................................... 16 3.1.2 Critiques of the Bilingual Understudy Score ........................................... 20 3.1.3 Translation Edit Rate ................................................................................ 21 3.1.4 Error Typology .......................................................................................... 23 4 Results and Analysis .................................................................................................. 25 4.1.1 Data: Selected corpora .................................................................................. 25 4.1.2 Data: Description and processing ............................................................... 26 4.2 Individual assessment .......................................................................................... 27 4.2.1 Results for eTranslation: ........................................................................... 27 4.2.2 Results for Google Translate ....................................................................... 33 4.2.3 Results for DeepL ....................................................................................... 39 4.3 Comparative assessment ...................................................................................... 45 4.3.1 The metrics scores ...................................................................................... 45 4.3.2 Error types .................................................................................................. 46 5 Discussion and perspectives ....................................................................................... 50 5.1 Caveats ................................................................................................................ 52 5.1.1 Evaluation metrics ...................................................................................... 53 5.2 Future studies ....................................................................................................... 55 6 Conclusion .................................................................................................................. 56 Bibliography .................................................................................................................. 59 Appendix ....................................................................................................................... 62 University of Copenhagen 1 Introduction 1.1 Motivation In the report ‘Sprogteknologi i verdensklasse’ (Kirchmeier et al. 2019), the status of Danish language technology was given and a bleak picture was painted. One of many identified areas with potential for improvement was machine translation. It was mentioned that although the quality has soared since the introduction of neural networks, there is still a gap between the standards of human translations and machine translations at the time of completing the report. There has also been an increasing focus on handling personal information safely and responsibly, which makes the European translation tool, eTranslation, particularly interesting to evaluate. In addition, translation tasks are still in demand by public and private stakeholders alike, but these tasks have been increasingly outsourced to either professionals or the most readily available tool, namely Google Translate or DeepL (Kirchmeier et al. 2019, p. 28). Therefore, I would like to study the quality of Danish to English machine translation today. Secondly, I examine whether eTranslation could be a realistic alternative to Google Translate or DeepL regarding Danish translation tasks. Also, is there a significant difference in the quality of translations and would a possible discrepancy be dependent on the domain? Concerning this: What does the choice of evaluation metrics mean for the total quality assessment? My motivation for this is the increasing focus and funding into Danish language technology and solutions aimed at the Danish language in recent years. I want to contribute to the development of this Danish language technology. At the time of writing, private and public stakeholders have recognised some of the issues raised in the report and language technology is picking up speed in Denmark. There are initiatives such as the public website ‘sprogteknologi.dk’ launched by the Agency of Digitalisation that aim to gather and collect existing and future language resources, models, tools, corpora etc. to create a foundation for all stakeholders with an interest in Danish language technology. This was to face one of the previous challenges, namely that the effort to improve the Danish language technology has been disjointed, resulting in an idle state of development. For example, a student in need of a named entity recogniser or a different language resource would not have to reinvent the wheel, but simply click onto the sprogteknologi.dk webpage and find the most suitable solution for his or her needs. Another challenge Danish language technology faces is the lack of high-quality linguistic data appropriate for tasks. To put Danish language technology into service, corpora with a great amount of metadata holding information on for example pronunciation for speech systems, domains specific words or phrases for classification tasks and so on. A common denominator for information-enriched corpora is that the higher the quality demands are the higher the need for a linguistic expert to be involved is. These are not only expensive but also in short supply in Denmark. As it stands right now, the only master's programme that truly focuses on language technology is IT & Cognition at the University of Copenhagen, even though there are electives and other minor subjects to be taken at other institutions. There is another issue in relation to this, namely that the students do not work with Danish language data per se, but have to opt to examine Danish data at exams and tests etc. The scarcities of high-quality data and specialists might stem from the lack of a focal point and incoherent efforts to create a solid foundation like a national term bank. This is pointed out in the report as one of the top priorities and establishing a national language bank would not only save funds but also add to the limited amount of useful data available at the moment (Kirchmeier et al. 2019). An initiative like this could also be the catalyst to illustrate the importance and value of the aforementioned data. At the time of writing, there are no standard procedures or systematic approaches for how municipalities choose to solve their translation tasks. The current practice is a mix of employees who know the target language but are employed for different tasks, others use external translators and only a very small portion use employees who are actively working with language-related tasks. The absence of structure prognosticates that no thoughts have been given to how the translated data is stored or what uses a translated text might have to others (Kirchmeier et al. 2019). There is no feedback of data to any storage or filing system and many valuable datasets are lost. To enhance the Danish field of machine translation, these texts could be stored in a translation memory. A translation memory is vital for training and is used by nearly all translation companies and is typically combined with machine translation. This could add a good chunk of data to the pool. Another option, which is readily available to public institutions and small and medium-sized enterprises, is the translation tool from the EU mentioned earlier, namely eTranslation. The conclusion of a workshop consisting of participants from public and private institutions, unions and representatives from the ELRC was that the trend of outsourcing public translation tasks could contribute to the state of language technology in Denmark if the data and not only the output were to be shared. However, a public-private collaboration would require regulation of data treatment and a re-examination of public tendering rules (Kirchmeier et al. 2019). This point is made more relevant from a conclusion in the report shows that translation is a growing need for both public and private entities that are active across the borders of EU countries and since the EU aspire to encourage digital inner market trading, a tool that allows free translation into 24 languages is of high value. The European Language Resource Coordination (ELRC) is a collection of language resources made available for all member states of the EU with Norway and Iceland included as well (European Language Resource Coordination 2020). The Danish Language Council and the two Danish anchor points in the ELRC, The Agency of Digitalisation and the Centre for Language Technology at the University of Copenhagen have recognised this. They have contributed to the initiative ELRC by gathering parallel corpora from public institutions and making them available for training models. These models could be eTranslation’s own or perhaps Danish-developed ones in the future. This effort has resulted in a steady increase in eTranslation’s quality and improvement on smaller languages like Danish and could be seen as a possible gateway to more data if the tool could translate texts to a satisfactory level (European Language Resource Coordination 2020, p. 33). Furthermore, there has been an increasing amount of attention to how personal data is treated online in recent years, with executive vice-president and EU antitrust chief Margrethe Vestager from her position as commissioner for Competition in the European Union raising the alarm for a more secure treatment of personal data and pointing fingers at Google and Facebook (Breinstrup 2016). One of the cornerstones of eTranslation is the treatment and protection of personal information and data security. Although this does not set eTranslation in a position to be directly compared to the two most used and readily available tools Google Translate and DeepL, it does announce itself as a possible viable alternative, exactly because it offers a new dimension, namely protection. A comparison between eTranslation, Google Translate and DeepL might inspire a new preference for translation tasks in the public and private sectors depending on the outcome. In addition, it might reveal that Danish language technology is not that far behind if not a forerunner as Danish is in other parts of digital governance. To perform the comparison and assess the quality of each translation tool, I am using a selection of corpora from the ELRC across different domains to evaluate eTranslation, Google Translate DeepL. The corpora from ELRC are converted from XML-files into .txt-files to enable the analysis and comparison of the sentences. The domains are Public Health, Culture, Finance and general text. General text is different due to its lack of a constraining vocabulary, thus offering a challenge to eTranslation, Google Translate and DeepL. EU’s eTranslation is a result of former machine translation services created by the European Commission MT@EC. This was in turn built upon an open-source toolkit for translation called MOSES. Whereas MT@EC was a statistical machine translation, eTranslation is a product of its time and is a neural network. In addition, the aim of eTranslation is scalability and flexibility to accommodate the potential growth in use (Connecting Europe Facility). Google Translate is also a neural network, making the transition in 2016 from a statistical, phrase-based machine translation model. Given the huge amount and influx of data that Google receives, its models are well fed and can present very accurate translations in many languages (Aiken 2019). DeepL is built upon an online dictionary called Linguee that scraped texts but is now a neural network claiming to be four times better than Google Translate. Because DeepL has a limit of 5000 characters, a number of sentences will be translated and evaluated; raising the character limit is an option to buy. This will be further elaborated on later. The most used metric for evaluating machine translations for the past many years has been the Bilingual Evaluation understudy-score also called the BLEU score. This method is used to evaluate eTranslation and Google Translate uses its own GLEU-score. In my thesis, I will employ the BLEU score for both systems and I will also be using translation edit rate (TER) to estimate the quality of translated documents to avoid limiting myself to only one measurement. BLEU is a comparison of sentences that returns a score that indicates how identical the hypothesis translation is to the reference translation(s). TER is a registration of modifications/edits required for a candidate translation to mirror a reference sentence. 2 Background in NLP and Machine Translation In this section, I will give some background knowledge on the status of Danish language technology and machine translation. 2.1 NLP in Denmark and beyond Natural language processing (NLP), natural language generation, natural language understanding, text-to-speech, chat bots, conversational AI, and machine translations are just some of the terms included under the ever-growing umbrella of language technology and computational linguistics. Advances in processing power and data availability have resulted in a plethora of opportunities with these technologies. As mentioned beforehand, language technology has come a long way. Even though the print press originated in China centuries before Johannes Gutenberg’s print presser saw the light of day around the middle of the 15th century, it can still be seen as one of many instalments in a long line of technology initiatives that have helped produce, generate, understand and learn language and meaning. Fast-forward a couple of centuries and the famous Alan Turing, who gave name to the Turing Test, which sets out to determine whether a machine is intelligent or at least can simulate intelligence. I am not going to discuss the validity of the test, but I want to note that the interesting part is the question asked and whether such a thing as artificial intelligence exists. To take this idea further, you can ask if a machine is able to think instead of just displaying intelligence. In almost all literature and movies aimed at either the future and/or space adventures, there has been some sort of way of verbally communication from humans to a central brain or a nexus of sorts, which displays various degrees of passive compliance or active defiance depending on the author’s intended message. The computer has had the role of the villain or just as a household technology that would assist in everyday family life. As you read this, you might remember that you are low on milk and oats and utter the words ‘Hey Siri – Can you add milk and oats to my shopping list?’, which is confirmed either with a beep or a voice repeating your command. The future is now if you are from a well-sourced language domain. Native English speaking countries can reap the rewards of what the modern world has to offer, but other countries have to wait years to even see this technology and the possibilities that follow. Danish is one of those low-resource languages that have to wait, adapt or develop the technology themselves. Language technologies have the potential to assist humans in many situations, like voice-controlled user interfaces, educational purposes and so on (Pedersen, Rehm, and Uszkoreit 2012). Currently, inclusion and accessibility are prioritised by companies and public sector entities in Denmark, which entails government websites to be made available to people with reading disabilities or otherwise struggle to access information. At Gyldendal Uddannelse, the educational department at the publishing company Gyldendal, all learning materials, images and videos have to be created in a format that can be read aloud by the computer or an application. Usually, these reading applications are imported, like the reader from Amazon or Mozilla. They work to a somewhat satisfactory level but do not fully understand Danish, which is a problem. In order to develop Danish solutions, we would need a stronger foundation as mentioned in the introduction. There would be both commercial and intangible gains when developing better Danish models. Oddly, we are so far behind on this sort of technology considering Denmark is one of the most digital countries in the world. According to the Digital Economy and Society Index (DESI) 2021 (Digital Economy and Society Index 2021), the digital infrastructure in Denmark ranks top among the EU countries. This entails availability of internet access, 5G readiness and so on. Furthermore, the report puts Danish small and medium enterprises in 1st place when ranking SMEs with a basic level of digital intensity, meaning they employ at least four digital technologies that ‘enable businesses to gain competitive advantage, improve their services and products and expand their markets.’ These could be big data, cloud solutions or the loosely defined AI (Digital Economy and Society Index (DESI) 2021). The Danish market is ready for high-quality solutions and the Danish digital government has also been promoted as one of the best globally. In Denmark, digital governance has been a priority since the 1990s when digitalisation, digital strategies and several other initiatives were launched. In the following years, Denmark has benefited in a number of ways from these and has ranked at the top of the list regarding public sector digitalisation. Public health, taxes and communication between citizens and public authorities have all been boosted by these initiatives. In April 2019, stakeholders from the Danish government, the Danish Language Council and other peers published ‘Sprogteknologi i verdensklasse’. The report mapped the current state of Danish language technology, what challenges lie ahead and gave suggestions to which areas within the field of language technology should be prioritised. These suggestions were based on surveys and workshops with researchers, developers, end-users and suppliers. An initiative to aid the development of Danish language technology is sprogteknologi.dk$^1$. It is a website created in 2020 by the Centre of Data and Technology a subdivision of the Danish Agency of Digitalisation. Metadata on Danish language resources and tools are available to use for everybody with an interest in Danish language technology and artificial intelligence. These are named entity recognisers and language models like BERT and Danish Electra, which are some of the state-of-the-art models in Danish. In their own words, ‘the primary goal is to support the development of artificial intelligence in Danish and to make sure that the digital language in Denmark is Danish’. The metadata and resources are continuously collected in an agile manner to conform to the user’s needs, which is a reflection of the rapid development happening in the field. There is also a political motive behind the initiative agreed upon by the government, KL – Local Government Denmark and Danish Regions. In addition to the employees $^1$ https://sprogteknologi.dk/ at the Centre of Data and Technology, a panel of experts from various organisations, like the University of Copenhagen, the Danish Language Council and Rigshospitalet, just to name a few, have also been included in the steering group to give advice. The steering group and other stakeholders call for better practices for gathering data and lobbying for a legal framework that makes data sharing easier for Danish NLP users. This would benefit the development of a foundation to further boost Danish NLP created by Danes with Danish principles. The European Language Coordination have their repository with parallel corpora amongst other readily available resources. This has been used to train their tool eTranslation. Machine translations have progressed to a point beyond the unintelligible, often laughable, attempts at translating snippets of text in one language into another, either for students or for professionals to save time on assignments. The quality of machine translations surpassed an adequacy threshold at some point, which has actually made them useful and they are now an essential tool for translators and other stakeholders in different domains like law or public health or even just general speech and text. 2.2 Related work – State of the art Machine translations have been around for a long time. The automatic machine translation systems we see now are the product of many years of research and attempts at breaking the language barrier. Historically, there have been some major shifts that need to be mentioned. The first shift was from rule-based machine translations to example-based around 1980. Rule-based systems were the initial translation systems and encapsulate a pragmatic approach to translation. They saw the light of day around 1950. They are constructed by an expert who makes a set of linguistic and grammatical rules and structures and the machine is taught a vocabulary in both languages, which is very time-consuming. This approach works well for everything unambiguous, but not many sentences contain words without several interpretations and thus the output is generally of a low standard (Sepesy Maučec and Donaj 2020). Example-based systems also signify a straightforward approach to translation. Example-based systems are corpus-based, meaning they have bilingual corpora at their disposal. As the name suggests, the system dives into a corpus to locate examples that match the given input and finds the corresponding sentence that matches. The output is thus a patched version of sentences that match in some way or another. In 1990, statistical machine translation systems gained ground and are still widely used today. They also incorporate corpora in their approach to translation and the training phase. They are trained on a large corpus consisting of gold standard translations and from this are able to create a statistical translation model. This is essentially a table of phrase frequency, which logs how often a phrase is encountered throughout the entire corpus. The probability of that phrase being correctly translated in the first place increases with the number of times it is put into the table. The probabilistic design works very well when a lot of data is available. For an overview of the performance of statistical machine translation, see figure 3 in the appendix. This is both a strength and a weakness since it is scalable but also vulnerable to data sparsity. Large amounts of training data are also a challenge faced by neural machine translations. The newest shift happened around 2015 as major machine translation services started transitioning to this kind of translation. Neural machine translations is using neural networks to train a statistical model for automatic translation. In theory, neural machine translations simulate how a brain works and learns to analyse text as it is presented with more data. In a sense, it is trained to recognise relationships amongst a large amount of data through various algorithms. A simple neural network consists of an input layer, a hidden layer and a target layer. These layers are connected by nodes to simulate the brain-like structure. When given an input, neurons calculate where the strongest relationship is and gives the information to the next neuron. Typically, the neurons have a certain value that determines whether the information should be passed or not. The input is looked at not sequentially but as a whole. The increasing amount of hidden layers in the simple neural network starts to form a deep neural network. In essence, a deep neural network teaches a computer how to solve a problem instead of telling it how to solve it. This can be used to train computers for a number of tasks that resemble intelligence or at least a higher level of cognitive ability than the basic statistical model. One of these tasks could be image processing or speech recognition or even machine translation. The way this training happens is also a vulnerability as spamming incorrect answers might disturb the algorithm and might be accepted as the correct answer and thus creating a new reality. For instance, when ‘Donald Trump’ appeared on Google when you searched for ‘idiot’. There is a black box element to the hidden layers as they are difficult to correct once the damage has been done (Wu et al. 2016). In order to elevate the quality of natural language processing, the concept of ‘Transformers’ and ‘attention’ were introduced. This was done to solve some of the problems with ambiguity, where the confusing word is identified along with the most important other elements that help clear up the ambiguousness. In a Danish context, some of the most recent influential transformer models are Danish BERT\textsuperscript{2}, Ælæctra\textsuperscript{3} and Danish Røberta\textsuperscript{4}. The Ælæctra-model is trained on the Danish GigaWord Project\textsuperscript{5} and requires much fewer resources for training and processing. This shows that there are possibilities for Danish NLP (Vaswani et al. 2017). The transition to neural machine translation has shown an improvement in the quality of machine translations. In a study on post-editing, Koponen et al. report that a comparison between neural machine translation and statistical machine translation showed ‘an overall reduction of errors as well as a reduction in specifically morphological errors and word order errors in various language pairs’ (Koponen, Salmi, and Nikulin 2019). Furthermore, in an update on the evaluation of Google Translate translations and which languages perform best and worst, the top 10 were: German, Afrikaans, Portuguese, Spanish, Danish, Greek, Polish, Hungarian, Finnish, and Chinese. This study was done using a variety of evaluation metrics. Thus, it might be as bleak a picture as has been painted for Danish machine translation (Aiken 2019). 2.3 Translation tools In this section, I explain why I have chosen the three translation tools I have for the analysis. I chose eTranslation, Google Translate and DeepL as the translation tools for this analysis for different reasons. First, the three tools are all free to use, although DeepL does not allow document translation for enough documents to do this examination without paying a subscription. As mentioned previously, eTranslation was highlighted as a tool for public sector translation due to data security and a reported rise in quality. I chose Google Translate as one of the tools because it is so widely used and has always been the tool to beat regarding the quality of free online translation. According to the recently published European Language Industry Survey 2022 (ELIS Research 2022), DeepL is the preferred choice by language companies. Furthermore, DeepL claims to be much better than market competitors such as Google Translate. In addition, DeepL offers translations in a good number of languages. 2.3.1 eTranslation Built upon a framework of the predecessor, MT@EC, eTranslation is the product of the natural progression towards neural machine translations, which is the new black within the field. The Connecting Europe Facility’s (CEF) eTranslation has been trained on various domains, comprising \textsuperscript{2} https://sprogteknologi.dk/dataset/ebdcd8fc-49ff-406a-83d8-2232aad95d0d \textsuperscript{3} https://github.com/MalteHB/-l-ctrn \textsuperscript{4} https://huggingface.co/flax-community/roberta-base-danish \textsuperscript{5} https://gigaword.dk/ 1 billion sentences from the Euramis translation memory. eTranslation offers translation between all the languages of countries part of the European Union, English, Norwegian and now also features Arabic and simplified Chinese resulting in +30 languages. The corpora’s origin are EU documents translated by translators connected to the EU institutions and thus the domains offered by eTranslation all relate to the nature of official EU articles (‘What Is ETranslation’). One of the strengths of eTranslation is exactly that of domain-specific translations, which, in theory, should offer more accurate translations in specialised areas such as law and public formal language. It is worth noting that in almost all translations not involving English, English is still used as a pivot language, meaning that a Danish to Polish translation would be translated from Danish into English and after that from English to Polish. This is a normal practice when data between language pairs is limited, as there usually exist parallel corpora between English and Danish and English and Polish. This feeds a different discussion on the growing amount of Anglicisms in otherwise ‘pure/clean’ translations and the quality hereof when introducing a third language to bilingual translation (Benjamin 2019). eTranslation is available, but not available to everybody; however many stakeholders can get access. Freelance translators for the EU, students, public administrations, territorial management units and recently small and medium-sized enterprises have access to the tool as long as they create a log in. 2.3.2 Google Translate Although Google Translate does not have any domains, it supports over 100 languages and still adds to that list. Google Translate was born in 2006 as a statistical phrase-based machine translation tool and although some of the translations were laughable, there was still a use for the tool. It grew in popularity and became a mainstay Google application. In 2016, the transition to state-of-the-art neural machine translation happened and since neural networks have the ability to learn as they are used and are provided with enough data, Google Translate has developed into a powerful tool (Wu et al. 2016). The company Google has also made advances on every front in the later years and acquired many other services, like image recognition and the browser Google Chrome with Google’s applications integrated making Google Translate very accessible to users. Although there is a cap of 5000 characters on text snippet translation, the cap can be raised by paying for additional services. According to Google’s blog, the transition to neural networks meant that ‘It uses this broader context to help it figure out the most relevant translation, which it then rearranges and adjusts…’ (Turovsky 2016). What is meant here is that when given an input, Google Translate browses a huge amount of documents and resources for a sentence matching the input with an appertaining sentence in the target language. 2.3.3 DeepL DeepL is an extension of an online dictionary called Linguee. Linguee was formed in 2009 and scraped text samples of a bilingual nature, which were then post-processed by linguists and language specialists to give additional information on the dictionary entries. Given technological advances and the rise of neural machine translation in 2016, DeepL was launched in 2017. It uses the same approach as Google Translate, uses English as a pivot language, offers text-document translation, and holds a 5000 character limit. There is also a 100,000 character limit on documents when using the free version of DeepL. A feature that separates DeepL from others is a glossary option for text translation. This is due to the foundation of Linguee’s manually translated text samples, sentences, and idioms and the rest of the data available from there. This means that synonyms and similar phrasings are offered when translating live. According to their website, they outperform competitors, Google, Amazon and Microsoft, based on reviews on 119 paragraphs in different language pairs analysed by external professional translators (‘https://www.deepl.com/press.html#press_comparison_article’). Translations are offered in 24 different languages, 22 of which are European (with Portuguese offered as Brazilian as well) and two Asian, Japanese and Chinese (Simplified). There is a disclaimer though, which seems to undermine DeepL as a serious candidate for public institutions and other businesses and it reads ‘I will not use DeepL Pro for the purpose of operating critical infrastructure (as outlined in the Terms & Conditions) and acknowledge that, due to its nature, machine translation may be imprecise.’ 3 Evaluation methodology In this section, I elaborate on metrics used for the quality assessment, BLEU score, TER score and the error typology. 3.1 Evaluation metrics 3.1.1 BLEU score To automatically evaluate on an objective basis and make machine translation evaluations more effective the Bilingual Evaluation Understudy Score was introduced in 2002 by Kishore Papineni et al. The people behind the BLEU score wanted to help ‘MT progress’ and free the ‘logjam of fruitful research ideas’ from the ‘evaluation bottleneck’ (Papineni et al. 2001). The idea was to perform an automatic evaluation of the quality of different machine translations cheaply and objectively. BLEU score is a metric for evaluating a machine translation by matching a candidate and a reference translation either at sentence-level, but is most suited for corpus-level evaluation. The reference translation is done by a human translator and serves as the gold standard. The approach of the BLEU score is a combination of several computations. Fundamentally, it is a direct unigram comparison between candidates and reference sentences, thus measuring resemblance to human translations. A score is between 0 and 1, with 1 being exactly the same and 0 meaning that there is no agreement between candidate and reference sentence. As mentioned before, there are as many interpretations and translations as there are humans, so neither humans nor machines are expected to score a perfect grade. In practice, the most basic application would be to have two candidates: 1a) Candidate sentence 1: ‘This initiative is has been developed to meet this challenge.’ 1b) Candidate sentence 2: ‘This strategy is designed to facing the dispute.’ 1c) Reference sentence 1: ‘This initiative has been developed to address this challenge.’ 1d) Reference sentence 2: ‘This initiative has been developed to meet this challenge.’ In this example, it is obvious which candidate will score the highest score for humans. Candidate sentence 1 is more intelligible and shares more words with both reference sentences. An algorithm comparing n-gram matches would also find this task easy and could effortlessly identify candidate 1 as the best translation. More n-gram matches result in a higher score. However, this is pretty naïve and not without pitfalls. The BLEU score was therefore revised and made into a modified n-gram precision score. Precision is a well-known concept in information retrieval; it is essentially a measure of how much of a selected amount of data was relevant and is accompanied by recall, which is a measure of how much relevant data was selected. To accommodate for the lack of recall in the BLEU score, a brevity penalty is introduced. The modified n-gram precision score is an implementation of a sort of inhibition of return that checks off a word in the reference sentence when it encounters a matching word in the candidate sentence. An excellent example is provided by Papineni et al. (Papineni et al. 2001) that illustrates this pitfall, namely: ‘Candidate: the the the the the the the the. Reference 1: The cat is on the mat. Reference 2: There is a cat on the mat. Modified Unigram Precision = 2/7’ Had it just been the naïve unigram comparison, the score would be 7/7 because all the words in the candidate were present in Reference 1. Had the candidate sentence consisted of only two tokens ‘The the’, the score would still be disrupted. Moreover, a comparison of only unigrams would merely show the adequacy of the translation illustrated by a high score. Adequacy is a metric used for machine translations that measures a translation’s understanding of the meaning. A high score on bigger n-grams, mainly 3 and 4-grams, indicates fluency, a different metric for machine translations (Snover et al. 2009). In a study on what users deemed to be worst for a translation, the researchers found disfluent texts to be the most disruptive, whereas users did not feel as strong for adequacy (Martindale and Carpuat 2018). The modified precision is thus all the checked n-gram counts for every candidate sentence in the corpus divided by the amount of candidate n-grams, which is usually no higher than 4. Machines show an exponentially lower precision when the number of n-grams is increased, which spills into how the brevity penalty ‘punishes’ shorter sentences. As mentioned, the brevity penalty would prevent the sentence from the previous example from achieving a high score. The brevity penalty ensures that the candidate sentence corresponds to the length of the reference sentence, choice of words and word order. In cases with several reference sentences consisting of 6, 8 and 10 words respectively, a candidate sentence of eight words would correspond to the reference sentence of eight words and the brevity penalty would be 1, which is relevant for the later calculation of the BLEU score. The closest sentence would be considered the ‘best match length’. The way Papineni et at. designed this was to enforce the penalty at corpus level to avoid punishing shorter sentences and to ‘allow some freedom at sentence level’ (Papineni et al. 2001). The best-matched length sentences are summed for each candidate in the corpus, thus finding the effective length of the reference corpus. This is used for the formula: \[ r = \text{Effective corpus length} \] \[ c = \text{Candidate corpus’ total length} \] \[ BP = 1 \text{ if } c > r \text{ OR } BP = e^{(1-r/c)} \text{ if } c \leq r \] The penalty is decreasing as n-grams are increasing in correlation with the performance of the machine, namely exponentially. It is possible to adjust the weights of n-grams to satisfy either adequacy or fluency, but for the baseline calculation of BLEU in = 4 and an equal weight between the n-grams is 0,25. Collecting all the parts of the BLEU score result in a calculation that looks like this: \[ \text{BLEU} = \text{BP} * \exp \left( \sum_{n=1}^{N} w_n \log p_n \right) \] Here, BP is the brevity penalty, $ N = $ number of n-grams, $ w_n $ is the weight of each modified precision, $ (p_n) $, which is usually the same (0,25) for each unless different aspects of analysis are desired. This results in a measurable metric between 0 and 1, where 1 is an identical translation. (Papineni et al. 2001). Below is seen an overview of how the scaling of the BLEU score could be estimated (https://cloud.google.com/translate/automl/docs/evaluate?hl=da). \| BLEU score \| Quality of translation \| \|------------\|------------------------\| \| < 0,1 \| Discardable translations \| \| 0,1-0,19 \| Almost unintelligible translations \| \| 0,2-0,29 \| Somewhat understandable, but with grammatical errors \| \| 0,3-0,39 \| Good translations \| \| 0,4-0,49 \| High-quality translations \| \| 0,5-0,59 \| Translations are of high adequacy and fluency \| \| 0,6-0,69 \| Equal to or better than human translations \| \| > 0,7 \| Almost similar translations \| Figure 1 Scale of the BLEU score Preprocessing the data also has an effect on the outcome. Tokenisation is crucial for comparing candidate sentences and reference sentences, for instance, the removal of punctuation affects the n-grams given that commas and other punctuation marks can inflate scores. The advantages of the BLEU score are several. Firstly, it gives a quick and measurable quantity for evaluating machine translations. Adding to this point, it can do so at a corpus-level as well with multiple references if available for better quality estimation; not only for short and simple sentences, meaning that it can be applied as a metric in other areas of natural language generation and processing. I use the corpus-level BLEU score in my analysis. Additionally, the BLEU implementation is quite simple and straightforward and further development of it has already been completed, most notably the SacreBLEU, presented by Matt Post (Post 2018). According to the research done by Papineni et al., the BLEU score is also a useful tool, due to the high correlation it has with human judgement and a > 95 correlation coefficient of monolingual and bilingual groups is reported in their paper ‘BLEU: a Method for Automatic Evaluation of Machine Translation’ (Papineni et al. 2001). 3.1.2 Critiques of the Bilingual Understudy Score The BLEU score is not without fault though and has been the subject to many raised fingers concerning several issues. As mentioned previously, human translations are considered the gold standard and there exist as many ‘perfect’ translations as there are translators. These may differ enough to skew the result of an evaluation and all reference translations have to meet high standards. Another issue is the lack of grammatical, syntactical or linguistic consideration. Even with a brevity penalty and modified precision, a single word makes up more than a number in the statistic. A negation, or the removal of one, has a huge influence on the meaning; a name/entity spelt wrong, like USB instead of USA, would also be considered a massive fault, but the score does not suffer adequately. This is also true when distinguishing between function words and context words. A translated text passage can usually be understood if a few function words go amiss but replace a few context words with incorrect ones and you will have a semantic disaster. Another critique of BLEU is that there are ways to manipulate and inflate scores. The pre-processing procedure has to be the same for both candidate and reference text or the comparison is deemed invalid, as the comparison would simply not be done on the same reference. Keeping the data ‘sterile’ is also desirable since pre-processing has major repercussions on the scores (Post 2018). There are no standards for pre-processing in the field of machine translation, thus leaving a lot of room for divergent approaches and scoring. A trick to achieving a higher BLEU score is to get rid of obscure words if the words do not appear in a vocabulary of maybe low-resource language, thus obstructing the scores. Furthermore, the calculation of BLEU score is a conglomerate of variables that all affect the result in many ways even though there are unspoken standards, such as keeping the n-gram count to 4 and the weights evenly distributed. If you only run BLEU on unigrams, you could also change the output score. You can also negatively affect the score if you have poor grammar and were to type an error-filled sentence into a translator. The fact that BLEU scores are calculated on sentences and strings means that it is not the overall translation quality that is analysed. The BLEU score has however been elevated by people to a guarantee of quality, despite the fact that experts call for comparisons at corpus-level instead of sentences, which would yield better results. The many reference sentences may also affect the performance of BLEU, by yielding low scores to otherwise well-translated candidates that simply do not match the references on enough criteria (‘Understanding MT Quality: BLEU Scores’). BLEU does not account for anything other than how similar a translation is to one or more references and even so, synonyms are considered an error. However, there are metrics that build on BLEU that address this issue among others. METEOR (Banerjee and Lavie 2005) is an evaluation metric that stems and matches synonyms. More specifically, it does the same as the BLEU, but stems from unmatched words and tries to find a match. Furthermore, METEOR adds a penalty to the order of words. As mentioned before, there is an improved BLEU implementation called SacreBLEU that was born from a need for standardisation. Matt Post, the author of SacreBLEU, does not discard BLEU as an evaluation metric but objects to how scores are reported. The tips and tricks mentioned earlier all contribute to a murky picture when comparing BLEU scores between papers. Post (Post 2018) suggests that SacreBLEU is used instead of the regular BLEU to combat irregularities in the machine translation evaluation community and at the Workshop/Conference on Machine Translation (http://www.statmt.org/wmt21/). METEOR and SacreBLEU offer improvements to the BLEU score but are still only indicating similarity between candidate and reference sentences. They do not say anything about how much post-editing is needed, which is also a quality stamp. Translation Edit Rate (TER) is a post-editing measurement that gives you a score depending on how much effort a human translator would have to make in order to make a candidate match a reference sentence. The lower the score the better the translation (Snover et al. 2006). 3.1.3 Translation Edit Rate Translation Edit Rate (TER) is a post-editing measurement that gives you a score depending on how much effort a human translator would have to make in order to make a candidate match a reference sentence. The lower the score the better the translation (Snover et al. 2006). A high BLEU score and a low TER score are signalling a strong machine translation. These two evaluations metrics can save a human translator time and thus create value for a company or freelance translator. TER is easy to explain as it is the quantification of editing to correct a candidate sentence. In this context, an edit is defined as ‘(...) insertion, deletion, and substitution of single words as well as shifts of word sequences. A shift moves a contiguous sequence of words within the hypothesis to another location within the hypothesis.’ (Snover et al. 2006). Hypothesis and candidate are synonyms in the BLEU score context. In addition, punctuation and capitalisation mistakes are treated as an edit as well. The way this enters in a TER calculation is by counting the number of edits and then dividing that by the number of word tokens in the reference sentence. Snover et al. are using more than one reference in which case you would normalise the average length of the reference sentences. \[ \text{TER} = \frac{\text{Number of edits}}{\text{Average number of reference words}} \] However, in my case, I am only using one reference, but the calculation stays the same. In practice, this would look like this: 2a) Reference sentence: ‘This Christmas, Coca Cola finally accepted blame for turning Santa red.’ 2b) Candidate sentence: ‘Coca Cola finally accepted blame this Christmas for turning santa red.’ Here, a few things would trigger the edit counter even though a human would be able to read and understand it easily. The shift in ‘This Christmas’, the deletion of the comma after the start adverbial and the missing capitalisation in ‘Santa’ are three edits. This gives the following formula: \[ \frac{3}{11} = 0.27 = 27\% \] which is decent. A score of 0 would be identical to a reference sentence and a 1 would require a complete rewrite of the candidate. To evaluate a full corpus, TER.corpus_score is used. It takes the total number of edits registered and divides that by the total amount of words in the corpus and then multiplies it by 100. The best TER score is 0% but is unrealistic. A good TER score is around 30% and increasing numbers means more post-editing (‘https://help.inten.to/hc/en-us/articles/360020528540-MT-quality-metrics’). Like BLEU, TER correlates well with human judgement and is a good indicator of the quality of a machine translation. However, an automatic TER evaluation would need four references because ‘TER score with 4 references correlates as well with a single human judgment as another human judgment does’, but fewer references can work for research purposes (Snover et al. 2006). TER does not identify error types or patterns in the reference and candidate sentences and is dependent on the reference sentence being of a high standard. Mistakes in the reference sentence will inevitably be catastrophic to the whole calculation of TER. Other improvements to TER could be to adjust the weight of penalisations or add a custom vocabulary depending on your needs. For example, insertions are to be deemed lighter than deletions. For the corpus score, you could also look to add a weighted average based on the number of tokens in a sentence. This would make a long sentence count for more than a short sentence (Snover et al. 2006). 3.1.4 Error Typology Inspired by Larsen (2021) I have created an error typology of the most common mistakes in machine translation. Potential challenges when translating to and from Danish might be compound nouns, comma rules and particle verbs (Pedersen, Rehm, and Uszkoreit 2012). The first four mistakes in bold are identified by C. Larsen and I have added some subcategories to the ‘Miscellaneous’ to help specify what this includes. I identified the subcategories and the need for a ‘Named Entity’-category upon initial examination of the translations: \| Error typology \| \|----------------\| \| Inconsistent terminology \| \| Omissions/additions \| \| Negations \| \| Made-up words \| \| Named entities \| \| Miscellaneous/other than the above \| \| - Literal translation \| \| - Metaphors/Idiomatic expressions \| \| - Meaning interpretation \| \| - Lexical ambiguity \| \| - Phrasal verbs \| \| - Prepositions \| Figure 2 Overview of categories and subcategories in the error typology Inconsistent terminology: Consistent terminology is important in formal/official documents where there are a lot of technical language and terms and there can be little to no doubt about the message conveyed. If a translation tool is not able to use and adapt to domain-specific terminology, it is less applicable. When calculating the BLEU score, synonyms are also seen as errors even though they are a big part of the general text-domain. Even though the style might be a bit looser in the general text domain, it --- 6 https://sprogteknologi.dk/uploads/page_images/2022-02-23-104655.408610eTranslationpp.pdf could still be disrupted if the jargon is not held. This could be in the finance domain, where a clean opinion means that an account gives a true and fair view and has a Danish counterpart. Omissions/additions: This can be seen as a quality marker of how good a machine translator is at looking at context and ‘understanding’ meaning. A small caveat to this error type is that it can be difficult to determine, whether an omission/addition of a semantically heavy word has led to a meaning misinterpretation or the other way around. An omission would inevitably lead to a meaning misinterpretation, but it can be difficult to determine if it is the chicken or the egg. Furthermore, the addition or removal of punctuation also holds great value for a sentence. In some instances, words are simply missing in the translated version, thus distorting the meaning. Negations: Negations hold great semantic value even though they are not deemed more important than other tokens during a BLEU evaluation. The same caveat as before is valid here since misunderstanding the sentence can lead to a negation error or that the negation error leads to misinterpretation. Made-up words: This error type is typically seen when encountering unknown terms or new phrasings, for example during the beginning of the Covid-19 pandemic. How do the tools translate a term like Covid-19? Danish and English have different ways of spelling this. Named entities: This is similar to the inconsistent terminology, only with names and when to translate them. There are various EU institutions and Danish ministries mentioned in the corpora and some of them have an international name, some of them do not. Furthermore, if a translation tool encounters an unknown entity, the challenge is: How to either translate it or how to find the correct version in a database. Miscellaneous: This category seeks to hold ‘the rest’ and is therefore expected to be higher than the other error types. There can be sentences with correctly conjugated words and tense agreement, but with a phrasing/wording that is unintuitive in Danish or English, which can be penalized. Anglicisms or Danish phrasings also fall under this subcategory. Errors of this type can be of a semantic nature, such as meaning misinterpretation. In the general text domain, metaphors are often used to enrich text or help explain abstract concepts through non-literal methods. Metaphors and idiomatic expressions can often lead to very literal translations. These are often a challenge for a machine translator since it has most likely not seen any occurrence of such wording before and would only be able to give a good translation after encountering many occurrences of that. Another error type that would fall under this category is the correct use of prepositions. Like negations, prepositions are important to a sentence and even though they might not have a huge impact on the BLEU score, they might hold great semantic meaning. In addition, BLEU does not distinguish between function- or context words. Lexical ambiguity describes the incorrect choice of words when a word has more than one meaning. In addition, some sentences lose their subject along the way or the word order is messed up and these are also the types of meaning interpretations that fall under this category. I will address these errors and look at whether they are still common mistakes or have been eliminated (Larsen 2021). To get an idea of the frequency of each error and if they are still a problem, I will manually examine approximately 2% of the sentences from each corpus. Figure 4 in the appendix is an example of how I have done this. 4 Results and Analysis In this section, I describe my data and present my results and analysis. I start by describing the corpora, how they have been processed and relevant information relating to them. Then I present the individual analysis of each tool in both English to Danish and Danish to English. I follow this with a comparison of the tools, errors and other points where they are similar and different. 4.1.1 Data: Selected corpora To perform my analysis, several parallel corpora in different domains were needed. The European Language Resource Coordination (ELRC) consortium has a language repository for the disposal of everybody. A number of domains are available, though not all domains are supported for every language. The datasets we chose for the evaluation span several domains, all within the frame of EU interests. The parallel corpora I chose from the ELRC are from the public health, finance, cultural and general text domains ('ELRC-SHARE'). The domains I have chosen are from a usability standpoint since these domains are deemed most useful for the end-users. In the report 'Sprogteknologi i verdensklasse', a big part of the participating stakeholders are involved with the public sector. I have chosen the public health and finance domains to explore the possible application of eTranslation or another tool, for companies in these sectors. In order to get a broader evaluation and to explore different challenges, I chose the culture and general text domains to counterbalance the two domains with a very strict formal writing style. If the tools are able to produce good translations for the cultural and general text domains, machine translation might be used in new contexts, which have otherwise been restrained from using it. The corpora are all available in an XML format. Below is an overview of the sizes of the corpora. \| Domain \| Bilingual corpus from the Publications Office of the EU on the medical domain v.2 \| Bilingual Danish-English parallel corpus from the State Audit Office (Rigsrevisionen) website \| Bilingual English-Danish parallel corpus from Aarhus 2017 – European Capital of Culture website \| Bilingual English-Danish parallel corpus from Danish Working Environment Authority website \| \|-------------------------\|--------------------------------------------------------------------------------------\|------------------------------------------------------------------------------------------------\|------------------------------------------------------------------------------------------------\|------------------------------------------------------------------------------------------------\| \| No. of sentences \| 13242 \| 8233 \| 4708 \| 1137 \| Table 1 Names, domain and size of selected corpora 4.1.2 Data: Description and processing To be able to evaluate the translations given by eTranslation, Google Translate and DeepL, I will use a Bilingual Evaluation Understudy score, henceforth ‘BLEU score’, which will be explained in-depth in a later section. For now, it is enough to mention that it is a metric, which compares a reference sentence from the source language to a candidate sentence from the target language. This means that the corpora have to be converted from XML formatting to a .txt-file. I have a script that allows me to select and extract sentences in a language in a corpus, i.e. Danish or English, and put them in a .txt-file in a structured manner with the new line white space character ‘\n’ added after each extracted sentence. They are ordered so each sentence has its line, which helps the sentence-matching feature of BLEU. Following this step, the corpus can be translated by a tool and used for evaluation as the gold standard. The evaluation is done by using a BLEU function from the Natural Language Toolkit: NLTK-BLEU (‘https://www.nltk.org/_modules/nltk/translate/bleu_score.html’). The function itself takes a file of both the target corpora and the source corpora and matches each sentence from the reference corpus with the target corpus. However, the function does not work if the corpora do not have the same amount of sentences. DeepL’s aforementioned character cap also means that sections of the corpora have been broken into smaller files of < 5000 characters to accommodate this resulting in smaller corpora sizes. Then, DeepL translated the documents and the outputs were put into new .txt files and stitched back into one corpus to be evaluated instead of evaluating each translation snippet and averaging the scores. In contrast to DeepL, eTranslation and Google Translate do not have this cap on documents and return them in the same format they were uploaded in. On eTranslation, the translations are available for download for 24 hours and are terminated afterwards, whereas translations from Google Translate are downloaded immediately. When performing translation tasks with the three tools, the structure of the files, e.g. line breaks, sections and so on, are maintained in the output, which eases post-editing. The three translation tools can be assessed and compared on different parameters and across different domains. Firstly, I will look at the individual performance of eTranslation in both English to Danish and Danish to English and then do the same for Google Translate and lastly for DeepL. Secondly, I will highlight different areas that distinguish the three tools from each other and compare their performances. I look at the BLEU scores, TER, and analyse manually registered error types in extracts of 2% of the sentences from the corpora. Even though eTranslation offers domain-specific translations, all corpora were translated using the general domain to ensure the fairest foundation for comparison between the tools. 4.2 Individual assessment Overall, the performances of eTranslation, Google Translate and DeepL are very good. All the translations are readable and fluent. It is therefore easier to highlight the mistakes to illustrate the shortcomings and challenges there are, instead of finding examples of successful translation, which are plenty. It is worth noting that a successful translation can be a candidate sentence that is identical to a reference sentence when measuring BLEU and TER. I have colour coded the results of the BLEU and TER scores to help readability. I change colour every 0.1 decimal and 10% point. The error typology tries to find readable and well-translated sentences, not necessarily the most identical like BLEU. This means that a successfully translated sentence in this instance is not necessarily a complete copy of the reference sentence, but is a sentence that is readable and captures the correct semantic meaning. 4.2.1 Results for eTranslation: Unsurprisingly, the BLEU score suggests that eTranslation has done well on the datasets that are available to it through ELRC. The general impression when examining the translations is that they are fluent and readable, which is reflected in the > 0.65 scores for both English to Danish translations and vice versa (https://cloud.google.com/translate/automl/docs/evaluate?hl=da). This high standard is without any smoothing applied and the lowest scoring translation is 0.679 seen in the Danish to English unsmoothed finance domain translation in table 1. Although the general text domain scores significantly lower, it will also be treated as a chapter for itself due to its difference from the other domains. The common interpretation of the score range is that everything above 0.60 could be considered competitive with human translations. Even human translators do not score a 1 on other human translations since they rarely produce identical translations. A score between 0.30 and 0.40 would be considered a comprehensible translation without grave grammatical mistakes (https://cloud.google.com/translate/automl/docs/evaluate?hl=da). \| English to Danish \| Public Health \| Culture \| Finance \| General Text \| \|-------------------\|--------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0,818 \| 0,728 \| 0,685 \| 0,706 \| \| Smoothed \| 0,909 \| 0,758 \| 0,775 \| 0,737 \| \| TER \| 35,33% \| 44,99% \| 60,95% \| 53,83% \| Table 2 eTranslation’s BLEU and TER-scores for English to Danish translation The English to Danish scores are very good for both evaluation metrics. The high BLEU scores mean the translations are very close to the reference corpus. Furthermore, the low TER scores suggest that some-to-little post-editing would be required to produce a similar sentence to the reference. One of the differences between the domains is the way semicolons are handled by eTranslation. Semicolons are rarely used in Danish in comparison to English due to the strong Danish comma. It would be reasonable to think that a comma would replace a semicolon in these translations from English to Danish or a full-stop leading into a new sentence. However, in the finance corpus, all 51 semicolons in the finance corpus are replaced by full stops, the following word is not capitalised, which leads to errors since the semicolons occur mid-sentence as seen in the example below, highlighted in bold. 3a) Source sentence: ‘The objective of the Danish national parks is not only to strengthen and develop nature; national parks must also meet other objectives, eg, to promote an understanding of nature, tourism and business development.’ 3b) Candidate sentence: ‘Formålet med de danske nationalparker er ikke kun at styrke og udvikle natur. de nationale parker skal også opfylde andre mål, f.eks. at fremme forståelsen af naturen, turismen og erhvervsudviklingen.’ In the public health and general text corpora, semicolons are simply omitted in the translation without any replacement punctuation and finally, in the culture corpus, semicolons are kept in the Danish translation. The public health BLEU score is very high and is almost a 1:1 copy of the reference. This is also reflected in the TER score, which is low without being as impressive as the BLEU score for the public health translation. There is little post-editing to be done on this corpus, but the same cannot be said about the finance domain translation with a score of 60,95% meaning that the amount of edits is over sixty percent of the number of words. Below is a table showing the amount of error type occurrences registered in extracts of the corpora. The error types are registered across the whole extract and a sentence can contain more than one occurrence of the same error type. The number in parenthesis is the number of sentences an extract of text consists of. \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|---------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 4 \| 2 \| 0 \| 0 \| 37 \| 0 \| \| Culture (82) \| 3 \| 0 \| 0 \| 0 \| 36 \| 6 \| \| Finance (164) \| 11 \| 0 \| 0 \| 0 \| 36 \| 0 \| \| General (23) \| 10 \| 0 \| 0 \| 0 \| 4 \| 2 \| Table 3 Error types for the English to Danish translations from eTranslation Given that the content of the four corpora is EU-related, you would not expect EU-related terminology and named entities to be an issue. This is also the case as table 2 shows as there are low amounts of errors and a majority of the translated sentences convey the same meaning as the reference. The most noticeable thing in this table is the few-to-non-existing errors other than inconsistent terminology and miscellaneous. The inconsistent terminology is mainly a reoccurring single term, like ‘near miss’ in the finance corpus, which in this context is a term related to the Danish Working Authority. In the Danish reference corpus, the correct term is ‘nærved hændelse’, but it has been translated in a plethora of different ways like ‘næsten fejl’, ‘nær ved fejl’, even ‘nærmiss’ or ‘nær miss’. Besides the incorrect translation, the incoherent translation is interesting to note as well, since it is the same wording to be translated throughout the corpus. An error in the miscellaneous category in the culture corpus highlights the aforementioned difficulties with idioms and underlying meaning. This is an example of eTranslation’s attempt at handling an idiomatic saying: 4a) Source sentence: ‘Thus, we also highly value the good advice and recommendations we’ve received ‘along the way’,” says CEO of Aarhus 2017, Rebecca Matthews.’ 4b) Candidate sentence: ‘Derfor sætter vi også stor pris på de gode råd og anbefalinger, vi har modtaget "på lang vej",’ siger CEO for Aarhus 2017, Rebecca Matthews.’ The fact that ‘along the way’ is in quotation marks indicates some kind of deeper understanding is needed. The translation is a blatant mistake that underlines the difficulties eTranslation still faces. Another thing I note is the translation of ‘CEO’ or the lack thereof. CEO is used in Danish, but has an international/business profile to it, whereas the Danish word ‘Direktør’ is readily available. It is difficult to know when and what to translate and what to leave. One of the few named entity errors is an example of exactly that. In the culture corpus, the report mentioned in this sentence ‘This is all to be found in the report ”Aarhus European Capital of Culture 2017 - Second Monitoring Meeting” that the EU has only just published on their homepage.’ has been translated into ‘Aarhus Europæisk Kulturhovedstad 2017 — Andet overvågningsmøde’, which is not an incorrect translation. However, when looking at the Danish reference corpus, the name of the report is not translated and the correct thing would be to leave the title as it is. An example of how eTranslation does everything right, but still falls short is the translation of this sentence: 5a) Source sentence: ‘In cases where notification must be made immediately to the South Jutland Police or the Danish WEA pursuant to section 8 in the Executive Order on Notification, the operator and the owner, respectively, have the duty of notification.’ 5b) Candidate sentence: ‘I tilfælde, hvor anmeldelse skal ske straks til Sønderjyllands Politi eller Arbejdstilsynet i henhold til § 8 i bekendtgørelse om anmeldelse, har henholdsvis operatøren og ejeren underretningspligt.’ I want to highlight that South Jutland Police is the correct English name for ‘Syd- og Sønderjyllands politi’, but as is evident in the Danish name the police force covers the Danish region ‘Sønderjylland’ and the southern part of Jutland, hence the name needs to have 2 mentioning of south. eTranslation has translated this into ‘Sønderjyllands Politi’, which the correct literal translation of the input given. However, it is actually not the correct translation of the entity, but how should it know? In general, eTranslation does well on English to Danish translations and even better on Danish to English translations, though only by a few decimal points. Looking at table 3, it is evident that they are performing at a similar level. The BLEU scores follow the same trend as before with public health at the top and finance at the bottom, though still a respectable score. The nature of the corrections in Danish to English translations is much the same as the English to Danish translations. The high BLEU scores indicate very well translated corpora where the mistakes are mostly lexical choices, though the translated sentences still convey the correct meaning. Like the BLEU score, the TER scores are a mirror image of the English to Danish analysis. It is worth noting that the translation of the finance corpus is improved and now below sixty percent. The public health TER score is low again and the two other fall somewhere in between the two extremes and corresponds well to their BLEU scores. \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|--------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 3 \| 0 \| 0 \| 0 \| 24 \| 5 \| \| Culture (82) \| 0 \| 0 \| 0 \| 0 \| 28 \| 0 \| \| Finance (164) \| 16 \| 0 \| 0 \| 0 \| 43 \| 0 \| \| General (23) \| 9 \| 0 \| 1 \| 0 \| 7 \| 5 \| Table 5 Error types for the Danish to English translations from eTranslation The most striking thing when looking at table 4 is the columns of zeroes. There are no examples of omission/addition errors or negation errors whatsoever. Even the made-up word is an entity, meaning it could belong in the named entity category. It is definitely a positive that these sorts of errors are non-existing and proves that eTranslation can be used to produce high-quality translations although with some reservations. In the finance corpus, there is an example of the difficulties when looking at domain-specific terms. The Danish sentence to be translated looks like this: ’(...)skal afrapporteres i form af en revisionspåtegning og revisionsberetning senest 15. maj i året efter regnskabsåret,(...)’. The correct English translation for the two financial terms ‘revisionspåtegning’ and ‘revisionsberetning’ are ‘auditor’s opinion’ and ‘auditor’s report’, but have been translated into: ‘(...)must be reported in the form of an audit report and audit report no later than 15 May of the year following the financial year(...).’ There is no distinction between the two terms and the sentence loses some of its meaning. The only instance of an error with made-up words within this language pair using eTranslation is in the general text-domain. However, this could also be a named entity error. The name to be translated is ‘Arbejdstilsynet’, which has been translated correctly in the English candidate to ‘the Working Environment Authority’. In the same candidate translation, another occurrence of ‘Arbejdstilsynet’ has been translated into ‘the Labour Inspectorate’, which is not incorrect, as other countries’ counterpart is called Labour Inspectorate. eTranslation’s Danish to English translation also struggled with the police force of Southern Jutland. The resulting error is the same literal translation of ‘Syd- og Sønderjyllands politi’ into ‘South and South Jutland Police’, but as mentioned before, the English name is South Jutland Police. Table 5 sums up and compares the quality between the two with the highest score within each domain marked by bold. As is evident, Danish to English translations are superior in all but one instance. \| EN-DA / DA-EN \| Public Health \| Culture \| Finance \| General Text \| \|---------------\|--------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0,818 / 0,821 \| 0,728 / 0,743 \| 0,685 / 0,679 \| 0,706 / 0,707 \| \| Smoothed \| 0,909 / 0,925 \| 0,758 / 0,772 \| 0,775 / 0,828 \| 0,737 / 0,741 \| \| TER (in %) \| 35,33/33,48 \| 44,99/44,94 \| 60,95/58,18 \| 53,83/49,58 \| Table 6 Comparison of eTranslation’s BLEU scores There is not much between the translations from the two language pairs, where the highest-scoring pair is Danish to English. Both in terms of BLEU score quality and the nature of errors. From the scores reported, eTranslation can definitely be used as a tool for translation tasks for the stakeholders with access to it. Even the lowest scoring translations are still of adequate quality, but should not be used without post-editing as illustrated by the error typology. eTranslation also offers domain-specific translations, but actually scores lower than when using the general text function. These scores can be found in the appendix in tables 18 and 19. Examining the domain-specific translations indicated a reduction of a general vocabulary, but a better domain-specific vocabulary for the domain in question. The low editing numbers are further backing the usefulness of neural networks. As Larsen (2019) concludes in his rapport ‘Neural Machine Translation in DA Brief Assessment Report’ on why a transition to neural machine translation is beneficial that ‘the DA LD is overwhelmingly in favour of NMT (94% of respondents prefer NMT against only 6% SMT). Although the quality is far from what is found in human translation, respondents appreciate its improvement over SMT because less editing is needed.’ The issue when this report was conducted was the otherwise low quality that the language pair had. The generally low quality of machine translations is also pointed out, but as mentioned previously the quality has surged upwards in recent years and you can see the benefit from it in the scores reported. The errors I found are not completely ruining the translated sentences and it is a mostly stylistic and deeper semantic type of error. A tool that does not have any domain-specific setting is Google Translate. ### 4.2.2 Results for Google Translate Google Translate’s BLEU score results are of a similar quality to what eTranslation performed. I will be using the same error type backdrop as on eTranslation to help identify what sort of errors are present in the translations from Google. \| English to Danish \| Public Health \| Culture \| Finance \| General Text \| \|-------------------\|--------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0.780 \| 0.757 \| 0.709 \| 0.722 \| \| Smoothed \| 0.876 \| 0.784 \| 0.798 \| 0.752 \| \| TER \| 40.97% \| 43.79% \| 58.13% \| 51.98% \| Table 7 BLEU score for Google Translate on English to Danish translations The absolute highest score is within the public health domain with a score of 0.876 when smoothed. The rest of the scores are similar and follow the same trend as eTranslation, with public health translations at the top and finance at the bottom. Given that the datasets are available online to stakeholders, such as Google, it is not surprising that Google Translate scores are very high. The characteristics of Google’s translations from English to Danish are Anglicisms like in the following example from the finance corpus. 6a) Source sentence: ‘Unless Denmark withdraws from the programme, a Joint Strike Fighter acquisition will be exempt from the ordinary rules(...) 6b) Reference sentence: ‘En anskaffelse af Joint Strike Fighter vil, medmindre Danmark udtræder af programmet, være undtaget fra de almindelige regler(...) 6c) Candidate sentence: ‘Medmindre Danmark udtræder af programmet, vil et Joint Strike Fighter-anskaffelse være undtaget fra de almindelige regler(...). This way of constructing a sentence is not wrong, but depending on what information you want to convey, you would write it differently in the two languages. English sentences are generally constructed with end-weight meaning that the most important information is at the end of a sentence. However, this is not the case for Danish, as the end of the sentence is less important than in English. The Danish reference for the example sentence above is constructed in a way that sounds way more Danish. The TER score reveals difficulties with the finance corpus especially, but also moderately high TER scores for the rest of the domains. Google Translate does relatively well on the English to Danish translation except for the finance. The types of errors are more interesting as evident in the table below. \| Error types \| Inconsistent terminology \| Omissions / additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|-----------------------\|---------------\|----------------\|---------------\|----------------\| \| Public Health (266) \| 8 \| 3 \| 0 \| 0 \| 46 \| 5 \| \| Culture (82) \| 0 \| 0 \| 0 \| 0 \| 21 \| 13 \| \| Finance (164) \| 23 \| 10 \| 0 \| 0 \| 52 \| 4 \| \| General (23) \| 8 \| 2 \| 0 \| 0 \| 4 \| 4 \| Table 8 Error types for the English to Danish translations from Google Translate The first thing to notice is the low amount of errors in general. The culture domain has 4 columns of zero. This indicates a vast majority of well-translated sentences. The two ‘empty’ columns of made-up words and negation errors show that Google Translate has come a long way. Furthermore, the fact that there are no errors regarding made-up words shows that Google Translate is either very resourceful when it comes to locating and combining the right words or simply trained way better and is learning the correct lexical pair very well. In addition, the low number of incorrectly named entities shows that Google Translate is capable of using its search engine or translation memory to locate the correct name. When taking a closer look at inconsistent terminology, Google Translate mostly struggles in the finance domain and it is the same issue as seen in eTranslation’s Danish to English. The two audit statements in the source sentence below have been translated into the same word and look like this: 7a) Source sentence: ‘A completed annual audit of an institution, (...) must be reported on by means of an auditor's opinion and an auditor's report(...)’ 7b) Candidate sentence: ‘En gennemført årlig revision af en institution,(...) skal aflægges rapport om ved hjælp af en revisionspåtegning og en revisionspåtegning(...).’ Another mistake, which is on the border of two categories, omission and miscellaneous respectively, is a missing full stop after the abbreviation ‘mv’ in this sentence from the finance domain ‘(...)mellem lande, sektorer, bistandsinstrumenter mv(...)’. However, there is also an occurrence of a successful translation, where the abbreviation is followed by a full stop, as it should be. This does confirm that it is an omission error and not a lack of knowledge of Danish abbreviation rules. Google Translate also shows signs of Anglicism in the finance corpus. The following title of the national park is correctly translated, however, the English possessive apostrophe and s is kept: ‘Thy National Park”s’ into ‘Nationalpark Thy”s’. I have also noted a weird phrasing in the translation of the public health corpus. The English sentence is: ‘(a) the contamination lasts for more than four consecutive months; or’ and the translation is this: ‘(a) forureningen varer i mere end fire på hinanden følgende måneder eller’. The phrasing ‘på hinanden følgende måneder’ can be literally translated to ‘on each other following months’, which is an unintuitive way of phrasing ‘consecutive’ for both languages. Google Translate does well on named entities and the errors in this category do not suggest a lack of knowledge, but execution. I found that Google Translate suffers the same problem as eTranslation. In the culture corpus, the report ‘Aarhus European Capital of Culture 2017 – Second Monitoring Meeting’ has not only been translated, as it should not but also translated to different versions like ‘Aarhus Europæisk Kulturhovedstad 2017 - Andet Overvågningsmøde’ and ‘Aarhus Europæisk Kulturhovedstad 2017 - Second Monitoring Meeting’. Google Translate’s English to Danish translations are very good across all the domains and would be suitable for many purposes. It is the same story with the Danish to English translations. \| Danish to English \| Public Health \| Culture \| Finance \| General Text \| \|-------------------\|--------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0,788 \| 0,759 \| 0,684 \| 0,718 \| \| Smoothed \| 0,909 \| 0,786 \| 0,833 \| 0,752 \| \| TER \| 41,21% \| 43,60% \| 58,28% \| 48,46% \| Table 9 Google Translate’s BLEU score for Danish to English translations The Danish to English results are showing the same as the others, where the public health corpus translation scores the highest score and the other domains are in the same places when unsmoothed. Here the smoothed score of 0.909 is one of the absolute top scores, but similarly, the other scores make for great translations as well. The errors in the Danish to English translations are also mostly identical to the English to Danish. One observation to be noted is the loss of the style format and Danish writing style. I would place the following example under inconsistent terminology. This is from the finance corpus: 8a) Source sentence: ‘According to section 1 of the act its objective is to contribute to sustainable development of the rural areas(…).’ 8b) Candidate sentence: ‘Formålet med loven er ifølge § 1 at bidrage til en bæredygtig udvikling af landdistrikterne(…).’ 8c) Source sentence: ‘According to section 1 of the act its objective is to contribute to sustainable development of the rural areas(…),’ 8d) Candidate sentence: ‘Ifølge lovens § 1 er formålet at bidrage til en bæredygtig udvikling af landdistrikterne(…).’ Due to the alphabetically ordered corpus, the sentence is accompanied by other sentences with the same initial wording of ‘Formålet med…. which shows that somewhere either at Rigsrevisionen or the creation of the corpus the Danish wording was lost. This results in a Danish candidate sentence that has broken the stylesheet and looks like sentence 8d. The translation itself is correct but the sentence does not fit in and is very easily identified in the candidate corpus, as the translations are returned in the same order as they are iterated. It is nestled between other sentences with the exact same start to the sentence, namely ‘Formålet med….’ Furthermore, Google Translate struggles to choose one English formulation for the phrase ‘Formålet med’, as it alternates between ‘the objective of the(se)’ and ‘the purpose of the(se)’ where the only identifiable determiner is what noun immediately follows. Of 38 sentences with this wording or the similar ‘Formålet er…’, 18 began with ‘The purpose’, 13 with ‘The objective’ and a single sentence began with ‘The aim is to’. The reason I include this latter example is that sentences beginning with ‘Formålet er…’ also show this differing pattern and are in the same error group and the verb would therefore not be the reason. You would expect that such phrasing would be consistent within a domain with a formal tone and glossary. The TER scores tell the same story as before with a finance corpus that causes issues. Interestingly, the general text domain has a score below fifty percent and the culture and public health domains are almost similar. \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|--------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 18 \| 22 \| 0 \| 1 \| 31 \| 8 \| \| Culture (82) \| 4 \| 0 \| 0 \| 0 \| 15 \| 0 \| \| Finance (164) \| 27 \| 16 \| 0 \| 0 \| 71 \| 16 \| \| General (23) \| 5 \| 0 \| 0 \| 0 \| 6 \| 2 \| Table 10 Error types for the Danish to English translations from Google Translate Once again, the finance corpus has the most errors and the culture domain has very few errors and four columns of zeros. There are recurring errors, like the difficulties with distinguishing technical terms in the finance corpus, where ‘revisionspåtegning’ and ‘reviosionsberetning’ were translated into ‘auditor’s report’. There are other difficulties with the finance vocabulary, as the term ‘Modkøb’ has been translated into the literal ‘counter-purchase’. This is not the correct translation, however, it is not an error that disturbs the meaning of the sentence. It is positive that it is these sorts of errors I find and not made-up nonsensical attempts at translating a technical term. Although, this translation in particular is a bit off from the correct translation, which is ‘offset obligation’. A trait of the public health corpus translation is the insertion of full stops mid-sentence and not having the following word capitalised. It is evident in the following sentence, which is a candidate sentence from the public health domain: ‘(...)as a result of the covid-19 outbreak and is directly linked to its creation, or the extension of reduced working time schemes(…).’ This issue and seemingly random insertions of semicolons at the end of clauses or sentences in the corpus that otherwise would end without any punctuation are what make up the biggest part of the omission/addition errors of the public health domain. The only case I have found of a possible negation error is in the public health corpus translation, but given that this type of error has not been present in ANY of the other translations, it is worth taking a closer look. The translation looks like this: 9a) Source sentence: ‘Der kan højst ydes godtgørelse i henhold til stk. 1, litra a), i højst 12 måneder(…)’ 9b) Candidate sentence: ‘Reimbursement may not be granted in accordance with subsection (1). 1 (a) for a maximum of 12 months(…)’ The error is obvious and the insertion of a negation completely changes the meaning of the sentence. This is a case of the chicken and the egg, since the insertion leads to a meaning misinterpretation, but can also be the other way around, where a meaning misinterpretation led to the insertion. I have classified it as a negation error, but it is the sole example of such a mistake. Google Translate also show some struggles when dealing with lesser-known words. In the culture domain, a citation from the CEO illustrates just that, as the statement in Danish goes: ‘Det er meget vigtigt for os, at vi får sådan et flot skudsmål.’ and the incorrect translation produced by Google Translate goes: ‘It is very important for us that we get such a great shot.’ The Danish word ‘skudsmål’ contains ‘skud’ meaning shot and ‘mål’ meaning goal, but the definition of ‘skudsmål’ is an assessment or rating, which is certainly not reflected in the translation ‘a great shot.’ In the named entity category, Google Translate does not do well with the ‘Syd- og Sønderjyllands politi’ as it translates it into ‘South and South Jutland Police’, which has already been mentioned. A more straightforward error is how ‘Miljøministeriet’ has been translated into ‘the Ministry of the Environment’ in the finance corpus translation. When conferring with the English version of the Ministry of Environment of Denmark$^7$ a clear answer is given to what a correct translation would be. You could excuse this error, as it is actually wrongfully stated in the English reference corpus as $^7$ https://en.mim.dk/ ‘the Ministry of the Environment’. This shows that a translation service is reliant/vulnerable to dependable data and that Google Translate was not able to retrieve that information. \| EN-DA/EN-DA \| Public Health \| Culture \| Finance \| General Text \| \|-------------\|---------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0,780/0,788 \| 0,757/0,759 \| 0,709/0,684 \| 0,722/0,718 \| \| Smoothed \| 0,876/0,909 \| 0,784/0,786 \| 0,798/0,833 \| 0,752/0,752 \| \| TER (in %) \| 40,97/41,21 \| 43,79/43,60 \| 58,13/58,28 \| 51,98/48,46 \| Table 11 Comparison of Google Translate’s BLEU and TER-scores Overall, Google Translate is a very good translation tool and would all be suitable for use in many cases. It comes as no surprise since Google Translate could possibly have trained their algorithm on these datasets or at least retrieved them. The error types are very similar in the two language pairs as can be seen in the technical term issues and the repetitions of the same named entity problems. The TER scores once again reveal that the finance corpus is more tricky than the other domains despite being the BLEU scores being close to general text. All the TER scores suggest that there is a moderate amount of post-editing to do if you use Google Translate. A tool claiming to be four times as good as Google Translate is DeepL. 4.2.3 Results for DeepL As mentioned, I have used the free version of DeepL, which has a limit of 5000 characters pr. translation. I have therefore translated snippets of 5000 characters and patched them together into corpora of around 50,000 characters, which serves as the basis for quality estimation. DeepL performs well when translating the text snippets, as is visible in the tables in this section. The lowest scoring domain for DeepL is the public health domain with a very respectable 0,621 and the culture domain scoring the highest BLEU score with 0,770. Interestingly, the order is different from the other tools. DeepL produces very convincing translations, but even with the high BLEU scores, there are still some issues with the English to Danish translations. In the culture domain, DeepL demonstrates little knowledge of Danish writing style and format. The following examples do not result in unreadable translations but illustrate different areas of improvement for the English to Danish translation in general. The first is about possession. As seen previously, the English possessive construction of apostrophe s has snuck its way into this candidate sentence: ‘(...)den stærke regionale forankring og Aarhus 2017's strategiske forretningsplan(...).’ The correct Danish way to express genitive is to put an –s on the end of a word and omit the apostrophe unless the word ends in –s, -x or –z. This is also true for abbreviations and numbers and symbols. The second issue is compound nouns and when to use them. The sentence: ‘(...)the panel also emphasizes a clear organizational structure and project management.’ has been translated into ‘(...)fremhæver panelet også en klar organisatorisk struktur og projektledelse.’ Here, only one of the potential two nouns has been brought together into one word, however, I have found no clear strategy as to when a compound noun is created and when DeepL leaves it as two words. In the Danish reference corpus, the sentence looks like this: ‘(...)fremhæver panelet også en klar organisationsstruktur og projektledelse.’ The 'low' BLEU score for the public health domain is primarily a result of small deviations in the choice of words and phrasing like in this example: 10a) Reference sentence: ‘De specifikke EHFF-foranstaltninger suppleres med en ændring af forordningen om den fælles markedsordning for at:’ 10b) Candidate sentence: ‘De specifikke EHFF-foranstaltninger suppleres af en ændring af forordningen om den fælles markedsordning med henblik på:’ The TER scores are very high for the public health domain translation and are an indication of a below-average translation. This alongside the two domains scoring above fifty tells a story that the translations might not be as good as the BLEU score suggests. This is also reflected in the error typology for the English to Danish DeepL translation below. \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|---------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 0 \| 4 \| 0 \| 0 \| 32 \| 10 \| \| Culture (82) \| 4 \| 3 \| 0 \| 0 \| 23 \| 5 \| \| Finance (164) \| 36 \| 8 \| 0 \| 0 \| 63 \| 8 \| \| General (45) \| 1 \| 0 \| 0 \| 0 \| 8 \| 5 \| Table 13: Error types for the English to Danish translations from DeepL DeepL does not have issues with negations and can also handle new/unknown words well enough to avoid making up words. In addition, inconsistent terminology only seems to be a problem in the finance domain, as the public health translation has zero occurrences of inconsistent terminology. The biggest issue for DeepL is entities as displayed in Table 13. One of the many examples of inconsistent terminology in the finance domain translation is the translation of ‘GNI-based resources’ into ‘BNI-baserede indtægter.’ Looking at the Danish reference, the term in question is ‘BNI-bidrag’, which translates to ‘GNI-contributions’. This is also an error in the omission category, as some vital information has been omitted in the Danish translation since ‘based’ has been left out. Interestingly, DeepL has successfully translated the ‘auditor’s opinion and auditor’s report’ into two distinct terms, ‘revisorerklæring og en revisionsberetning’. As mentioned before, DeepL does struggle with the genitive, which has resulted in insertions of apostrophes in the Danish candidates. These sort of errors are what makes up most of the additions in the finance and culture domains. However, in the public health domain, the nature of insertions is random numbers as seen in this translation. The sentence ‘Contributions referred to in paragraph 1(...)’ is translated into ‘2. De bidrag, der er omhandlet i stk. 1(...)’, which cannot be explained by any meaning misinterpretation, but simply as an error in the output. Although DeepL produces good translations, there are signs that there is no real understanding of what is and should be translated. In the culture domain, the sentence ‘Now everyone wants to “gentænke”’ ‘gentænke’ is established as a concept. In the following sentences, ‘gentænke’ is mentioned several times, but in different ways: 11a) Source sentence: ‘(...) applying the concept of rethinking.’ 11b) Candidate sentence: ‘(...) de anvendte begrebet gentænkning.’ 12a) Source sentence: ‘(...) the word ‘rethink’ has now fought its way to (...).’ 12b) Candidate sentence: ‘(...) har ordet “rethink” nu kæmpet sig ind (...).’ 13a) Source sentence: ‘“Gentænk” has become a frequently used word(...).’ 13b) Candidate sentence: ‘“Gentænk” er blevet et hyppigt brugt ord(...).’ DeepL falls victim to inconsistency in the source corpus, since DeepL can only translate the input DeepL gets, thus resulting in the varying translation above. This might sound obvious, but the point is that DeepL does not have the ability to ‘remember’ and make the anaphoric reference to the earlier established concept ‘gentænke’. It seems that translation happens depending on the quotation marks since the word in single quotation marks has been translated. Whether a concept like ‘gentænke’ should be translated or not is difficult to judge since it is not a culturally laden word nor is it inherently Danish, as a concept like ‘Hygge’, but in this example, it should be consistently translated to either of the languages. The named entity errors in the general text domain are simply untranslated occurrences of the abbreviated form of the Danish Working Environment Authority, WEA as seen in this example: 14a) Source sentence: ‘In this case, the Danish WEA will contact the operator and the owner, respectively(...).’ 14b) Candidate sentence: ‘I dette tilfælde vil den danske WEA kontakte henholdsvis(...).’ Overall, the English to Danish translations are very readable with the majority of the errors being of semantic nature. It is much the same story for DeepL’s Danish to English translations. \| Danish to English \| Public Health \| Culture \| Finance \| General Text \| \|-------------------\|--------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0,615 \| 0,774 \| 0,692 \| 0,690 \| \| Smoothed \| 0,751 \| 0,900 \| 0,795 \| 0,806 \| \| TER \| 68,82% \| 41,03% \| 54,56% \| 50,43% \| Table 14 DeepL’s BLEU scores for Danish to English translations The standard of Danish to English translations from DeepL are very high. There are no issues with style or format similar to the English to Danish translations, which points towards mismatch in words and phrasing as the main reason behind the ‘low’ BLEU scores. Once again, the public health domain score is the lowest with ‘only’ 0,615 and the culture domain is convincingly at the top with 0,774. Opposite to the English to Danish, the finance domain score is higher than the general text domain, but only by a very small margin. This is not reflected in the TER scores as the general text domain scores lower than the finance translation and you could thus argue that the general text translation is better than the finance. They are both subject to a good part of post-editing as they both score above fifty percent. The public health domain translation is not useless, but would require a lot of editing as almost seventy percent of the words would be subject to an edit of the kind mentioned in the TER section. \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-----------------\|--------------------------\|---------------------\|---------------\|----------------\|---------------\|----------------\| \| Public Health (266) \| 0 \| 22 \| 0 \| 0 \| 68 \| 0 \| \| Culture (82) \| 6 \| 5 \| 0 \| 0 \| 24 \| 8 \| \| Finance (164) \| 25 \| 13 \| 0 \| 0 \| 65 \| 12 \| \| General (45) \| 10 \| 3 \| 0 \| 0 \| 11 \| 0 \| Table 15 Error types for the Danish to English translations from DeepL In the Danish to English translation, there are fewer named entity errors than in the English to Danish translation. Furthermore, the four columns of zeros in the public health domain support the claim that the translations actually are very good, even though the BLEU scores are lower than 0,7. One of the many terminology errors in the finance domain is the inability to correctly translate a certain type of VAT fraud, namely VAT carousel fraud. 15a) Source sentence: ‘Forholdene kan være indikationer på momskarruselsvindel.’ 15b) Candidate sentence: The circumstances may be indicative of VAT fraud. The correct translation of this type of fraud is the very literal ‘VAT carousel fraud’, which DeepL fails to get in the Danish to English translation, but has done correctly in the English to Danish translation. Another mistake that seems easy to avoid is an omission in the finance domain. The end of the sentence is simply left out. 16a) Source sentence: ‘En bedre koordinering vil således kunne imødegå unødigt dobbeltarbejde.’ 16b) Candidate sentence: ‘Better coordination could thus avoid unnecessary duplication.’ DeepL has somewhat successfully dealt with the concept of rethinking in the culture corpus. In the Danish to English translation, the concept is consistently translated to the same word, except for one instance, where it is simply the wrong choice of words and ‘gentleness’ is the word in question instead of ‘rethink’. 17a) Source sentence: ‘I mediestrømmen er gentænk blevet et hyppigt anvendt ord (...).’ 17b) Candidate sentence: ‘In the media stream, gentleness has become a frequently used word (...).’ An error that is more difficult to correct is the choice of the preposition to accompany ‘important’. Depending on whether you want to express that the important thing is personal to the subjective (important to) or that the important thing is used to accomplish something (important for), like a goal in football is important for winning the match. It can be difficult to select which is the correct option for this example. In the reference sentence, it is deemed that the assessment is important to something implied in the context, whereas the candidate suggests that subject currently has achieved something important. 18a) Reference sentence: ‘It is very important for us to receive such an impressive assessment.’ 18b) Source sentence: ‘Det er meget vigtigt for os, at vi får sådan et godt skudsmål.’ 18c) Candidate sentence: ‘It is very important to us that we get such a nice shot.’ Furthermore, this example also exposes issues with idiomatic language, as seen in the translation of ‘skudsmål’. \| EN-DA/DA-EN \| Public Health \| Culture \| Finance \| General Text \| \|-------------\|---------------\|---------\|---------\|--------------\| \| w/o smoothing \| 0.621/0.615 \| 0.770/0.774 \| 0.708/0.692 \| 0.719/0.690 \| \| Smoothed \| 0.759/0.751 \| 0.906/0.900 \| 0.823/0.795 \| 0.834/0.806 \| \| TER (in %) \| 68.55/68.82 \| 42.40/41.03 \| 57.33/54.56 \| 53.14/50.43 \| Table 16 Comparison of DeepL’s BLEU scores Table 16 illustrates that DeepL performs best on translation from English to Danish, though only by a few points. Although there is a higher frequency of errors in the English to Danish translations, the BLEU scores suggest the production of a more similar translation to the reference corpus. This is because of the inadequate knowledge of the Danish language. DeepL falls short when the issues are decisions on style and format and not just straightforward translations. In general, DeepL is a good tool for texts in these domains. The TER scores for DeepL are not encouraging and a lot of post-editing has to be done especially for the public health domain in both languages. It is interesting that the Danish to English general text and finance translations score lower than the English to Danish translations, which have scored a higher BLEU score. 4.3 Comparative assessment In this comparison, I will compare the evaluation scores for the tools. In addition, I will look at general points of improvement for the tools, highlight areas, and error types that separate them from each other. It is evident that there is very little between the tools regarding the quality of translations they are able to produce. eTranslation was expected to do well due to the nature of the corpora, Google Translate has been the most used tool and therefore the expectations are high and finally DeepL claims to be 4 times better than Google and other market competitors. It is interesting to highlight areas of improvement as the tools do vary in error types and now look into new challenges. It is also evident that machine translation has moved past the point where negations and made-up words are serious issues. Furthermore, there were very few to no syntactical errors, subject-verb agreement mistakes, singular and plural nouns were in agreement and pronouns referred back to the correct subject. 4.3.1 The metrics scores The three translation tools all score very high BLEU scores. Furthermore, the scores are all very similar across the domains except for DeepL’s public health scores. Still, the lowest score of 0.615 from DeepL’s Danish to English public health translation indicates a strong translation. A possible explanation as to why the scores are that high is that the domains all have a closed vocabulary. There is nothing besides DeepL’s public health BLEU score that can significantly separate them, which is around 0.2 lower than eTranslation. Remarkable that DeepL’s scores are low for the public health translations in both languages relative to the two other machines. This point will be elaborated on in section 5. Certainly, DeepL is not 4 times better as proclaimed on their website, but it definitely produces translations on a similar level to the two other tools. The BLEU scores suggest that translations from English to Danish and from Danish to English have progressed to a point, where they can be qualified as above-average/high standard using these three tools. The TER scores reveal that DeepL have some flaws and using this tool will result in more post-editing compared to the other tools. eTranslation’s TER scores are the lowest among the tools and Google Translate slots into the middle. It was remarkable that some translations broke the inverse proportionality between the BLEU and TER score, which dictates that when BLEU is high TER must be low. This happens in DeepL’s general text translations, where the translation with the lowest BLEU score also scores the lowest TER score and vice versa for the highest scoring. The TER score contributes to a better quality estimation of the three tools. The tools: An overall decision when translating any kind of language into English from DeepL is what kind of English to translate into, British English or American English. eTranslation and Google Translate do not have this option yet or have simply chosen not to, however, the tools perfectly well understand American English, but do not have an option to output American English. Interestingly, the output from Google Translate is American English, as words like organisation, analyse and characterise are spelt with a z instead of an s. The standard output from eTranslation is British English and I chose British English for the DeepL translations, which DeepL have been well-executed. 4.3.2 Error types Inconsistent terminology: A recurring problem was the terminology of the finance corpus, where the most problematic part was the auditor’s report/revisionspåtegnings terms. The tricky part for the tools is to distinguish between two closely related technical terms. Only DeepL managed to produce correct translations for both languages, whereas eTranslation did not translate correctly into English from Danish and Google Translate failed both ways. However, DeepL produced the only failed translation of VAT carousel fraud. Both Google Translate and eTranslation correctly translated the term from English to Danish and vice versa, but DeepL only did so for English to Danish. The Danish to English translation does not specify what kind of VAT fraud is mentioned, which results in a big loss of information. In the error typology analysis of the public health domain, I found that the term ‘Covid-19’ is treated differently across the tools, but also across languages. The Danish dictionary suggests two correct spellings, covid-19 and COVID-19, whereas Cambridge Dictionary suggests Covid-19 and COVID-19 as valid spellings. eTranslation prevailed when correctly translating the terms into the respective languages, whereas DeepL only succeeded with the English to Danish where it is spelt ‘COVID-19’. However, DeepL’s Danish to English translation failed due to occurrences of missed hyphens. Google Translate also only produced one good version, which is the English to Danish where ‘COVID-19’ is consistently used. Google Translate’s Danish to English translation resulted in the term ‘covid-19’, which is not the correct translation according to the Cambridge Dictionary. Insertions: The majority of insertions and deletions were in the context of EU legislations, regulations, and articles, which there are a high frequency of in these particular corpora. The characteristic of an article mentioned in a reference corpus includes an article number and a paragraph number like this example from the public health corpus, where the Danish to English translation from Google Translate includes an insertion marked in bold writing: 19a) Reference sentence: ‘Den berørte medlemsstat kan give et forskud på mellem 50 % og 100 % af den finansielle støtte, efter at produktions- og afsætningsplanen er godkendt i overensstemmelse med artikel 28, stk. 3, i forordning (EU) nr.’ 19b) Candidate sentence: ‘The Member State concerned may grant an advance of between 50% and 100% of the financial assistance after the production and marketing plan has been approved in accordance with Article 28 (2). 3 of Regulation (EU) No’ This is not an isolated incidence in the translations from Danish to English, in the translations in the public health domain or in the translations from Google Translate as DeepL also makes this error. Another mistake DeepL does is to add an initial ‘2.’ to the beginning of some sentences in the English to Danish public health translation. These sentences all include a reference to an EU paragraph like the example seen below: 20a) Reference sentence: ‘The support referred to in paragraph 1 shall end on 31 December 2020.’ 20b) Candidate sentence: ‘2. Den i stk. 1 omhandlede støtte ophører den 31. december 2020.’ eTranslation is the only tool to not have such issues and the nature of the very few existing examples of insertions are simply a random word inserted on the back of a sentence and not related to any particular style sheet like DeepL and Google Translate. This might indicate a recurring problem for the two tools, whereas it is worth noting that eTranslation has almost no deletion/insertion errors at all and produce better translations based on this parameter. It would be tempting to claim, that ‘of course, eTranslation did not have issues with this’, but it would probably be worse for eTranslation not to be able to handle this type of writing style since it is within the realm of the EU. Miscellaneous: A category that is less specific is the miscellaneous. No tool had significantly more errors than the others did and the number of errors across the domains were consistently distributed. All three translation systems had wrongly inflected nouns and also translated some sentences very literally as mentioned before. One thing DeepL struggled more with compared to the other two tools are prepositions highlighted in the English to Danish translation of this sentence from the finance domain: 21a) Source sentence: ‘In 2009, Rigsrevisionen issued a total of 37 audit opinions on institutions under the Ministry of Economic and Business Affairs, the Ministry of Science, Technology and Innovation, the Ministry of the Environment and the Ministry of Climate and Energy.’ 21b) DeepL candidate sentence: ‘Rigsrevisionen har i 2009 afgivet i alt 37 revisionspåtegninger på institutioner under Økonomi- og Erhvervsministeriet, Ministeriet for Videnskab, Teknologi og Innovation, Miljøministeriet og Klima- og Energiministeriet.’ Both eTranslation and Google Translate chose the Danish word ‘om’ instead of ‘på’, which is a more correct way of translating this particular example. Preposition mistakes happen more than a few times in the translations that DeepL produced and they happen in both languages. It is not something that eTranslation and Google Translate have significantly issues with. I cannot pinpoint exactly where in DeepL’s inner workings things are different to the two others regarding these types of errors; also, it is uncharacteristic, since DeepL otherwise displays translations that would lead the reader to assume that these mistakes would not happen. Entities: In raw numbers, eTranslation did best regarding entities, which is not a big surprise given that the corpora are from ELRC-SHARE and you would expect an EU tool to perform well on EU institutions, different legislations and so on. The two other tools are also doing well, considering they are not related to some of the entities. An issue all the tools had was correctly translating the police force of Southern Jutland’s name both to English to Danish and the other way around. ‘Syd- og Sønderjyllands politi’ poses a challenge, since Sydjylland and Sønderjylland are not the same region; in fact, Sydjylland is the area of land that Sønderjylland does not cover in the southern part of Jutland. Therefore, translating the police force’s name into ‘South and South Jutland Police’ or only ‘Sydjyllands politi’ are not satisfactory translations because of the geographical and cultural implications of the two names. In addition, the prefix ‘Sønder-’ does not exist in the dictionary in any other form than an expression synonymous with beating something to bits and pieces. All three tools struggle with identifying when an entity should be translated and when not. An example is the report mentioned in the culture corpus, which is called ‘Aarhus European Capital of Culture 2017 – Second Monitoring Meeting’ in both the Danish and English references. This was not an issue when translating to English from Danish, however, there were different mistakes when translating from English to Danish. eTranslation was the only tool to consistently translate the name completely to Danish as ‘Aarhus Europæisk Kulturhovedstad 2017 – Andet overvågningsmøde’ and even though it is an incorrect translation, the consistent translation is a plus. Both Google Translate and DeepL produced the same translation as eTranslation, however, they also produced a hybrid version of Danish and English namely ‘Aarhus Europæisk Kulturhovedstad 2017 – Second Monitoring Meeting’ showing inconsistent translations, when encountering named entities. As seen in the error typology scores, entities are one of the main issues. It is not always clear if they have a valid translation in the target language and whether it should be translated or not. A strategy for a tool is to locate/crawl for the organisation’s website and see if they have an English/Danish version and pick the name they use themselves. If this is not the case and only one version is available, the systems should stick to that and not attempt to make up a name in the target language. Languages: According to the unsmoothed BLEU scores, there is nothing between the two languages as both the English to Danish and Danish to English translations outscore each other on 6 of the 12 translations. The Danish to English translations outscore the English to Danish translations 7 to 4 and Google Translate’s general text smoothed translations both score 0,752 resulting in a tie. As mentioned before, there are very few decimal points separating the translations, both language and domain-wise. Both the English and Danish translations are susceptible to Anglicisms and Danish phrasing, which could indicate an inability to properly understand the full meaning and context of a sentence or not fully understanding the rules of the target language. An example of an Anglicism is from DeepL’s English to Danish translation in the public health domain: 22a) Source sentence: ‘Availability of the Instrument’ 22b) Candidate sentence: ‘Tilgængelighed af instrumentet’ Google Translate and eTranslation have both translated this sentence to the more fluent ‘Instrumentets tilgængelig’. I have categorised this sort of error as miscellaneous. Another difference is the way semicolons are handled. A semicolon is a rarity in Danish, due to the strong commas, but they are more common in English. The three tools practised two methods; Google Translate and DeepL simply kept the semicolons from English to Danish, where a comma might have been better and eTranslation simply omitted or replaced them with full stops, which can result in poorly translated sentences. 5 Discussion and perspectives My aim with this study was to examine the current quality of machine translations from English to Danish and the other way around using three different tools. I highlighted eTranslation on the basis of the opinion of stakeholders asked in the report ‘Sprogteknologi i verdensklasse’ and this has been compared to the biggest on the market, Google Translate and the most preferred tool by language companies, DeepL. I have compared translations across four different domains to investigate whether domain-specific language would have a significant impact on the quality of machine translation. Furthermore, I have used different evaluation metrics to get a better quality assessment. My findings indicate that the three tools are all outputting translations of very high quality and they could all be useable options for machine translation tasks. In addition, I have demonstrated this for both English and Danish translations across four different domains. The BLEU scores above 0.6 is a surprise since the narrative in reports has been negative and experts have painted a pessimistic picture. There have not been many recent studies on this topic and reports like the ELRC White Paper call for more research on language technology for Danish. A paper from 2009 has classified Danish to English and vice versa to score >0.5 on a statistical machine translation system. This study also examined pivot language translation and what effect a pivot language could have on translations with low-resource language pairs. An intermediate language could be English or French, which is used as a mediator between two languages with few parallel corpora and other data available, meaning a Danish-Ukrainian translation is actually Danish to English to Ukrainian. The recent crisis in Ukraine call could call for public sector webpages to be translated into Ukrainian from Danish to accommodate Ukrainian refugees. In such a case, a pivot language would most likely be the best way to translate. An overview from their study in 2009 can be found in the appendix (Koehn, Birch, and Steinberger 2009). The overview shows that Danish was doing well on statistical machine translation systems, but the transition to neural machine translation systems has lowered the quality and along with the low spending, compared to like-minded languages, has created the disheartened perception. My study contributes to this field by informing stakeholders that Danish machine translations are reliable, although, given the rapid progression and recent initiatives, I would like to see an update in a few years. More and more attention is given to Danish NLP these days and my results contribute to the increasing need for information on what technologies exist and the quality thereof. The results of the BLEU scores for all the translation systems have surpassed my expectations and the fact that negation errors and made-up words are not problems for neural machine translations anymore is positive. The data follow a trend in 3 out of the 4 domains. The public health domain is the only one with a relatively big variety in BLEU scores compared to the other. As mentioned before, DeepL’s scores for both the Danish and English translation of the public health are just above 0.6, which is one of the only points that differentiate the three tools. This trend is visible in the TER scores as well. In theory, the higher the BLEU score is, the lower the TER score should be. However, the results of the translation edit rates leave something to be desired. They are more varied than the BLEU scores and they indicate that some post-editing is required depending on the domain. The nature of this post-editing can be seen in the errors found. This point is backed by the errors located from the error typology analysis, which point to challenges that require knowledge of the world or a specific context in order to produce a correct translation of a term or entity. Something the current machine translation systems do not possess at the time of writing. To iterate a previous point, all the sentences in the candidates are readable and make sense. This is positive since Danish machine translation has reached a threshold and moves the debate to a holistic view of the translation systems. Since the translations are so similar in quality and make roughly the same errors, which factors decide what tool to choose? This might be something to study in the future as data security, trust, usability, custom vocabularies for commercial systems and maybe even a tool developed by Danes for Danes will see the light of day. I do not think machine translation systems can substitute human translators, but they are certainly making a strong case with the results. It could be interesting to see to what extent machine translation systems can deliver the same or outperform human translators. The two evaluation metrics account for human correlation by number of references etc. However, the subject of translation is more than similarity and post-editing. Translation is more than a linguistic practice; it also requires knowledge of regions and groups of people in Denmark. A human translator uses translation strategies to transform a piece of text in one language into a different language while retaining meaning, writing style, humour and so on. Machine translations are not human translations, but comparing time, effort with both pre and post-editing, cost and other factors could play into a decision to use a machine translation tool or a human translator. Most translation tasks done by translation companies are done with the help of machine translation, but what is lost and gained? A human translator considers different things and has several micro strategies for a translation. In addition, monoculture specific terms and entities are adapted to suit the receiver. This could be something like a translation of Middelalderslagsgenfortælling (middle age battle re-enactment) into Civil War re-enactment for an American audience and vice versa. This is one of the major challenges for machine translation and requires more than lexical, morphological and syntactic knowledge (Øveraas 2016). 5.1 Caveats As mentioned, the lowest score was DeepL’s Danish to English public health translation. A possible explanation could be that DeepL did not translate whole documents, but only snippets of around 50.000 characters, as the option to translate documents, is subscription-based. As mentioned, I look at the free versions of the tools. Interestingly, I had the same issue with Google Translate, but upon revisiting Google Translate, I was able to translate whole documents for free, not just parts of them. I had already done some initial analysis on snippets from Google Translate and these were higher than the full document translations. This disproves that length is the reason behind the low score for the public health domain translations of DeepL. The fact that the one system is only snippets of the whole document might invalidate the whole comparison foundation, just as toggling the domain-specific translation function for eTranslation and comparing the output from here instead of the general text domain as I have done. 5.1.1 Evaluation metrics As mentioned in a previous section, there are drawbacks to BLEU. One is that it only measures similarity and does not account for meaning or syntax as such although n-gram size and smoothing factor can be adjusted. Furthermore, the BLEU score I have used is one-dimensional in its evaluation of whether an n-gram is a match or not and there is not much room for creativity and nuances. In addition, I only used 1 reference to evaluate the quality of the candidate. This means that synonyms and minor differences are penalised. As mentioned previously, there are ways to manipulate the BLEU score using various methods and tricks, which have been discussed by others. In addition, one of the critiques of BLEU is that valid comparisons across all evaluations made with BLEU should be done using the same pre-processing scheme. There are alternatives to BLEU like SacreBLEU and RIBES. Translation edit rate has limitations as well. According to Snover et al., automatic TER works best with 4 references as it would then correlate on par with human judgment. There is a semi-automatic metric created to better Human-mediated Translation Error Rate (HTER) is a semi-automatic metric that uses references created by humans to acquire better quality estimation. This is done to address some of the limitations of TER, such as dealing with synonyms, something that the metric METEOR is able to as well (Snover et al. 2006). Furthermore, the score generated by TER does not distinguish between the cognitive loads each error has. This means that some errors require more attention to correct than others do and like in the error typology, negations and prepositions are more crucial than some other mistakes. Furthermore, Koponen et al. argue that 38% of post-edits are unnecessary. This argument stems from the fact that human post-editors can have preferences and ‘over-edit’ translations that were good enough already. Also, some errors may not be corrected by the post-editor or new errors may be introduced (Koponen, Salmi, and Nikulin 2019). Error typology: An issue with the criteria that a translation should be readable is that it is my assessment of the sentences. What might seem like a readable sentence to one reader might not always correspond to what another reader might deem adequate. For a stronger analysis in the future, professional translators could be employed to carry out the examination. In the excerpts I have analysed for the error typology, the miscellaneous category has been a basket for the ‘rest’. Preposition mistakes are part of this category and they are as disruptive to the meaning as negations and they usually only make up few words per sentence, therefore, they might not be properly reflected in the evaluation metrics and error typology. The same goes for inconsistent terminology in domain-specific translations. The BLEU and TER scores might be good, but if all the technical terms are translated incorrectly then the rest of the translation is almost invalid. It was difficult to determine whether an insertion of an article that otherwise would not be present resulted in a meaning misinterpretation or the other way around. Which error influenced the other? Is it the chicken or the egg? It is obvious that insertions or omissions of articles or prepositions result in a misunderstanding, but it is difficult to know where in the algorithm the error has happened. Another way of structuring such an analysis could be to only register if a sentence needed post-editing and thus count correct sentences vs. sentences that need attention. Corpora: The translations are only as good as the corpora they are given to translate. This means that even though the corpora were supposed to be parallel corpora, they themselves were translated wrong, which led to translations of the ‘same’ sentence having different meanings. For instance in the Danish and English culture references, where one person is a racing driver advisor and the other is an advisor on an unspecified topic for racing driver Kevin Magnussen: 23a) English reference: ‘What do the Minister of Justice, the car company Jaguar, Prime Minister Lars Løkke and Kevin Magnussen's racing driver advisor have in common?’ 23b) Danish reference: ‘Hvad har Justitsministeren, bilfirmaet Jaguar, Lars Løkke og racerkører Kevin Magnussens rådgiver tilfælles?’ Differences like this illustrate that the evaluation metrics can function to perfection, but still get it wrong since a perfectly well-translated sentence in this instance would still in theory result in an error due to a meaning misinterpretation. Factors like this can also influence a BLEU score and thus skewing a quality estimation of a translation system. The origin of the corpora also affects the analysis since the corpora may have been translated using machine translation and then post-edited in order to create the parallel corpora. This may have led to Anglicisms in the Danish references and Danish phrasing in the English references. Another factor that could alter the result of the evaluation is the choice of corpora. The ones I have used are all from the EU and that is the predominant theme in these. Even the general text domain is quite a formal language compared to newspaper articles or naturally occurring language. I chose the corpora due to their availability and the fact that they are parallel corpora of considerable size. I would speculate that the BLEU score would be lower with a less restrained writing style. 5.2 Future studies What are the needs for machine translation tasks; Danes are proficient speakers of English, so in what contexts do Danes need translation assistance? According to the ELRC White Paper, there is a demand for translations for EU languages, non-official EU languages and as mentioned before immigrant languages. The paper mentions the Danish public sector as a key stakeholder and highlights municipality websites as concrete cases where translations into other languages both EU languages and Greenlandic and Faroese even though they are not official EU languages. Increased digitalisation, and customisation of domain vocabulary to comply with words like Fællesoffentlig sector that do not have a corresponding English term. Furthermore, valuable Danish data is hard to come by and there is very little coordinated effort to collect language data and spread awareness of how important data and data collection from various sources, like the public sector, can be. It is also important to get Danish sources and not just translated corpora or news articles to train language models (European Language Resource Coordination 2020). As mentioned before, there is a need for Danish NLP enthusiasts and experts. Even at the universities, there is a risk that students of language technology like at the master’s programme IT & Cognition put their effort into analysing and utilising the English language. The consequence of this, as mentioned in ‘Sprogteknologi i verdensklasse’, is that the Danish language with all its challenges both linguistic and language politically is bypassed and thereby further contributing to existing problems for Danish language technology. The high quality of machine translations and other linguistic helping applications are a problem for learners of language in the Danish schools since they do not actually learn a language, but only how to use the tools themselves (Kirchmeier et al. 2019). Even though we got our hands on more data, it would still need to be marked with metadata in order to be useful for training, processing etc. This requires manual labour and annotation is no cheap task. An initiative created by experts and stakeholders who are trying to progress this is det Centrale Ordregister (COR) or The Central Word Register in English. Similar to the Danish social security number, every word will be given a number. This number will be linked to a word and associated information about this word that can be accessed depending on a user’s need, which could be pronunciation, inflexions and so on. This can help track, correct and add new information on Danish words and thus make it easier for everybody involved in Danish NLP. One such area that would benefit is speech recognition, which is difficult in Danish since there is little correlation between spelling and pronunciation. Chatbots that can operate a phone hotline at all times, dictation and virtual assistants are some of the areas that could see huge progress within the next years with a project called KIRI$^8$. In addition, how do the virtual assistants deal with anaphoric references and things mentioned previously in the conversation or even ellipsis? Finally, it could be useful to expand my study and get an overview of how Danish did across all EU languages using eTranslation, Google Translate, DeepL and other big commercial systems like Microsoft Bing Translator and Amazon AWS. This could nuance the results I have found and give a clearer picture of the state of Danish machine translation. 6 Conclusion In my paper, I have looked at the state of machine translations involving Danish and English using three different translation tools. My point of departure was the report ‘Sprogteknologi i verdensklasse’ published in April of 2019, where it was stated that one of the areas with the most potential for improvement and applicability was automatic translation in a Danish context. The results of my analysis show that machine translations involving English and Danish indicate that the Danish language has reached a point where the issues are not a system’s lack of training and knowledge of the Danish language, but rather the availability of data and (national) policies on this subject. In fact, the BLEU score evaluations indicated translations of very high quality. The BLEU scores above 0.6 suggest the three systems were able to produce identical translations close to a gold standard/reference. Judging based solely on the BLEU scores suggests that there is no reason to prioritise machine translation in the Danish NLP environment since they perform so well. The translation edit rate examination suggests that there are still some issues, especially with DeepL. Certain domains proved more challenging than others, namely the finance domain and the public health domain when using DeepL. Overall, the three translation systems, eTranslation, Google Translate and DeepL are all producing high-quality translations in both English to Danish and Danish to English according to the BLEU scores. In terms of usability, they are also very similar, but what truly separates them is the setup $^8$ https://videncenter.kl.dk/cases/cases-fra-tekradar-2019/kommune-kiri-faellekommunal-borgerservice-chatbot/ beside the translation system. eTranslation was created by the EU and is now offered to certain stakeholders and promotes themselves on data security among other things. Google Translate is the largest and most known tool and has access to a huge database. DeepL is a commercial tool with services behind a subscription wall and claims to be better than competitors are. I believe this is where the real choice lies for a user of machine translation. However, the intentions and underlying values of the tools are outside the scope of this particular analysis but could serve as a topic within language policy-related studies. On the matter of domains, I have found domain specificity not to be an issue, not for any of the tools nor the languages concerning the BLEU scores. That being said, the finance domain did present challenges with the technical terms for all the tools. Furthermore, the finance domain consistently scored the lowest or second-lowest BLEU score, the worst or second-worst TER score and was the domain with the most errors in the error typology. The overarching theme of the domains is the EU and EU-formal language, which presented some difficulties for both Google Translate and DeepL, however, eTranslation did well across the board and did not have any issues with the writing style of EU legislations and the like. The domain with the lowest BLEU scores was DeepL’s public health domain scores, which is interesting since this domain is the highest scoring domain for the two other translation systems. The biggest differences were revealed in the manual error location analysis. As previously mentioned, the error types selected for this analysis were issues that had been challenging machine translation systems when translating to and from Danish into English. I can conclude that negation errors are outdated and the only occurrence of a negation mistake was debatable. Likewise, there was only one incidence of a made-up word and that too was questionable, since it was an entity and could have been classified as such. It seems that machine translation has reached a threshold, which is positive. Idioms still prove to be a problem but the nature of neural networks indicates that the translation systems will learn to translate them with time. It is not always the translation system that is at fault for an incorrect translation; they are still human dependent. This is both in regards to the differences in input and accessible data. The way the neural networks function, learn and solve problems bear resemblance to the human brain, but looking at the results and the issues that are facing them now, I wonder if it is only mimicry and not actual intelligence, since they lack knowledge of the world around them. There is no doubt; however, the transition to neural machine translations has borne fruit and has caught up to the Danish language. After I saw the results, I was tempted to write the conclusion in Danish and translate it using eTranslation, since I would get the best result from that tool and my data would be safe. Bibliography Aiken, Milam. 2019. ‘An Updated Evaluation of Google Translate Accuracy’. Studies in Linguistics and Literature 3 (3): p253. https://doi.org/10.22158/sll.v3n3p253. Banerjee, Satanjeev, and Alon Lavie. 2005. ‘METEOR: An Automatic Metric for MT Evaluation with Improved Correlation with Human Judgments’. In Proceedings of the ACL Workshop on Intrinsic and Extrinsic Evaluation Measures for Machine Translation and/or Summarization, 65–72. Ann Arbor, Michigan: Association for Computational Linguistics. https://aclanthology.org/W05-0909. Benjamin, Martin. 2019. ‘Empirical Evaluation of Google Translate across 107 Languages’. Teach You Backwards (blog). 30 March 2019. https://www.teachyoubackwards.com/empirical-evaluation/. Breinstrup, Thomas. 2016. ‘Vestager tager fat på dataindsamling’. Berlingske.dk. 18 January 2016. https://www.berlingske.dk/content/item/85517. CEF. n.d. ‘ETranslation Builds on MT@EC’. CEF Digital. Accessed 27 October 2021. https://ec.europa.eu/cefdigital/wiki/cefdigital/wiki/display/CEFDIGITAL/eTranslation+builds+on+MT@EC. ‘DeepL Press Information \| Setting Records!’ n.d. Accessed 28 February 2022. https://www.DeepL.com/press.html. ELIS Research. 2022. ‘EUROPEAN LANGUAGE INDUSTRY SURVEY 2022 Trends, Expectations and Concerns of the European Language Industry’. ‘ELRC-SHARE’. n.d. Accessed 2 December 2021. https://www.elrc-share.eu/info/#general. European Commission. 2021. ‘Digital Economy and Society Index (DESI) 2021’. https://digital-strategy.ec.europa.eu/en/policies/desi. European Language Resource Coordination and One Vision Design. 2020. ELRC White Paper Sustainable Language Data Sharing to Support Language Equality in Multilingual Europe: Why Language Data Matters. ‘Evaluating Models \| AutoML Translation Documentation’. n.d. Google Cloud. Accessed 29 November 2021. https://cloud.google.com/translate/automl/docs/evaluate?hl=da. Kirchmeier, Sabine, Peter Juel Henrichsen, Philip Diderichsen, and Nanna Bøgebjerg Hansen. 2019. ‘Sprogteknologi i verdensklasse’. https://dsn.dk/wp-content/uploads/2021/01/sprogteknologi-i-verdensklasse.pdf. Koehn, Philipp, Alexandra Birch, and Ralf Steinberger. 2009. ‘462 Machine Translation Systems for Europe’. In MTSUMMIT. Koponen, Maarit, Leena Salmi, and Markku Nikulin. 2019. ‘A Product and Process Analysis of Post-Editor Corrections on Neural, Statistical and Rule-Based Machine Translation Output’. Machine Translation 33 (June). https://doi.org/10.1007/s10590-019-09228-7. Larsen, Claus Thornby. 2019. ‘Neural Machine Translation in DA Brief Assessment Report’. Larsen, Claus Thornby. 2021. ‘ETranslation - Machine Translation at the European Commission’. At University of Copenhagen, Amager. Martindale, Marianna, and Marine Carpuat. 2018. ‘Fluency Over Adequacy: A Pilot Study in Measuring User Trust in Imperfect MT’. In Proceedings of the 13th Conference of the Association for Machine Translation in the Americas (Volume 1: Research Track), 13–25. Boston, MA: Association for Machine Translation in the Americas. https://aclanthology.org/W18-1803. ‘MT Quality Metrics’. n.d. Intento. Accessed 16 December 2021. https://help.inten.to/hc/en-us/articles/360020528540-MT-quality-metrics. ‘NLTK :: Nltk.Translate.Bleu_score’. n.d. Accessed 6 December 2021. https://www.nltk.org/_modules/nltk/translate/bleu_score.html. Øveraas, Kirsten Marie. 2016. Ti faldgruber: oversættelse for ikke-oversættere. 1. udgave. Frederiksberg: Samfundslitteratur. Papineni, Kishore, Salim Roukos, Todd Ward, and Wei-Jing Zhu. 2001. ‘BLEU: A Method for Automatic Evaluation of Machine Translation’. In Proceedings of the 40th Annual Meeting on Association for Computational Linguistics - ACL '02, 311. Philadelphia, Pennsylvania: Association for Computational Linguistics. https://doi.org/10.3115/1073083.1073135. Pedersen, Bolette S., Georg Rehm, and Hans Uszkoreit. 2012. The Danish Language in the Digital Age. White Paper Series. Berlin New York: Springer. Post, Matt. 2018. ‘A Call for Clarity in Reporting BLEU Scores’. In Proceedings of the Third Conference on Machine Translation: Research Papers, 186–91. Brussels, Belgium: Association for Computational Linguistics. https://doi.org/10.18653/v1/W18-6319. Sepesy Maučec, Mirjam, and Gregor Donaj. 2020. ‘Machine Translation and the Evaluation of Its Quality’. In Recent Trends in Computational Intelligence, edited by Ali Sadollah and Tilendra Shishir Sinha. IntechOpen. https://doi.org/10.5772/intechopen.89063. Snover, Matthew, Bonnie Dorr, Rich Schwartz, Linnea Micciulla, and John Makhoul. 2006. ‘A Study of Translation Edit Rate with Targeted Human Annotation’. In Proceedings of the 7th Conference of the Association for Machine Translation in the Americas: Technical Papers, 223–31. Cambridge, Massachusetts, USA: Association for Machine Translation in the Americas. https://aclanthology.org/2006.amta-papers.25. Snover, Matthew, Nitin Madnani, Bonnie Dorr, and Richard Schwartz. 2009. ‘Fluency, Adequacy, or HTER? Exploring Different Human Judgments with a Tunable MT Metric’. In Proceedings of the Fourth Workshop on Statistical Machine Translation, 259–68. Athens, Greece: Association for Computational Linguistics. https://aclanthology.org/W09-0441. Turovsky, Barak. 2016. ‘Found in Translation: More Accurate, Fluent Sentences in Google Translate’. Google. 15 November 2016. https://blog.google/products/translate/found-translation-more-accurate-fluent-sentences-google-translate/. ‘Understanding MT Quality: BLEU Scores’. n.d. Accessed 13 September 2021. https://www.rws.com/blog/understanding-mt-quality-bleu-scores/. Vaswani, Ashish, Noam Shazeer, Niki Parmar, Jakob Uszkoreit, Llion Jones, Aidan N. Gomez, Lukasz Kaiser, and Illia Polosukhin. 2017. ‘Attention Is All You Need’. ArXiv:1706.03762 [Cs], December. http://arxiv.org/abs/1706.03762. ‘What Is ETranslation’. n.d. CEF Digital. Accessed 1 December 2021. https://ec.europa.eu/cefdigital/wiki/cefdigital/wiki/display/CEFDIGITAL/What+is+eTranslation. Wu, Yonghui, Mike Schuster, Zhifeng Chen, Quoc V. Le, Mohammad Norouzi, Wolfgang Macherey, Maxim Krikun, et al. 2016. ‘Google’s Neural Machine Translation System: Bridging the Gap between Human and Machine Translation’. ArXiv:1609.08144 [Cs], October. http://arxiv.org/abs/1609.08144. ## Appendix \| \| en \| bg \| de \| cs \| da \| el \| es \| et \| fi \| fr \| hu \| it \| lt \| lv \| mt \| nl \| pl \| pt \| ro \| sk \| sl \| sv \| \|-------\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\|-----\| \| en \| – \| 40.5\| 46.8\| 52.6\| 50.0\| 41.0\| 55.2\| 34.8\| 38.6\| 50.1\| 37.2\| 50.4\| 39.6\| 43.4\| 39.8\| 52.3\| 49.2\| 55.0\| 49.0\| 44.7\| 50.7\| 52.0\| \| bg \| 61.3\| – \| 38.7\| 39.4\| 39.6\| 34.5\| 46.9\| 25.5\| 26.7\| 42.4\| 22.0\| 43.5\| 29.3\| 29.1\| 25.9\| 44.9\| 35.1\| 45.9\| 36.8\| 34.1\| 34.1\| 39.9\| \| de \| 53.6\| 26.3\| – \| 35.4\| 43.1\| 32.8\| 47.1\| 26.7\| 29.5\| 39.4\| 27.6\| 42.7\| 27.6\| 30.3\| 19.8\| 50.2\| 30.2\| 44.1\| 30.7\| 29.4\| 31.4\| 41.2\| \| cs \| 58.4\| 32.0\| 42.6\| – \| 43.6\| 34.6\| 48.9\| 30.7\| 30.5\| 41.6\| 27.4\| 44.3\| 34.5\| 35.8\| 26.3\| 46.5\| 39.2\| 45.7\| 36.5\| 43.6\| 41.3\| 42.9\| \| da \| 57.6\| 28.7\| 44.1\| 35.7\| – \| 34.3\| 47.5\| 27.8\| 31.6\| 41.3\| 24.2\| 43.8\| 29.7\| 32.9\| 21.1\| 48.5\| 34.3\| 45.4\| 33.9\| 33.0\| 36.2\| 47.2\| \| el \| 59.5\| 32.4\| 43.1\| 37.7\| 44.5\| – \| 54.0\| 26.5\| 29.0\| 48.3\| 23.7\| 49.6\| 29.0\| 32.6\| 23.8\| 48.9\| 34.2\| 52.5\| 37.2\| 33.1\| 36.3\| 43.3\| \| es \| 60.0\| 31.1\| 42.7\| 37.5\| 44.4\| 39.4\| – \| 25.4\| 28.5\| 51.3\| 24.0\| 51.7\| 26.8\| 30.5\| 24.6\| 48.8\| 33.9\| 57.3\| 38.1\| 31.7\| 33.9\| 43.7\| \| et \| 52.0\| 24.6\| 37.3\| 35.2\| 37.8\| 28.2\| 40.4\| – \| 37.7\| 33.4\| 30.9\| 37.0\| 35.0\| 36.9\| 20.5\| 41.3\| 32.0\| 37.8\| 28.0\| 30.6\| 32.9\| 37.3\| \| fi \| 49.3\| 23.2\| 36.0\| 32.0\| 37.9\| 27.2\| 39.7\| 34.9\| – \| 29.5\| 27.2\| 36.6\| 30.5\| 32.5\| 19.4\| 40.6\| 28.8\| 37.5\| 26.5\| 27.3\| 28.2\| 37.6\| \| fr \| 64.0\| 34.5\| 45.1\| 39.5\| 47.4\| 42.8\| 60.9\| 26.7\| 30.0\| – \| 25.5\| 56.1\| 28.3\| 31.9\| 25.3\| 51.6\| 35.7\| 61.0\| 43.8\| 33.1\| 35.6\| 45.8\| \| hu \| 48.0\| 24.7\| 34.3\| 30.0\| 33.0\| 25.5\| 34.1\| 29.6\| 29.4\| 30.7\| – \| 33.5\| 29.6\| 31.9\| 18.1\| 36.1\| 29.8\| 34.2\| 25.7\| 25.6\| 28.2\| 30.5\| \| it \| 61.0\| 32.1\| 44.3\| 38.9\| 45.8\| 40.6\| 57.2\| 25.0\| 29.7\| 52.7\| 24.2\| – \| 29.4\| 32.6\| 24.6\| 50.5\| 35.2\| 56.5\| 39.3\| 32.5\| 34.7\| 44.3\| \| lt \| 51.8\| 27.6\| 33.9\| 37.0\| 36.8\| 26.5\| 41.0\| 34.2\| 32.0\| 34.4\| 28.5\| 36.8\| – \| 40.1\| 22.2\| 38.1\| 31.6\| 31.6\| 29.3\| 31.8\| 35.3\| 35.3\| \| lv \| 54.0\| 29.1\| 35.0\| 37.8\| 38.5\| 29.7\| 42.7\| 34.2\| 32.4\| 35.6\| 29.3\| 38.9\| 38.4\| – \| 23.3\| 41.5\| 34.4\| 39.6\| 31.0\| 33.3\| 37.1\| 38.0\| \| mt \| 72.1\| 32.2\| 37.2\| 37.9\| 38.9\| 33.7\| 48.7\| 26.9\| 25.8\| 42.4\| 22.4\| 43.7\| 30.2\| 33.2\| – \| 44.0\| 37.1\| 45.9\| 38.9\| 35.8\| 40.0\| 41.6\| \| nl \| 56.9\| 29.3\| 46.9\| 37.0\| 45.4\| 35.3\| 49.7\| 27.5\| 29.8\| 43.4\| 25.3\| 44.5\| 28.6\| 31.7\| 22.0\| – \| 32.0\| 47.7\| 33.0\| 30.1\| 34.6\| 43.6\| \| pl \| 60.8\| 31.5\| 40.2\| 42.1\| 42.1\| 34.2\| 46.2\| 29.2\| 29.0\| 40.0\| 24.5\| 43.2\| 33.2\| 35.6\| 27.9\| 44.8\| – \| 44.1\| 38.2\| 38.2\| 39.8\| 42.1\| \| pt \| 60.7\| 31.4\| 42.9\| 38.4\| 42.8\| 40.2\| 60.7\| 26.4\| 29.2\| 53.2\| 23.8\| 52.8\| 28.0\| 31.5\| 24.8\| 49.3\| 34.5\| – \| 39.4\| 32.1\| 34.4\| 43.9\| \| ro \| 60.8\| 33.1\| 38.5\| 37.8\| 40.3\| 35.6\| 50.4\| 24.6\| 26.2\| 46.5\| 25.0\| 44.8\| 28.4\| 29.9\| 28.7\| 43.0\| 35.8\| 48.5\| – \| 31.5\| 35.1\| 39.4\| \| sk \| 60.8\| 32.6\| 39.4\| 48.1\| 41.0\| 33.3\| 46.2\| 29.8\| 28.4\| 39.4\| 27.4\| 41.8\| 33.8\| 36.7\| 28.5\| 44.4\| 39.0\| 43.3\| 35.3\| – \| 42.6\| 41.8\| 41.6\| \| sl \| 61.0\| 33.1\| 37.9\| 43.5\| 42.6\| 34.0\| 47.0\| 31.1\| 28.8\| 38.2\| 25.7\| 42.3\| 34.6\| 37.3\| 30.0\| 45.9\| 38.2\| 44.1\| 35.8\| 38.9\| – \| 42.7\| \| sv \| 58.5\| 26.9\| 41.0\| 35.6\| 46.6\| 33.3\| 46.6\| 27.4\| 30.9\| 38.9\| 22.7\| 42.0\| 28.2\| 31.0\| 23.7\| 45.6\| 32.2\| 44.2\| 32.7\| 31.3\| 33.5\| – Table 3: Translation performance as measured in %BLEU for all 462 language pairs Figure 3 Statistical machine translation performance from (Koehn, Birch, and Steinberger 2009) \| EN-DA eTranslation \| Google Translate \| DeepL \| DA-EN eTranslation \| Google Translate \| DeepL \| \|-------------------\|------------------\|-------\|-------------------\|------------------\|-------\| \| \| \| \| \| \| \| \| Public Health \| \| \| \| \| \| \| Without smoothing \| \| \| \| \| \| \| 0.818 \| 0.780 \| 0.621 \| 0.821 \| 0.788 \| 0.615 \| \| With smoothing \| \| \| \| \| \| \| 0.909 \| 0.876 \| 0.759 \| 0.925 \| 0.909 \| 0.751 \| \| Culture \| \| \| \| \| \| \| Without smoothing \| \| \| \| \| \| \| 0.728 \| 0.757 \| 0.770 \| 0.743 \| 0.759 \| 0.774 \| \| With smoothing \| \| \| \| \| \| \| 0.758 \| 0.784 \| 0.906 \| 0.772 \| 0.786 \| 0.900 \| \| General text \| \| \| \| \| \| \| Without smoothing \| \| \| \| \| \| \| 0.706 \| 0.722 \| 0.719 \| 0.707 \| 0.718 \| 0.690 \| \| With smoothing \| \| \| \| \| \| \| 0.737 \| 0.752 \| 0.834 \| 0.741 \| 0.752 \| 0.806 \| \| Finance \| \| \| \| \| \| \| Without smoothing \| \| \| \| \| \| \| 0.685 \| 0.709 \| 0.708 \| 0.679 \| 0.684 \| 0.692 \| \| With smoothing \| \| \| \| \| \| \| 0.775 \| 0.798 \| 0.823 \| 0.828 \| 0.833 \| 0.795 \| Table 17 Comparison of unsmoothed and smoothed BLEU scores across the tools and languages \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|--------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 39 \| 22 \| 4 \| 0 \| 167 \| 23 \| \| Culture (82) \| 0 \| 4 \| 0 \| 0 \| 20 \| 3 \| \| Finance (164) \| 35 \| 7 \| 4 \| 0 \| 56 \| 20 \| \| General (23) \| 6 \| 2 \| 0 \| 0 \| 23 \| 2 \| Table 18 Domain specific translation error types for English to Danish translations from eTranslation \| Error types \| Inconsistent terminology \| Omissions/additions \| Made-up words \| Negation error \| Miscellaneous \| Named entities \| \|-------------\|--------------------------\|--------------------\|--------------\|---------------\|---------------\|----------------\| \| Public Health (266) \| 56 \| 8 \| 3 \| 0 \| 112 \| 44 \| \| Culture (82) \| 0 \| 8 \| 0 \| 0 \| 24 \| 0 \| \| Finance (164) \| 28 \| 12 \| 2 \| 0 \| 68 \| 12 \| \| General (45) \| 7 \| 1 \| 0 \| 0 \| 12 \| 0 \| Table 19 Domain specific translation error types for Danish to English translation from eTranslation 5. Notification of near misses and damage to facilities as well as evacuations The operator or owner is obliged to report incidents and damage to the plant as well as evacuations to the Danish Working Environment Authority. In cases where notification must be made immediately by the South and Southern Jutland Police or by the Danish Working Environment Authority pursuant to section 8 of the Executive Order on Notifications, it is the operator or the owner who has the duty to notify. Overview of notification of near misses and damage to the facility as well as evacuations The table provides an overview of which near misses and evacuations must be reported, when and to whom. The table includes notifications to the South and Southern Jutland Police and the Danish Working Environment Authority under the headings of notification. Notes to the table: a. describe the course of events and describe what preventive measures have been taken so that recurrences are avoided. From 19 July 2018, the notification with associated information must be made in accordance with the common reporting format set out in Annex I, incident types AF, and I, to Commission Implementing Regulation (EU) No. 1112/2014 of 13 October 2014, cf. Appendix 3 in the Notice of Notice. From 19 July 2018, these operators and owners must report the incidents with associated information in accordance with the common reporting format set out in Annex I, incident type AF, and I, to the Commission's Implementing Regulation (EU) No. 1112/2014 of 13 October 2014, cf. Appendix 3 in the Notice of Notice. To Commission Implementing Regulation No 1112/2014, a guide has been prepared, which aims to provide the competent authorities, operators and owners with additional information and examples in order to promote a uniform interpretation of the reporting requirements in the Implementing Regulation. See more under the section "Background" in this guide. It appears from the executive order on medical control of work with ionizing radiation in connection with offshore oil and gas activities, etc., when it must be reported that a person has been exposed to ionizing radiation. Notification of incidents that have or could have resulted in the release of biological agents is stated in the Executive Order on protection against exposure to biological agents in connection with offshore oil and gas activities, etc. It is the responsibility of the operator or owner, respectively, to make a competent assessment of the individual near-incident with a view to whether it should be reported. The operator's or owner's management system for safety and health must state how this assessment is made. It is the operator's or owner's duty to report a near incident. However, everyone has the right to report a near incident. This means that, for example, the party involved can report a recent incident to the Danish Working Environment Authority. In that case, the Danish Working Environment Authority will contact the operator or the owner to clarify any notification from him. The notification should be made as soon as possible for the sake of the possibility of determining the causal link. It is not possible to use the digital notification system EASY to report near misses. Operators and owners who have been granted an operating license for a facility after 19 July 2015 must use the Reporting Formats in Commission Implementing Regulation No 1112/2014. Figure 4 Example of error categorisation for the error typology	ae06581f-ccd9-4bea-a8f8-4b8211eac286	CC-MAIN-2023-50	https://sprogtek-ressources.digst.govcloud.dk/Speciale/Jakob%20Blaaholm%20Nielsen%20-%20Evaluation%20of%20Machine%20Translations%20from%20Google%20Translate,%20eTranslation%20and%20DeepL.pdf	2023-12-04T01:11:24+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00223-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	622,945,813	35,183	eng_Latn	eng_Latn	0.937432	eng_Latn	0.996076	[ "eng_Latn", "eng_Latn", "eng_Latn", "por_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "dag_Latn", "eng_Latn", "dag_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 302, 1269, 2497, 6476, 6502, 9225, 12174, 15092, 17787, 20628, 23360, 26124, 29071, 31841, 34744, 37063, 39623, 42079, 44236, 47066, 49861, 52578, 54434, 57178, 59807, 63277, 66008, 68548, 71362, 73921, 76278, 78842, 81238, 83893, 86485, 88909, 91837, 94269, 96246, 98407, 101224, 103410, 106260, 108673, 111240, 113748, 116370, 118734, 121544, 124160, 126974, 129778, 132455, 135022, 137825, 140583, 143450, 143658, 146162, 149150, 149971, 155869, 157680, 160261, 161201 ]
Risk-sharing Agreements for Medical Devices in Emerging Markets: Opportunities and Challenges 105/2014 INSEAD Healthcare Management Initiative www.insead.edu/hmi [email protected] Written by Ridhima Aggarwal, The Salmon and Rameau Research Programme Manager with the Healthcare Management Initiative at INSEAD and Shruti Veenam, INSEAD MBA'14J. Risk-sharing agreements (RSA) in health care are used as a tool by payers (or insurers) and health technology manufacturers to share the risks associated with bringing new products to market. The aim is twofold: to make new therapies accessible to patients and support innovation. RSAs have been widely implemented in the pharmaceutical sector, but their application to medical devices is limited to only a few examples 1 . While adoption in the devices space is currently at an early stage, these types of contractual arrangements are gaining momentum, particularly in countries with mature healthcare systems. Medical devices differ from pharmaceuticals on a number of dimensions, subjecting each sector to vastly different reimbursement strategies. Innovation in the medical device sector is rapid, with shorter product development cycles (averaging 18 to 24 months) relative to the pharmaceutical sector. Low barriers-to-entry allow new entrants to penetrate the market with similar products within a short span of a new product launch. A growing number of competitors in many segments of the device market increasingly expect payers to reimburse devices based on superior clinical outcomes and cost effectiveness. Hence there is a need for policies and regulation to ensure that innovation continues and better technologies reach patients faster. A review of the published literature and interviews with experts were conducted to learn more about country-level experiences with RSAs in the medical device sector, particularly across emerging markets. This paper thus explores the applicability of RSAs to medical devices, recent examples from around the globe, as well as the perceived challenges of using these schemes to drive adoption or access to new medical technologies. Background RSAs between health care payers and manufacturers are also referred to as "performance-based schemes". While a large number of RSAs in pharmaceuticals are focused on outcomes-based schemes, non-outcomes-based or financial schemes may also have potential for medical devices. In addition to shorter product life cycles and investment recovery periods, the impact of medical devices on health outcomes is more difficult to establish, as medical devices are often combined with other treatments such as medicines or surgical procedures. Second, intellectual property and patenting of medical devices is more fragmented, with diverse players and greater opportunities for new entrants. Finally, the investment needed for evidence collection and development may be difficult to justify against the budget impact of medical devices. Taxonomy A taxonomy of risk-sharing agreements initially developed for the pharmaceutical sector was used as a reference to explore applications of such schemes for medical devices. 2 Non-outcomes based schemes - Population-level price-volume agreements might be applicable to single-use and high-price devices such as joints and stents for which quality-adjusted life-year 1 For more information on RSAs, see http://centres.insead.edu/healthcare-management-initiative/thought- pieces/documents/RSA-OnePager-April2014_000.pdf 2 For the taxonomy used in pharmaceuticals, see http://centres.insead.edu/healthcare-management-initiative/thoughtpieces/documents/RSATaxonomy-April2014_001.pdf (QALY) cost-effectiveness calculations are more feasible than for one-time purchase large medical equipment or reusable devices used to support procedures. - Patient-level utilization caps such as dose caps or price caps may have fewer applications for medical devices, as medical equipment is often used for diagnostic purposes and can only be used once or a set number of times per patient. Similarly, high-price devices such as stents and coils are largely implantable and hence used only once per patient or per procedure. Devices which are procedures in and of themselves, such as energy-based radiation and ultrasound therapies often used in conjunction with a particular delivery method, could potentially be launched via utilization cap schemes. - In some instances, manufacturers may partially fund treatments for a limited period/dosage or the supporting infrastructure required for administration. These approaches may be particularly applicable to large medical equipment or diagnostic tests. Outcomes-based schemes - Conditional coverage (including coverage with evidence and conditional treatment continuation) agreements have already been used for the reimbursement of medical devices. An example of coverage with evidence was when Centers for Medicare and Medicaid Services (CMS) in the U.S. introduced a new policy requiring beneficiaries seeking reimbursement for certain expensive medical devices and drugs to enroll in research as a condition for medical coverage. 3 CMS allowed reimbursement for implantable cardioverter defibrillators (ICD) for certain subgroups on condition that patients' details were recorded by the National Cardiovascular Data Registry (maintained since 2005) and could be used to study the clinical effectiveness of ICDs. In another example, the manufacturer Given Imaging, in collaboration with the Gastroenterological Society of Australia (GESA), maintained a registry of all patients who used PillCam for capsule endoscopy from 2004 to 2009. Conditional treatment continuation schemes linked to individual patients for short-term goals could be applicable to energy-based therapies such as radiology or ultrasound if patients can be attributed to the particular device. - Performance-linked outcome guarantee schemes for clinical endpoints or intermediate outcomes might be applied in cases where patients can be mapped to a particular device. Hence these agreements may be more suited to highpriced implantable devices for which it is easier to track the impact on patients. - Pattern or process-of-care schemes where the reimbursement level is tied to clinical decision-making or practice patterns – e.g. whether or not patients adhere to treatment suggested by a risk-predicting genomic test – have been implemented for Oncotype DX, a genetic test used to quantify the likelihood of breast cancer recurrence and predict the likelihood of chemotherapy benefit for a large portion of early-stage breast cancer patients in the U.S. Other mechanisms for bringing new technologies to the market Medical device manufacturers may launch new devices through other types of collaborations including public private partnerships (PPPs) and discounts (distinct from those characterized under risk-sharing). Manufacturers may enter into a PPP with public payers in emerging markets to improve access. For example, Wipro GE Healthcare Pvt. 3 http://www.cms.gov/Center/Special-Topic/Medicare-Coverage-Center.html Ltd. in partnership with Ensocare have formed a consortium with the government of Maharashtra in India to set up advanced diagnostic facilities – including installation of CT scanners, digital radiography systems, color Doppler systems, and x-ray units -- at 22 government hospitals. Additionally, manufacturers may give discounts either directly to providers or payers with the aim of increasing market share or profits. Discounts are built into the marketing costs of the product and thus not considered a mechanism to share risk. While RSAs are widely used as a risk-sharing method, some experts question the rationale for classifying financial- or non-outcomes based agreements as RSAs since they are often payer driven. Some manufacturers offer financial discounts and rebates to improve uptake and show that the technology works, thus mitigating risk as part of the marketing strategy against low adoption of a new technology. Others offer devices to hospitals for free for a certain period to encourage trial of the equipment. In neither case is risk being shared by the payer. Industry Examples A limited number of risk-sharing examples were identified in the medical devices sector, all of which were implemented in developed markets such as the U.S., UK and Australia, the same countries leading RSAs in the pharmaceutical sector. In the Australian example, Medicare signed a RSA with Given Imaging on PillCam Endoscopy 4 . An agreement was reached between Genomic Health and UnitedHealthcare (UHC) 5 in the U.S. and the National Institute for Health and Care Excellence 6 (NICE) in the UK on Oncotype DX. UHC in the U.S. agreed on a list price with the payer, with both companies tracking the results to decide if the genetic test was having the anticipated effect on actual clinical practice. NICE has begun making recommendations on medical devices in the last three to four years, and an RSA was implemented following NICE's assessment that the test was not cost-effective; Genomic Health subsequently lowered the price as part of the agreement. Some experts in the UK suggest that RSAs in the medical device sector are not outcomesbased and that the focus is often on reaching a cost-effectiveness threshold, making them financial-based RSAs in most cases. Risk Sharing in Emerging Markets RSAs are uncommon in developing countries. Discussions with experts revealed several interesting insights for the low number of RSA implementations. First, many experts agree that developed countries are more favourable markets since they are more economically advanced and often supported by publicly funded health care systems. In countries such as China, India and others in Southeast Asia, healthcare is largely funded out-of-pocket by patients, thus placing all the risk on patients and mitigating opportunities for risk-sharing across the different stakeholders. Therefore RSAs are 4 O'Malley. SP, Selby, WS and Jordan, E. A successful practical application of Coverage with Evidence Development in Australia: Medical Services Advisory Committee interim funding and the PillCam Capsule Endoscopy Register, International Journal of Technology Assessment in Health Care (2009). Available at http://journals.cambridge.org/action/displayFulltext?type=1&fid=5961428&jid=THC&volumeId=25&issueId=03&aid=5961 420&bodyId=&membershipNumber=&societyETOCSession=. 6 NICE Diagnostics Guidance 10. Gene expression profiling and expanded immunohistochemistry tests for guiding adjuvant chemotherapy decisions in early breast cancer management: MammaPrint, Oncotype DX, IHC4 and Mammostrat; September 2013. Available at http://publications.nice.org.uk/gene-expression-profiling-and-expandedimmunohistochemistry-tests-for-guiding-adjuvant-chemotherapy-dg10. 5 Stockholm Network, Sharing the Burden: Could risk-sharing change the way we pay for healthcare?; 2010. Available at http://www.stockholm-network.org/downloads/publications/Sharing_the_Burden.pdf. viewed as an unlikely proposition in these markets. Second, developing countries are often playing catch-up with existing technologies, particularly devices. Thus the primary objective of manufacturers in these markets is to increase uptake of their products, whereas efficiency improvement (through RSAs and other means) is more often the focus in developed markets such as Europe. Industry experts hinted that discussions may be underway to implement RSAs in the pharmaceutical sector in Malaysia, Indonesia and the Middle East, though details are yet to be released. Device Manufacturers' Perspective RSAs are not so obvious or instantly desired in emerging markets, and the following reasons were cited by manufacturers. First, whether to enter a risk-sharing agreement in an emerging country is simply a commercial question. Some are keen to maintain margins on their products when attempting to penetrate new markets, in the belief that high profitability enables sustainable growth. Global brands invest significantly in these new markets to differentiate themselves with the aim of creating new markets for their devices and to grow market share. Entering into formal arrangements with governments might encourage health departments to create formularies (as with pharmaceuticals), which are often unwanted by medical device manufacturers. Second, firms which make inroads into Asian markets face the challenge of lack of evidence-based data. The majority of evidence around disease prevalence and treatment response rates to prove device effectiveness is based on sample patient populations in the Western world, making it difficult to apply to developing economies with significantly different demographics. RSAs would require a new body of data that is relevant to local populations to serve as evidence. Third, manufacturers must build stronger relationships with their stakeholders to have greater influence over the full continuum of care, rather than simply playing the role of treatment provider. Better partnerships are needed along the entire chain of care in order to move beyond the perceived transactional contribution and contribute effectively to disease management. Fourth, a fair number of emerging countries are attempting to emulate the pricing policies of the West, despite the difference in economic conditions, population needs and health care systems. Some manufacturers have questioned the suitability and applicability of international reference pricing to emerging markets, out of concern about profitability in the entire region. Nonetheless, manufacturers continue to explore ways to accelerate access to new technologies, particularly with the growing market opportunity in emerging economies. While some are evaluating cost-sharing, financial or discount schemes, others are moving into the service domain – for example, by offering an entire diagnostic facility to support their device. Challenges RSA activity has grown in both pharmaceutical and medical device sectors, but significant challenges remain, particularly in emerging markets. - Several pharmaceutical RSAs have shown that collecting evidence and supporting compliance can be expensive, with particularly large expenses associated with outcomes-based agreements. - Administration can be complex. - Infrastructure for data collection such as computers and internet access is often lacking in emerging markets. - There is uncertainty around interpretation of results. If a drug under a RSA, for example, is used to treat an acute illness where the outcome being measured as the number of years the patient survives after taking the treatment, if the patient dies from unrelated reasons such as an accident or failure of a surgical procedure, it must be ensured that the death is not attributed to the failure of the drug. These measurements can be difficult to monitor on a large scale and measuring the impact of the therapy can be a significant challenge. - Conflicts of confidentiality among payers and independent organizations such as NICE have emerged as another issue. When manufacturers approach NICE and negotiate a price for a therapy, they often request that the price be kept confidential, although NICE is compelled to publicly disclose the price of drugs or devices that are being reimbursed by the NHS. This is considered a significant challenge in the implementation of RSAs. - Rapid technological improvements in the medical device industry also pose challenges. An RSA, for example, could be implemented for version 2.0 of a device, and a more effective 3.0 version might be developed 18 months later. Would the original RSA hold when the 3.0 is launched and can it be transferred to the new device? For this reason, NICE often keeps all RSAs under review in cases where a more advanced therapy might become available. - Multiple layers of price negotiations make it difficult to enforce RSAs at a single price. Manufacturers and NICE agree on a price, but that is often not reflected at the point of delivery. Hospitals and clinics in the NHS procure therapies through a decentralized purchasing system, making it difficult to enforce the agreed price.	<urn:uuid:b1803dab-0224-44a9-9dd0-0f7e0266dc45>	CC-MAIN-2024-26	https://www.insead.edu/sites/default/files/assets/dept/centres/hmi/docs/risksharingmedtech-insead-hmi.pdf	2024-06-24T10:36:20+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-26/subset=warc/part-00052-44971353-df4b-48d7-8025-975e8feb989b.c000.gz.parquet	713,595,812	3,003	eng_Latn	eng_Latn	0.942534	eng_Latn	0.996753	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 343, 3663, 7119, 11080, 14170, 16264 ]
December 8, 2017 Re: Consultation regarding proposed school boundary changes in central Kingston Dear Central and Sydenham School Councils: As we shared with you in October, Senior Staff of the Limestone District School Board is conducting a consultation with parents/guardians of students attending schools in central Kingston regarding proposed boundary changes. As part of the Senior Staff proposal, Central and Sydenham Public Schools would be designated within the catchment area of the new Kingston Intermediate and Secondary School presently under construction on Kirkpatrick Street, and scheduled to open in the 2019-2020 school year. Consideration of these boundary changes is made necessary due to enrolment changes related to the French Immersion and English programs at Rideau Public School; and the Board's accommodation review decision regarding the Intermediate and Secondary Schools in central Kingston (June 19, 2013). We have planned a meeting to consult with parents and guardians of students attending Central and Sydenham Public Schools from 6:30-8:30 p.m. on January 15, 2018 at Sydenham P.S. after your scheduled School Council Meeting. This will give all school parents and guardians the opportunity to participate and provide feedback on the proposed boundary changes. An alternate date of January 18, 2018 has been scheduled if required (due to possible inclement weather). Board staff will attend the meeting to present a brief outline of the proposed boundary changes. Parents and guardians who attend will have the opportunity to provide their feedback on the proposed boundary changes and to ask questions. Our Board recording secretary will take notes of the meeting. Trustees may attend the meeting; however, their role will be that of observer. In addition, parents and guardians who cannot attend the meeting, can provide their feedback via an online survey that will be provided in the new year. Additional information about the proposed boundary changes can be found on the Limestone website at HTTP://WWW.LIMESTONE.ON.CA/PARC/BOUNDARY_CHANGES If you have any questions about the meeting, please contact Principal Jennifer Lawless by December 19, 2017. Thank you for your assistance in gathering parent and guardian feedback. Sincerely, Debra Rantz Director of Education cc. Jennifer Lawless, Principal, Central & Sydenham P.S. Area Trustee Paula Murray Area Trustee Alec Ross 220 Portsmouth Ave., Kingston, ON K7M 0G2 P: 613-544-6920 \| F: 613-544-6804 TF: 1-800-267-0935 \| TTY: 613-548-0279 www.limestone.on.ca	<urn:uuid:83ec9616-8917-4372-8976-7b33fa42f27e>	CC-MAIN-2018-09	http://www.limestone.on.ca/PARC/Documents/Central%20&%20Sydenham%20SC%20Boundary%20Consultation%20Dec%202017.pdf	2018-02-21T01:05:25Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891813187.88/warc/CC-MAIN-20180221004620-20180221024620-00558.warc.gz	502,354,654	552	eng_Latn	eng_Latn	0.991756	eng_Latn	0.991756	[ "eng_Latn" ]	false	rolmOCR	[ 2572 ]
Christmas Celebrations Christmas Eve was a wonderful and joyous celebration for all at Tender Heart. We danced and sang and laughed and enjoyed celebrating this time together. Children were treated to individual bags of sweets and cakes personally handed out by Santa Claus. Children made Christmas decorations and cards to share with their family. It was a special day to welcome in Christmas. Tender heart has launched a Beautician Training course. This was in response to some young women wanting work other than laborious cleaning work. These young women are now learning skills in manicure, facials, massage, hair styling, make-up and much more. They are flourishing and seeing a brighter future for themselves. Expansion During 2015 Due to the level of support we have received Tender Heart has been able to complete a number of building projects this year including the building of three new classrooms, two of which now house our special needs children, a new bathroom block and a concrete table for the children to eat lunch. Specialised training for Special Educators Tender Heart conducted a computer training course to assist Special Education teachers in registering special athletes in remote villages throughout Haryana. This training will result in many athletes having the opportunity to participate in the Special Olympics as their details will be accurately recorded with the appropriate authority. Women’s Profile Meera came to Tender Heart in late 2014 after moving here from Bihar. She has two children, Mohini and Manjeet, who are both well performing students at the school. Meera holds a very important role at Tender Heart as the school cook and produces unbelievably delicious food. She has also been working with the women empowerment programme and has shown a real flair for design and handicrafts. Student’s Profile Muskan is a Grade 10 student and is a strong academic student. Muskan is also talented in music, dancing and painting. Muskan is often called upon to sing for Tender Heart events, something Muskan enjoys as well as the audience. She has great leadership skills wants to go into higher education and become a teacher. Please consider sponsoring a child Tender Heart has a policy of not saying no to any child in need of education. While this is extremely generous, it is also very difficult to maintain without considerable help from others. This is where you could come in. Please consider sponsoring a child. There are 15 children within Tender Heart who are in particular need of financial assistance to ensure their education. For around $500 Australian dollars, you can cover all costs for a child’s education for one year. If this is something you feel you could manage, please contact us and we will send you further information on these children. As our school year commences in April, we are really hoping these children will find sponsors before then to ensure their education throughout 2016. Some of the children in need of sponsorship Product of the Month Cushion Covers: these beautiful cushion covers made from cotton look really stylish and are sure to brighten up any room. Coming Up! A writing project, A Heart for Writing, will take place at Tender Herat during January and February. Details in next newsletter THANK YOU! THANK YOU!! THANK YOU!!! Josh Goldsmith and David McDonald of the Chi-Phi Foundation of Florida for the building of the new special needs classrooms Liz & Gavin Style for sponsoring the education of Guarav Prajapti Tender Heart Educational Society Village Bhatola, Tigaon Road Faridabad – 121008, Haryana, India Ph No: +91-9350844393, +91-9718516337 Email: [email protected] Web: www.tenderheartngo.org	<urn:uuid:7e97e1c5-abaa-4057-817a-27f11945ad92>	CC-MAIN-2018-51	http://www.tenderheartngo.org/uploads/1/8/5/8/18581574/issue_8.pdf	2018-12-10T11:59:27Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823322.49/warc/CC-MAIN-20181210101954-20181210123454-00322.warc.gz	490,165,767	750	eng_Latn	eng_Latn	0.998405	eng_Latn	0.998485	[ "eng_Latn", "eng_Latn" ]	false	docling	[ 1423, 3719 ]
Pope's defenders push back John L. Allen Jr. \| May. 16, 2010 NCR Today Rome -- Both in the media and on the street, defenders of Pope Benedict XVI pushed back this weekend ? in effect, insisting that the pope still enjoys popular support, and that media focus on the Catholic church vis-à-vis the sexual abuse of minors, as opposed to the broader culture, amounts to ?moral panic.? On Saturday, the prestigious Jesuit-edited journal Civilità Cattolica published the second installment of a twopart series on pedophilia. Meanwhile on Sunday, an umbrella group of lay Catholic movements in Italy organized a massive rally in St. Peter?s Square to show support for Benedict XVI, which drew more than 150,000 people. Though neither development was sponsored by the Vatican, both were obviously welcomed by senior advisors to Benedict XVI. tThe Civilità Cattolica article was written by Italian Jesuit Fr. Giovanni Cucci and German Jesuit Fr. Hans Zollner, both of whom teach in the Institute of Psychiatry at the Pontifical Gregorian University in Rome. tIn summary, their piece makes the following points: Psychological literature on pedophilia is confused on both the definition and the causes of the disorder, but there?s general agreement on its gravity. Pedophiles ?do not recognize they have a problem, are highly resistant to therapy, [and] they lack a perception of the gravity of the acts they commit.? Media focus on sex abuse in the Catholic church, the authors assert, is an example of ?moral panic,? the defining elements of which are: 1) presenting old information as if it?s new, and 2) obscuring the real statistical dimension of the problem. Cucci and Zollner cite Philip Jenkins of Pennsylvania State University, who has written extensively on the sex abuse crisis in the United States. Priestly celibacy does not cause pedophilia. Citing data both for the United States and elsewhere, Cucci and Zollner assert that the instance of pedophilia is at least as high in sporting associations, social institutions that serve young persons, and Protestant churches, and in each case those acts of abuse are committed by non-celibate persons. Two-thirds of the sexual abuse of children occurs in the family, committed by people who aren?t celibate. Social attitudes in recent decades, the authors assert, have oscillated between criminalization and liberalization of sexual contact with minors. The cite the German Green Party, which in 1985 proposed the decriminalization of sexual relationships with minors ? noting the irony that some German Greens have been among the fiercest critics of the Catholic church in Germany and of Pope Benedict XVI on the church?s handling of the sex abuse crisis. Criticism of Pope Benedict XVI for allegedly being too slow to remove predator priests, the authors assert, overlooks the fact that guilt has to be definitively established before penalties can be imposed. The media, the authors assert, ?don?t hesitate to put accused persons on the front page, as if they were automatically guilty, and then ?forget? to report the news if they?re found innocent.? ?There are, unfortunately, many sad aspects to this affair, which are certainly not very edifying,? Cucci and Zollner write, referring to media coverage of the pope?s record and the sexual abuse crisis. ?One hopes the appropriate lessons are drawn.? Civilità Cattolica is reviewed by the Vatican?s Secretariat of State prior to publication, and is generally believed to reflect the thinking of senior Vatican officials. Sunday?s rally, meanwhile, brought tens of thousands of Catholic laity from throughout Italy to St. Peter?s Square for a rally sponsored by the Consulta nazionale della aggregazioni laicali, an umbrella group for 67 lay organizations. Special trains and buses were organized across the country to bring Catholics to St. Peter?s Square, despite chilly and rainy weather on Sunday. The event was carried live on Catholic television and Internet sites in Italy. t?We want Benedict XVI to hear our affection, after months of repeated attacks against him and the whole church,? said Gabriele Brunini, president of the National Confederation of Mercy, a Catholic charitable group in Italy. t?We can?t forget the people who?ve been victims of abuse,? Brunini said, ?but to utilize the scandal of pedophile priests to strike at the pope and the church, trying to reduce them to silence, is something else entirely.? tClaudia Nodari, president of the St. Vincent de Paul Society in Italy, struck a similar note. t?We?re with the pope,? she said, ?against the effort to cancel out all the good the church and its ministers have done, and are doing, for the spiritual and material welfare of people all over the world.? tGuido Boldrin, a member of the ?Communion and Liberation? movement who made the trip from Milan to Rome to take part in the rally along with his wife and four daughters, said he wanted to protest the ?cynical and unjust? campaign against Benedict XVI on the part of the ?national and international media.? tThe gathering in St. Peter?s Square began with a liturgy of the Word led by Cardinal Angelo Bagnasco, president of the Italian bishops? conference, and culminated with Benedict XVI?s regular Sunday prayer of the Regina Coeli. Seventy members of the Italian parliament turned out, representing all the major political parties in Italy. Continuing the tone he set during his trip to Portugal, Benedict XVI insisted that the problem facing the church comes from internal sin rather than external attacks. ?The true enemy to fear and to combat is sin, spiritual evil, which at times, unfortunately, infects even members of the church,? the pope said. tThe rally in Rome built on Benedict?s four-day trip to Portugal last week, when he drew large crowds throughout the country ? including an estimated half-million for a May 13 Mass in Fatima, and some 200,000 for his concluding Mass on May 14 in Porto (which is located in the north of Portugal, where levels of religious faith and practice remain comparatively high.) tBoth Vatican officials and bishops in other parts of the world pointed to the turnout in Portugal as evidence that the pope?s base is still with him. ?I think it?s very encouraging that at this time of crisis in the church, that the Holy Father would experience the support he has here,? said Cardinal Sean O?Malley of Boston, who was in Portugal participating in the papal visit. O?Malley spoke in a May 13 interview with NCR after the papal Mass in Fatima. [John Allen is NCR senior correspondent. His e-mail address is [email protected].] Benedict's Trip to Portugal Catholic journalism. O'Malley on the crisis, the visitation of women's orders, and Fatima [2], Allen's May 14 column Support independent It's dialogue or death, pope says in Portugal [3] Pope lauds 'maternity of God' as counter-sign to egoism [5] A Tale of Two Fatimas [4] Pope consecrates world's priests to Mary [6] Pope?s antidote to secularism: saints, not structures [8] Support independent Catholic journalis Image not found [1] http://ncronline.org/files/images/donate_ncr.gif An ?Affirmative Orthodoxy? tour de force in Portugal [7] On the crisis, Benedict XVI changes the tone [9] Sex abuse crisis 'terrifying,' pope says [11] Pope on secularism: Seek dialogue, but be ready for martyrdom [10] Benedict in Portugal: A different crisis, secularism, and 'Marian Cool' [12] Allen's column for May 7 John Allen's recent reporting from Rome Pope's defenders push back [13] 'The days of cover-up are over,' Schönborn [15] Benedict?s defense may mean tainting John Paul II [14] Naming Pell to Bishops would be a landmark move [16] Source URL (retrieved on 05/26/2017 - 16:33): https://www.ncronline.org/blogs/ncr-today/popes-defenderspush-back Links: http://openx.ncronline.org/www/delivery/ck.php?oaparams=2__bannerid=30__zoneid=56__cb=a2fbd2d8b1__oadest=ht [1] [2] http://ncronline.org/node/18304 [4] http://ncronline.org/node/18300 [3] http://ncronline.org/node/18302 [5] http://ncronline.org/node/18287 [7] http://ncronline.org/node/18271 [6] http://ncronline.org/node/18280 [8] http://ncronline.org/node/18260 [10] http://ncronline.org/node/18254 [9] http://ncronline.org/node/18259 [11] http://ncronline.org/node/18252 [13] http://ncronline.org/node/18332 [12] http://ncronline.org/node/18190 [14] http://ncronline.org/node/18228 [16] http://ncronline.org/node/18217 [15] http://ncronline.org/node/18247	<urn:uuid:f526bb34-c8f6-48c0-9808-52d873e44c48>	CC-MAIN-2017-22	https://www.ncronline.org/printpdf/18332	2017-05-26T21:33:11Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463608684.93/warc/CC-MAIN-20170526203511-20170526223511-00241.warc.gz	1,152,710,450	2,009	eng_Latn	eng_Latn	0.977867	eng_Latn	0.99637	[ "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3113, 6232, 8486 ]
Balance The Books Young Enterprise has created a series of board games to help students become more financially capable. Balance The Books teaches students how to record personal financial transactions. Players learn how different situations impact on their financial positions, and collect risk and reward cards. Student learning Through Balance The Books, students will: Understand how their savings can grow and shrink. Learn the difference between risk (expenses) and reward (income). Learn about social responsibility and the benefits of unpaid work. Compare and contrast their savings with other players. Curriculum links Personal Financial Management is a fundamental part of a young person's education. Balance The Books is designed to support the development of all five key competencies. The game also has strong links to the Social Sciences and Mathematics and Statistics learning areas. Download resources now All New Zealand teachers can download and use our resources free of charge. Signing up with Young Enterprise only takes a minute – visit http://youngenterprise.org.nz/findresources/ to start using these resources in your classroom today Contact us Visit http://youngenterprise.org.nz/ to find out more, or contact us today on 04 570 0452. About Young Enterprise Young Enterprise Trust has been supporting teachers and students for more than 30 years. We offer enterprise programmes for students of all ages, and have a huge collection of resources that can be freely used in your classroom. Year 4-6 45 mins Mathematics and Statistics Social Sciences Free to NZ schools Led by teachers Training Available	<urn:uuid:65fc3fab-06cb-45b2-b71c-21beb6efd5ca>	CC-MAIN-2020-45	http://youngenterprise.org.nz/find-resources/balance-the-books/showOverview	2020-10-25T10:26:01+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-45/subset=warc/part-00027-6409130e-6e9b-44d1-90ec-9f9d0ade2504.c000.gz.parquet	189,586,525	309	eng_Latn	eng_Latn	0.997969	eng_Latn	0.997969	[ "eng_Latn" ]	false	rolmOCR	[ 1646 ]
RCW 34.05.470 Reconsideration. (1) Within ten days of the service of a final order, any party may file a petition for reconsideration, stating the specific grounds upon which relief is requested. The place of filing and other procedures, if any, shall be specified by agency rule. (3) If a petition for reconsideration is timely filed, and the petitioner has complied with the agency's procedural rules for reconsideration, if any, the time for filing a petition for judicial review does not commence until the agency disposes of the petition for reconsideration. The agency is deemed to have denied the petition for reconsideration if, within twenty days from the date the petition is filed, the agency does not either: (a) Dispose of the petition; or (b) serve the parties with a written notice specifying the date by which it will act on the petition. (2) No petition for reconsideration may stay the effectiveness of an order. (4) Unless the petition for reconsideration is deemed denied under subsection (3) of this section, the petition shall be disposed of by the same person or persons who entered the order, if reasonably available. The disposition shall be in the form of a written order denying the petition, granting the petition and dissolving or modifying the final order, or granting the petition and setting the matter for further hearing. (5) The filing of a petition for reconsideration is not a prerequisite for seeking judicial review. An order denying reconsideration, or a notice provided for in subsection (3)(b) of this section is not subject to judicial review. [1989 c 175 s 21; 1988 c 288 s 421.] Effective date—1989 c 175: See note following RCW 34.05.010. Page 1	<urn:uuid:f4d8565b-ac5c-4a57-9315-bda4d4c0f230>	CC-MAIN-2024-51	https://app.leg.wa.gov/RCW/default.aspx?cite=34.05.470&pdf=true	2024-12-02T09:56:57+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00226-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet	79,072,457	372	eng_Latn	eng_Latn	0.993924	eng_Latn	0.993924	[ "eng_Latn" ]	false	rolmOCR	[ 1695 ]
SUBSTANCE USE DISORDER Quitting can be hard. Don't wait. Get support to start your journey to recovery. Your health plan provides many treatment options. Choose treatment facility or program designed to meet your individual needs. Learn more about how to access your health plan benefits on the back of this flyer. Instructions for accessing your substance abuse treatment benefits through your health plan. \| Blue Shield of California Members \| Kaiser Permanente Members for your Kaiser facility \| \|---\|---\| \| 1. Once you choose the treatment facility/program you would like to attend, reach out directly to the treatment facility/program Admission Offci e. 2. The treatment facility/program will do an assessment by collecting important medical/clinical information to determine your medical suitability and the level of care needed. 3. If medically approved by the treatment facility/program, they will handle your authorization to receive services through your Blue Shield of CA health beneftis. 4. They will instruct you about next steps to enter the treatment facility/program. \| 1. Reach out to your primary care physician or directly to the Addiction Medicine Recovery Services (AMRS) for your Kaiser facility: https://thrive. kaiserpermanente.org/care- near-you/northern-california/ gsaa/departments/psychiatry/ addiction-medicine-recovery- services-amrs/ 2. You will be assessed by Kaiser’s AMRS program to determine the service that will best meet your clinical needs. 3. You will be informed in writing when a referral to a treatment facility/program is authorized. 4. An Authorization for Medical Care form describing the specifci treatment authorized, will be sent to the treatment facility/program. The treatment facility/program may contact the member directly to arrange admission. \| The Center of Excellence is a new benefit option available through all health plans that requires a preauthorization based on an appropriate level of care for your individual need. It is an inpatient substance use clinic in Maryland that was established to treat fire fighters who require inpatient support to address addiction resulting from trauma. Scan the QR code for more information:	<urn:uuid:23ff441c-495b-43d5-a2a8-d86d46880de9>	CC-MAIN-2024-30	https://sfhss.org/resource/iaff-center-excellence/download	2024-07-21T10:31:17+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-30/subset=warc/part-00235-65338ae2-db7f-48fa-a620-71777c40d854.c000.gz.parquet	455,523,324	446	eng_Latn	eng_Latn	0.998416	eng_Latn	0.998613	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 318, 2198 ]
T3N3 SERIES Ø50mm Touch Beacon Selection Guide IOD- RYG Color order can be arbitrarily exchanged * Blue available per request low (left) to high (right) priority. Specifications IB- RGB (7 different colors controlled by software) Dimensions Wiring Diagram T3N3-IO \| Line order \| Line color \| Note \| \|---\|---\|---\| \| 1 \| Brown \| Power + \| \| 2 \| White \| Input \| \| 3 \| Blue \| Power - \| \| 4 \| Black \| Output \| \| 5 \| - \| N/A \| T3N3-IB T3N3-IOD \| Line order \| Line color \| Note \| \|---\|---\|---\| \| 1 \| Brown \| Power + \| \| 2 \| White \| IB + \| \| 3 \| Blue \| IB - \| \| 4 \| Black \| Power - \| \| 5 \| - \| N/A \| Quick Disconnect \| Line order \| Line color \| Light color \| \|---\|---\|---\| \| 1 \| Black \| Output \| \| 2 \| Brown \| Power + \| \| 3 \| Green \| Signal input \| \| 4 \| Yellow \| Signal input \| \| 5 \| Blue \| Power - \| \| 6 \| Red \| Signal Input \| 1 Male 3	<urn:uuid:966ba3e4-7934-45b4-9d9f-a1b372c017ed>	CC-MAIN-2022-05	https://acrossland.com/wp-content/uploads/2018/07/T3N3-V1.2.2.pdf	2022-01-17T23:14:19+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-05/subset=warc/part-00125-1e2959d8-5649-433a-b76e-f1b876a6479d.c000.gz.parquet	152,524,533	308	eng_Latn	eng_Latn	0.555498	eng_Latn	0.837482	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 235, 847 ]
HORTON HEARS A WHO! Connect the Dots to Horton! Start at #1 and connect the dots until you see a picture of Horton! Dr. Seuss Properties TM & © 2010 Dr. Seuss Enterprises, L.P. All Rights Reserved.	<urn:uuid:2860a7c4-e96a-4b6e-850e-2b49e202d363>	CC-MAIN-2020-50	https://lacatholics.org/wp-content/uploads/2020/09/Where-is-Horton.pdf	2020-11-27T08:33:11+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-50/subset=warc/part-00073-8431e8c9-c763-4c27-b286-ba1dd7e2631e.c000.gz.parquet	351,639,262	55	eng_Latn	eng_Latn	0.894305	eng_Latn	0.894305	[ "eng_Latn" ]	false	rolmOCR	[ 201 ]
MONDAY SEPTEMBER 8, 2014 SAVE THE DATE 34 th Annual Stockman-Pryce Scholarship Golf Tournament WHEN: Monday September 8, 2014 12:30 PM shotgun start WHERE: East Aurora Country Club 300 Girdle Road East Aurora, NY FOR FURTHER INFORMATION CONTACT: Paul McGarvey [email protected] 716-691-8501 William Schutt [email protected] 716-683-5961 www.wnywea.org	<urn:uuid:f38545f6-cbef-4f1d-8c70-6b9446545079>	CC-MAIN-2017-43	http://wnywea.org/assets/140908_Stockman-Pryce.pdf	2017-10-18T18:14:09Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187823067.51/warc/CC-MAIN-20171018180631-20171018200631-00794.warc.gz	360,706,641	130	eng_Latn	eng_Latn	0.533848	eng_Latn	0.533848	[ "eng_Latn" ]	false	rolmOCR	[ 370 ]
NOTICE OF POLL Teignbridge District Council Election of a Parish Councillor for Dunchideock Notice is hereby given that: 1. A poll for the election of a Parish Councillor for Dunchideock will be held on Thursday 6 February 2020, between the hours of 7:00 am and 10:00 pm. 2. The number of Parish Councillors to be elected is one. 3. The names, home addresses and descriptions of the Candidates remaining validly nominated for election and the names of all persons signing the Candidates nomination paper are as follows: 4. The situation of Polling Stations and the description of persons entitled to vote thereat are as follows: \| CERIO Gervaise Sarah \| (Address in Teignbridge District) \| \| John S Moor (+) \| \|---\|---\|---\|---\| \| SWAIN Dudley Henry \| The Croft, Dunchideock, Exeter, EX2 9TR \| Chartered Civil Engineer (RTD) \| Trevor J Baker (+) \| i \| Situatoi n of Polling Statoi n \| Statoi n Number \| \|---\|---\| \| Dunchideock Village Hall, Dunchideock \| 1 \| Dated: 23 January 2020 Printed and published by the Returning Officer, Forde House, Brunel Road, Newton Abbot, Devon, TQ12 4XX	<urn:uuid:4a294995-b333-496f-949c-fe0b7c9accf6>	CC-MAIN-2021-17	https://www.dunchideock.org.uk/uploads/1/1/9/5/119593673/notice_of_poll_feb_2020.pdf	2021-04-14T20:00:32+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00055-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet	852,553,169	319	eng_Latn	eng_Latn	0.99698	eng_Latn	0.99698	[ "eng_Latn" ]	false	rolmOCR	[ 1095 ]
Quantification of quantum correlation of ensembles of states Michal Horodecki,1 Aditi Sen(De),1,2,3 and Ujjwal Sen1,2,3 1Instytut Fizyki Teoretycznej i Astrofizyki, Uniwersytet Gdański, PL-80-952 Gdańsk, Poland 2ICFO-Institut de Ciencies Fotoniques, Mediterranean Technology Park, 08860 Castelldefels (Barcelona), Spain 3Institut für Theoretische Physik, Universität Hannover, D-30167 Hannover, Germany (Received 7 July 2006; published 26 June 2007) We present a measure of quantum correlation of an ensemble of multiparty states. It is based on the idea of minimal entropy production in a measurement whose elements are locally distinguishable. It is shown, for pure ensembles, to be a relative entropy distance from a set of ensembles. For pure bipartite ensembles, which span the whole bipartite Hilbert space, the measure is bounded below by the average entanglement. We naturally obtain a monotonicity axiom for any measure of quantum correlation of ensembles for single systems. We evaluate the measure for certain cases. Subsequently we use this measure to propose a complementarity relation between our measure and the accessible information obtainable about the ensemble under local operations. The measure is well defined even for the case of a single system, where the complementarity relation is seen to be yet another face of the “Heisenberg uncertainty relation.” DOI: 10.1103/PhysRevA.75.062329 PACS number(s): 03.67.Mn, 03.65.Ud I. INTRODUCTION Quantifying quantum correlation of states is a much studied problem in quantum information (see, e.g., Refs. [1–5]). Several measures have been proposed for such quantification. Prominent among them are distillable entanglement [1], entanglement of formation [1], relative entropy of entanglement [2], etc. One of the reasons for the fascination is that quantum correlations are a resource for several nonclassical tasks, like dense coding [6] and quantum teleportation [7]. However to our knowledge, the problem of quantification of quantum correlation of an ensemble of states has never been studied. Such a quantification has potential applications in quantitative studies of quantum cryptographic tasks [8–14]. In this paper we propose a measure of quantum correlation $ Q $ of an ensemble of states. A trivial way to quantify quantum correlation of an ensemble of states is to take an average of an individual property of the constituent states in the ensemble. For example, one could take the average entanglement of formation [1] of the ensemble states. However, such an averaging over a property of the individual states cannot capture the complexity of the ensemble as a whole. To take into account the structure of the ensemble as a whole, the measure must depend on the ensemble as a whole. A simple measure of quantum correlation of multiparty ensembles could be the difference $ D $ between the globally accessible information and the locally accessible information. However, accessible information is an operationally useful quantity, and one aim of defining $ Q $ is to estimate accessible information under different sets of operations. Moreover, $ D $ vanishes for single-party ensembles, whereas $ Q $ will be seen to be nontrivial also in such cases. We begin in Sec. II with a discussion of the concept of accessible information, which will be needed later on in the paper. We define the measure in Sec. III, and present the motivations behind such a definition. In Sec. IV, we relate our measure to relative entropy distances. We show that for pure ensembles, it can be seen as a relative entropy distance from a set of “classical” ensembles. For a pure bipartite ensemble, which spans the whole bipartite Hilbert space, we show that measure is bounded below by the average relative entropy of entanglement [2]. In Sec. V, we discuss the monotonicity properties of the measure, and propose the first axioms for any measure of quantumness of an ensemble of a single system. We then evaluate the measure for the case of four Bell states (given with equal prior probabilities) in Sec. VI. We also evaluate the measure for other more general ensembles. We subsequently propose (Sec. VII) a complementarity relation (see Refs. [15,16]) between this measure of quantum correlation of an ensemble and the accessible information obtainable about the ensemble, under the relevant class of allowable operations. In the case of a single system, this complementarity is proven under a certain assumption, and is seen to be yet another face of the “Heisenberg uncertainty relation” (Sec. VIII). Importantly, both the information gathering and disturbance terms in this relation are information-theoretic, in contrast to, e.g., Ref. [17]. We give our conclusions in Sec. IX. II. ACCESSIBLE INFORMATION In this section, we discuss the concept of accessible information, that quantifies the amount of classical information that can be decoded from an ensemble of quantum states. Suppose therefore that a source encodes a classical message $ x $, with probability $ p_x $, in a quantum state $ \varrho_x $, and sends the resulting ensemble \[ E = \{p_x, \varrho_x\} \] to one or more receivers. Let $ X $ be the (classical) random variable corresponding to the message variable $ x $. The receiver(s) are able to perform a set of quantum operations $ \Lambda $. The task of the receiver(s) is to gather as much information as possible (by using the allowed operations in $ \Lambda $) about the index $ x $. To do so, the receiver(s) performs (perform) a measurement $ M $ (that is in $ \Lambda $), that gives the result $ m $, with probability $ q_m $. Let the corresponding post-measurement ensemble be Let $ Y^M $ be the (classical) random variable corresponding to the measurement outcomes in the measurement $ M $. The information gathered can be quantified by the classical mutual information between the random variables $ X $ and $ Y^M $ [18]: \[ I(X;Y^M) = H(\{p_x\}) - \sum_m q_m H(\{p_{x\|m}\}). \] (1) Here \[ H(\{r_x\}) = - \sum_x r_x \log_2 r_x \] is the Shannon entropy of the probability distribution $ \{r_x\} $. Throughout the paper, we calculate all the quantities on amounts of information transfer in bits (binary digits). Note that the mutual information can be seen as the difference between the initial disorder and the (average) final disorder. The receiver(s) are interested to obtain the maximal information, which is the maximum of $ I(X;Y^M) $ over all measurement strategies. This quantity is called the accessible information under $ \Lambda $: \[ I^{\Lambda}_{\text{acc}} = \max_{M} I(X;Y^M), \] (2) where the maximization is over all measurement strategies in $ \Lambda $. In particular, if there are more than one receivers who are allowed to act locally (with quantum mechanically allowed operations) and communicate over a classical channel, then the corresponding accessible information is called “locally accessible information” and denoted as $ I^{\Lambda}_{\text{acc,LOCC}} $, where LOCC is an abbreviation for local operations and classical communication. III. MOTIVATION AND DEFINITION OF THE MEASURE Multiparty states are not necessarily locally distinguishable, even if they are mutually orthogonal (see, e.g., Ref. [19]). However, a geometrical concept (such as nonorthogonality, for global operations), that separates locally distinguishable ensembles from locally indistinguishable ones is absent. One of our goals is to provide such a notion of “local nonorthogonality.” The idea is that locally distinguishable ensembles are to be considered as “classical” (“nonquantum”). A locally indistinguishable ensemble will of course not “match” with any locally distinguishable one. The amount of quantumness of the locally indistinguishable ensemble will then be the amount of this disharmony, quantified by the minimal entropy production when the ensemble is dephased (globally) in a measurement, whose elements are locally distinguishable. Note here that there are general methods and results to determine local distinguishability of ensembles in certain cases [20,21]. These results can be used to determine the value of the measure, which can then be used, as we show later, to provide bounds on locally accessible information. Consider therefore an ensemble of bipartite states \[ E = \{ p_x, Q_x^{\otimes AB} \}_{x=1}^{N}, \] that are not necessarily orthogonal. (If the probabilities $ p_x $ are not explicitly mentioned, they are assumed to be equal.) Let $ A $ be the Hilbert space spanned by the support of the states $ Q_x^{\otimes AB} $. Let $ \{ \eta_i \}_{i=1}^{n} $ be a measurement of $ H_A \otimes H_B $, such that the vector of ranks of $ \eta_i $ is majorized by the corresponding vector of the ensemble states [22]. Consider the part of $ \{ \eta_i^{\otimes AB} \}_{i=1}^{n} $ which has a nonzero overlap with $ A $ [23]. The normalized operators \[ \tilde{\eta}_i = \eta_i / \text{tr} (\eta_i) \] are states, and can be distinguishable or indistinguishable under local operations and classical communication [24]. Let $ D_A $ be the set of all such measurements $ \{ \eta_i^{\otimes AB} \}_{i=1}^{n} $ whose overlap with $ A $, if normalized, is LOCC distinguishable. The measure of quantum correlation $ Q $ for the ensemble $ E $ is defined as the minimal entropy produced when dephased (measured) by a measurement from $ D_A $. Precisely, \[ Q(E) = \inf_{D_A} \sum_{x=1}^{N} p_x H(\{p_{[x]} \}_{i=1}^{n}). \] Here $ p_{[x]} $ is the probability that $ \eta_i $ clicks if the signal state was $ Q_x $, i.e., \[ p_{[x]} = \text{tr} (\eta_i Q_x). \] The infimum is taken over all bases in $ D_A $. Since the compactness of $ D_A $ is not known, we keep the infimum instead of a minimum. Actually, the above notion of $ Q $ as a measure of quantumness can be used in much more general situations than just in the case of a system consisting of two spatially localized subsystems. Suppose that a source produces an ensemble $ \Gamma = \{ p_x, Q_x \}_{x=1}^{N} $, with the $ Q_x $'s defined on some Hilbert space $ H $. And as before, let $ A $ denote the span of the supports of $ Q_x $, and let $ \{ \eta_i \}_{i=1}^{n} $ be an arbitrary measurement in $ H $, whose rank-vector is majorized by that of the ensemble states. Let $ D_A^{\Gamma} $ be the set of all measurements $ \{ \eta_i \}_{i=1}^{n} $, for which the nonzero overlap with $ A $ is distinguishable under a set chosen set of operations $ \Lambda $. Then the measure of quantumness of the ensemble $ \Gamma $, with respect to the set of allowed operations $ \Lambda $, is defined as \[ Q(\Gamma) = \inf_{D_A^{\Gamma}} \sum_{x=1}^{N} p_x H(\{p_{[x]} \}_{i=1}^{n}). \] When the states $ Q_x $ are bipartite states on $ H = H_A \otimes H_B $, with the allowed operations being LOCC, we recover the definition given before for bipartite ensembles. For a multiparty ensemble $ \{ p_x, Q_x^{\otimes ABC} \} $, defined on $ H_A \otimes H_B \otimes H_C \otimes \cdots $, one chooses the measurements $ \{ \eta_i^{\otimes ABC} \} $ on this Hilbert space. Considering the set of allowed operations as LOCC between $ A, B, C, \ldots $, and $ D_A $ as the set of measurements whose nonzero overlap with $ A $ is distinguishable by such LOCC operations, where $ A $ is the span of the supports of $ Q_x^{\otimes ABC} $, we have a measure of quantum correlation of an ensemble of multiparty states. Importantly, $ Q $ can be defined also for an ensemble $ \Gamma $ of a single system, when the allowed operations in its definition are all quantum operations. The dephasing is then in any orthonormal measurement (in $ \mathcal{H} $), whose rank-vector is majorized by that of the ensemble states. Again the idea is to consider an ensemble consisting of the elements of such a measurement as “nonquantum.” Any other ensemble will be “incommensurable” with all such nonquantum ensembles, during a measurement. And the entropy produced can again be interpreted as a measure of quantumness of $ \Gamma $. The measure of quantumness for single systems proposed in [25] is based on “fidelity,” while the one here, when considered for a single system, is based on entropy production. Note that Ref. [25] proposed that the “most quantum” two elements ensemble should be \[ \Gamma(\theta) = \{\cos(\theta/2)\|0\rangle \pm \sin(\theta/2)\|1\rangle\}, \] for $ \theta = \pi/2 $, and when given with equal probabilities. This criterion is satisfied by our measure, just as for the measure in Ref. [25]. In general, \[ Q(\Gamma(\theta)) = H(\cos^2(\theta/2)), \] (3) where we have assumed that the elements of $ \Gamma(\theta) $ are given with equal probabilities. Here in the case of a single system, we assume that all quantum mechanical operations are allowed. Moreover, the ensemble states are pure, and span a two-dimensional complex Hilbert space ($ \mathbb{C}^2 $). Therefore, in this case, the set $ D_A^+ $ consists of all rank-one projective measurements in $ \mathbb{C}^2 $. Equation (3) then follows by direct calculation. It may later on be reasonable to consider a regularized version of $ Q $. Given an ensemble $ \{\rho_x, \varrho_x\} $ and a set of allowed operations $ \Lambda $, consider $ Q' $ for an extension \[ \{\rho_{x,\psi}, \varrho_x \otimes \|0\rangle\langle 0\|\} \] of the given ensemble, where $ \|0\rangle $ is any state that can be produced by $ \Lambda $ (hence it is for free). The regularization is then the infimum of $ Q' $'s for all possible such extensions. This brings in the possibility of vanishing regularized $ Q $ even for some ensembles that are indistinguishable under $ \Lambda $. Unless mentioned otherwise, we will be considering the non-regularized version here. By definition, $ Q $ is vanishing for ensembles which are distinguishable under the allowed set of operations $ \Lambda $. For indistinguishable ensembles, due to possible noncompactness of the set over which the infimums are taken, $ Q $ can possibly be also vanishing. IV. RELATION WITH RELATIVE ENTROPY DISTANCE We now show that for pure ensembles, $ Q(\Gamma) $ is average relative entropy distance from some ensembles of states, where \[ S(\varrho\|\sigma) = \text{tr}(\varrho \log_2 \varrho - \varrho \log_2 \sigma) \] is the relative entropy distance of $ \varrho $ from $ \sigma $. Let $ \{\|a_i\rangle\}_i $ be any set of states which are distinguishable under the set of allowable operations $ \Lambda $, and $ \{a_i^\}_i $'s be arbitrary sets of probabilities mixing the $ \|a_i\rangle $'s. Also, let \[ \sigma'_x = \sum_i p_{1,i}\|a_i\rangle\langle a_i\| \] and \[ \sigma_x = \sum_i a_i^\|a_i\rangle\langle a_i\|. \] Then, from the definition of $ Q $, it follows that \[ Q(\Gamma) = \inf_{\{\sigma'_x\}} \sum_x p_x[-\text{tr}(\varrho_x \log_2 \sigma'_x)] = \inf_{\{\sigma'_x\}} \sum_x p_x S(\varrho_x\|\|\sigma'_x), \] so that \[ Q(\Gamma) = \inf_{\{\sigma_x\}} \sum_x p_x S(\varrho_x\|\|\sigma_x). \] (4) So for pure ensembles, $ Q $ is the average relative entropy distance of the signal states from the “classical” ensembles, namely, the ones whose members are mixtures of the same set of distinguishable pure states (distinguishable under $ \Lambda $). Note that for a single “classical” ensemble, the constituent signals are mutually commuting. Although $ Q $ turns out to be a relative entropy distance, it has (in contrast to relative entropy of entanglement) an operational meaning in terms of entropy production. Thus $ Q $ is more related to quantum correlation of states in Ref. [26], than to relative entropy of entanglement. Note that the averaging in Eq. (4) is done before the infimum, and so the measure $ Q $ can still “feel” the ensemble as a whole. Otherwise, the measure will turn out to be an average of an individual property of the ensemble states, as noted in the Introduction. Consider now the case of an ensemble of bipartite pure states with the allowed operations being LOCC between the sharing partners. Suppose also that the ensemble spans the whole bipartite Hilbert space. A set of orthogonal pure states in the span (i.e., a complete orthogonal basis) is distinguishable under LOCC only if they are all product states [21]. (Note that the opposite is not necessarily true [19].) So the relevant $ \sigma_x $'s that appear in formula (4) must have product eigen basis, and so are separable states. (Again the opposite is not true.) So \[ Q(\mathcal{E}) \equiv E_R = \sum_x p_x E_R(\varrho_x^{AB}) = \sum_x p_x S(\text{tr}_A \varrho_x^{AB}), \] (5) for any pure ensemble $ \mathcal{E} $ spanning the whole bipartite Hilbert space. \[ E_R(\varrho^{AB}) = \min_\sigma S(\varrho\|\sigma) \] is the relative entropy of entanglement, the minimization being over all separable states $ \sigma $ [2]. We have used that for pure bipartite states \[ E_R(\varrho_x^{AB}) = S(\text{tr}_A \varrho_x^{AB}), \] the unique asymptotic pure state entanglement measure [1,2]. Among other things, the inequality (5) will be important for evaluation of $ Q $ for certain bipartite ensembles. V. EVALUATING THE MEASURE We will now calculate the value of our measure for the ensemble $ \mathcal{B} $ consisting of the four Bell states \[ \|\phi^{\pm}\rangle = \frac{1}{\sqrt{2}}(\|00\rangle \pm \|11\rangle), \] \[ \|\psi^{\pm}\rangle = \frac{1}{\sqrt{2}}(\|01\rangle \pm \|10\rangle), \] given with equal prior probabilities. The four Bell states span the whole $ 2 \otimes 2 $ Hilbert space. To find $ Q $, we have to minimize entropy production after dephasing over all LOCC-distinguishable bases in $ 2 \otimes 2 $. Let us dephase in the computational basis \[ \{\|00\rangle, \|11\rangle, \|01\rangle, \|10\rangle\}. \] For any signal, the entropy produced is $ H(\frac{1}{2}) $. So \[ Q \leq 4 \times \frac{1}{4}H\left(\frac{1}{2}\right) = 1. \] However from Eq. (5) we know that this bound is saturated, as the Bell states have $ E_R = 1 $. Therefore, we have that \[ Q = 1, \] for the ensemble of the four Bell states given with equal prior probabilities. Consider now the more general ensemble $ \mathcal{B}' $ consisting of \[ a\|00\rangle + b\|11\rangle, \quad \bar{b}\|00\rangle - \bar{a}\|11\rangle, \] \[ c\|01\rangle + d\|10\rangle, \quad \bar{d}\|01\rangle - \bar{c}\|10\rangle, \] given with equal prior probabilities. Here $ a $ and $ b $ ($ c $ and $ d $) are complex numbers, with $ \|a\|^2 + \|b\|^2 = 1 $ ($ \|c\|^2 + \|d\|^2 = 1 $). Again a dephasing in the computational basis implies that \[ Q \leq \frac{1}{2}[H(\|a\|^2) + H(\|c\|^2)]. \] And again saturation follows from Eq. (5), so that \[ Q = \frac{1}{2}[H(\|a\|^2) + H(\|c\|^2)]. \] Similarly, for the canonical set of maximally entangled states in $ d \otimes d $, given with equal prior probabilities, viz., \[ \|\varphi_{nm}^{\text{max}}\rangle = \frac{1}{\sqrt{d}} \sum_{j=0}^{d-1} e^{2\pi i j n/d} \|j\rangle \langle (j+m) \mod d\|, \] where $ n,m = 0,\ldots,d-1 $, one obtains \[ Q = \log_2 d, \] by dephasing of this basis in the computational basis and using Eq. (5). VI. MONOTONICITY AXIOMS It should be noted that $ Q $, for the case of multipartite ensembles (with the allowed operations being the LOCC class) can actually increase under LOCC. This is because one can create nonorthogonal product states after starting with a multiorthogonal product basis [27]. Note, however, that $ Q $ can increase even if the output states are orthogonal, as there exist ensembles of orthogonal product states which are locally indistinguishable [19]. Such ensembles, which by definition have nonzero $ Q $, can be created by LOCC from a multi-orthogonal product basis [27], which being LOCC distinguishable has by definition vanishing $ Q $. However, from our experience with entanglementlike quantum correlation measures [1–4], we know that a quantum correlation measure should show some kind of monotonicity. It may now seem that $ Q $ (for the case of multipartite ensembles), being defined in terms of entropy production, will be monotonically decreasing under LOCC operations, if we do not allow discarding subsystems as a valid operation, because discarding subsystems can both increase or decrease entropy. Note that the operations that are useful in a distinguishing protocol of a multiparty ensemble are (a) adding local ancillas, (b) local unitaries, (c) local dephasing (von Neumann measurement), (d) communication of predephased quantum states (classical communication). Adding the item (e) discarding subsystems, will give us the whole set of LOCC. $ Q $ is obviously monotonically decreasing for operations (a), (b), and (d). However, it turns out that $ Q $ increases under (c): The ensemble \[ \mathcal{E}_1 = \{\|s_i^{AB}\rangle\|i\rangle^{A'}B'\}_{i,j=1}^3, \] where $ \{\|s_i^{AB}\rangle\}_{i,j=1}^3 $ is a set of nine orthogonal product states in $ (C^3 \otimes C^3) $ which are locally indistinguishable [19], and $ \{\|i\rangle^{A'}\}_{i=1}^3, \{\|j\rangle^{B'}\}_{j=1}^3 $ are local orthogonal states, can be transformed into $ \{\|s_i^{AB}\rangle\}_{i,j=1}^3 $ along with just white noise at $ A'B' $, by performing a measurement in a basis complementary to $ \{\|i\rangle^{A'}\rangle^{B'}\}_{i,j=1}^3 $, and forgetting the outcome. Since \[ Q(\mathcal{E}_1) = 0 \] and \[ Q(\{\|s_j\rangle\}) > 0, \] we have an example where $ Q $ increases under (c). Even if the outcomes in (c) are remembered, they are random and completely uncorrelated with anything else in this example, and so remembering them does not help. However, the preceding discussion seems to indicate that monotonicity under addition of ancillas, unitary operations, and dephasing with outputs being orthogonal states, are natural axioms for any measure of quantumness of a single system. VII. CONJECTURE: COMPLEMENTARITY WITH ACCESSIBLE INFORMATION A. Formulation Quantification of quantum correlation of an ensemble has several important potential applications. For example, it suggests a complementarity relation with locally accessible information (Sec. II). For an ensemble $ \{p_s, \sigma_s^{AB}\} $, of bipartite states, a complementarity has been obtained [16] between the locally accessible information and average shared asymptotic entanglement $E$ [4] of the ensemble states ($k = \dim(\mathcal{H}_A \otimes \mathcal{H}_B)$): $$I_{\text{acc}}^{\text{LOCC}} + \bar{E} \leq \log_2 k.$$ \hspace{1cm} (6) However, the complexity of locally accessible information depends on the geometry of the ensemble, which cannot be captured by taking an average of an individual property (for example, entanglement) of the ensemble states. Consequently, the complementarity obtained in Ref. [16] can potentially be made stronger if the locally accessible information is taken along with a measure of quantum correlation of an ensemble of states. Consider the quantity $$I_{\text{acc}}^\Lambda + Q,$$ where $I_{\text{acc}}^\Lambda$ is the accessible information under the set of operations $\Lambda$ (Sec. II), and $Q$ is considered using the same set of operations. Below we prove that the complementarity relation between accessible information and quantumness, for an ensemble $\{p_x, Q_x\}_{x=1}^N$ $$I_{\text{acc}}^\Lambda + Q \leq \log_2 N$$ \hspace{1cm} (7) holds for several exemplary families. We feel that the complementarity (7) is true in general. Among other things, note that in the Eq. (6), the right-hand side (RHS) is the logarithm of the dimension of the Hilbert space on which the signals are defined, whereas in Eq. (7), the RHS is the logarithm of the number of states in the ensemble, which can be less than, equal to, or greater than the dimension of the said Hilbert space. For an ensemble of bipartite states, $\{p_x, Q_x^{(B)}\}_{x=1}^N$, the proposed complementarity is $$I_{\text{acc}}^{\text{LOCC}} + Q \leq \log_2 N.$$ \hspace{1cm} (8) Note that due to Eq. (5), the relation (8) will in general be stronger than the one in Eq. (6) if the ensemble consists of $k$ pure states that span $\mathcal{H}_A \otimes \mathcal{H}_B$. It seems to be true that $Q \geq E_R + \log_2 N - \log_2 k$. B. Exemplary cases I. Some exemplary ensembles consisting of four states of two qubits For the case of the four Bell states, given with equal prior probabilities $I_{\text{acc}}^{\text{LOCC}} = 1$. This follows from Eq. (6) and the fact that measuring in the computational basis gives $I_{\text{acc}}^{\text{LOCC}} = 1$. And for this case, we have proven that $Q = 1$. Therefore we have proven inequality (8) for the case of four Bell states given with equal probabilities. Inequality (8) is true also for the more general ensemble $B'$. From Eq. (6), we have $$I_{\text{acc}}^{\text{LOCC}} \leq 2 - \frac{1}{2}[H(\|a\|^2) + H(\|c\|^2)].$$ But a measurement in the computational basis shows that this bound can be achieved, so that in this case, $$I_{\text{acc}}^{\text{LOCC}} = 2 - \frac{1}{2}[H(\|a\|^2) + H(\|c\|^2)].$$ Using the value of $Q$ obtained for $B'$, we have the inequality (8) proven for this ensemble. Similarly Eq. (8) holds for the canonical set of maximally entangled states in $d \otimes d$. 2. An ensemble of three Bell states For the case of the ensemble of the three Bell states $\|\phi^\pm\rangle$, $\|\psi^\pm\rangle$, given with equal prior probabilities, a measurement in the computational basis gives $I_{\text{acc}}^{\text{LOCC}} \geq \log_2 3 - \frac{2}{3}$. And the fact that the set $\{\|00\rangle, \|11\rangle, \|\psi^+\rangle\}$ is a LOCC-distinguishable ensemble belonging to the span of $\|\phi^\pm\rangle$, $\|\psi^\pm\rangle$, gives $Q = \frac{2}{3}$. These two inequalities do not have a contradiction with the proposed Eq. (8). VIII. STATUS OF THE CONJECTURED COMPLEMENTARITY FOR SINGLE SYSTEMS One may consider Eq. (7) for the case of an ensemble of a single system, with all quantum mechanically allowed operations in $\Lambda$. Then Eq. (7) can be seen as a “Heisenberg uncertainty relation.” The accessible information is the maximal “information gain” that is possible about the system. On the other hand, $Q$ denotes the quantumness of the ensemble, quantifying the resistance to such information gain. For an ensemble $\{p_x, Q_x\}_{x=1}^N$ on $\mathcal{H}$, the accessible information $$I_{\text{acc}} = \max_M \left(H(\langle p_x\|)_y) - \sum_y r_y H(\langle p_x\|)_y)\right),$$ where a measurement $M = \{y\}$ has been performed, the measurement result $y$ having occurred with probability $r_y$, $p_{x\|y}$ is the probability that the signal was $Q_x$, given that the outcome was $y$. Now $$H(X) - H(X\|Y) = H(Y) - H(Y\|X),$$ for random variables $X$ and $Y$. So $$H(\langle p_x\|)_{x=1}^N) - \sum_y r_y H(\langle p_x\|)_y) = H(\langle p_x\|)_y) - \sum_{x=1}^N p_x H(\langle p_x\|)_y).$$ If we now restrict ourselves to only projection valued measurements on $\mathcal{H}$, we have $$I_{\text{acc}} \leq \max_M H(\langle p_x\|)_y) - Q \leq \log_2 \dim \mathcal{H} - Q \leq \log_2 N - Q.$$ Hence for a single system, we have Eq. (7) in a restricted case. Let us mention here that it is conceivable that in general, the complementarity in Eq. (7) is true only when we consider the regularized version of $Q$. IX. CONCLUSION We have proposed a measure of quantum correlation of ensembles. We evaluated the measure for several cases. We used it to propose a complementarity with accessible information. The measure and the complementarity are well-defined even for single systems, where the latter is proven when projection-valued measurements are used to maximize the accessible information. The measure naturally led to the first monotonicity axioms for quantumness of ensembles for single systems. ACKNOWLEDGMENTS We acknowledge support from the EU Grant No. RESQ, DFG (Grants No. SFB 407, No. SPP 1078, No. SPP 1116, and No. 436POL), the Alexander von Humboldt Foundation, Spanish MEC (Grant No. FIS-2005-04627, Consolider Project QOIT, and Ramón y Cajal), the ESF Program QUEDDIS, and EU IP SCALÀ. [1] C. H. Bennett, D. P. DiVincenzo, J. A. Smolin, and W. K. Wootters, Phys. Rev. A 54, 3824 (1997); C. H. Bennett, G. Brassard, S. Popescu, B. Schumacher, J. A. Smolin, and W. K. Wootters, Phys. Rev. Lett. 76, 722 (1996). [2] V. Vedral, M. B. Plenio, M. A. Rippin, and P. L. Knight, Phys. Rev. Lett. 78, 2275 (1997); V. Vedral and M. B. Plenio, Phys. Rev. A 57, 1619 (1998). [3] G. Vidal, J. Mod. Opt. 47, 355 (2000). [4] M. Horodecki, P. Horodecki, and R. Horodecki, Phys. Rev. Lett. 84, 2014 (2000); M. Horodecki, Quantum Inf. Comput. 1, 3 (2001). [5] M. Horodecki, A. Sen(De), and U. Sen, Phys. Rev. A 70, 052326 (2004). [6] C. H. Bennett and S. J. Wiesner, Phys. Rev. Lett. 69, 2881 (1992). [7] C. H. Bennett, G. Brassard, C. Crépeau, R. Jozsa, A. Peres, and W. K. Wootters, Phys. Rev. Lett. 70, 1895 (1993). [8] C. H. Bennett and G. Brassard, Proceedings of IEEE International Conference on Computers, Systems and Signal Processing, Bangalore, India (IEEE, Washington, D.C., 1984), pp. 175–179. [9] A. K. Ekert, Phys. Rev. Lett. 67, 661 (1991). [10] C. H. Bennett, G. Brassard, and N. D. Mermin, Phys. Rev. Lett. 68, 557 (1992). [11] M. Zukowski, A. Zeilinger, M. Horne, and H. Weinfurter, Acta Phys. Pol. A 93, 187 (1998). [12] M. Hillery, V. Bužek, and A. Berthiaume, Phys. Rev. A 59, 1829 (1999). [13] V. Scarani and N. Gisin, Phys. Rev. Lett. 87, 117901 (2001); Phys. Rev. A 65, 012311 (2001). [14] A. Sen(De), U. Sen, and M. Żukowski, Phys. Rev. A 68, 032309 (2003). [15] J. Oppenheim, K. Horodecki, M. Horodecki, P. Horodecki, and R. Horodecki, Phys. Rev. A 68, 022307 (2003). [16] P. Badziąg, M. Horodecki, A. Sen(De), and U. Sen, Phys. Rev. Lett. 91, 117901 (2003). [17] C. A. Fuchs and A. Peres, e-print arXiv:quant-ph/9512023; B.-G. Englert, Phys. Rev. Lett. 77, 2154 (1996). [18] T. M. Cover and J. A. Thomas, Elements of Information Theory (Wiley, New York, 1991). [19] C. H. Bennett, D. P. DiVincenzo, C. A. Fuchs, T. Mor, E. M. Rains, P. W. Shor, J. A. Smolin, and W. K. Wootters, Phys. Rev. A 59, 1070 (1999); C. H. Bennett, D. P. DiVincenzo, T. Mor, P. W. Shor, J. A. Smolin, and B. M. Terhal, Phys. Rev. Lett. 82, 5385 (1999). [20] J. Walgate, A. J. Short, L. Hardy, and V. Vedral, Phys. Rev. Lett. 85, 4972 (2000); J. Walgate and L. Hardy, ibid. 89, 147901 (2002); S. Virmani, M. F. Sacchi, M. B. Plenio, and D. Markham, Phys. Lett. A 288, 62 (2001); Y.-X. Chen and D. Yang, Phys. Rev. A 64, 064303 (2001); 65, 022320 (2002). [21] M. Horodecki, A. Sen(De), U. Sen, and K. Horodecki, Phys. Rev. Lett. 90, 047902 (2003). [22] \{x_1, \ldots, x_d\} is “majorized” by \{y_1, \ldots, y_d\} (both arranged in decreasing order), if $ \sum_{i=1}^{l} x_i^k \leq \sum_{j=1}^{l} y_j^k $, where $ l = 1, \ldots, d - 1 $, and equality holds when $ l = d $. See, e.g., R. Bhatia, Matrix Analysis (Springer, New York, 1997). [23] $ \eta_l \in \{\eta_l^{AB}\}_{l=1}^n $ has “nonzero overlap” with $ A $, if $ \langle \varphi \| \eta_l \rangle \|\varphi\rangle \neq 0 $, for some $ \|\varphi\rangle \in A $. The set of such $ \eta_k $ of $ \{\eta_l^{AB}\}_{l=1}^n $ is called “overlap of $ \{\eta_l^{AB}\}_{l=1}^n $ with $ A $” . [24] To be precise, a set of $ N $ states $ \{\eta_l\} $ are LOCC distinguishable if the corresponding ensemble of those states, given with equal probabilities, has an accessible information under LOCC equal to $ \log_2 N $. If the accessible information under LOCC is strictly less than $ \log_2 N $, then the set of states are LOCC-indistinguishable. [25] C. A. Fuchs and M. Sasaki, e-print arXiv:quant-ph/0302092; e-print arXiv:quant-ph/0302108; K. M. R. Audenaert, C. A. Fuchs, C. King, and A. Winter, Quantum Inf. Comput. 4, 1 (2004). [26] J. Oppenheim, M. Horodecki, P. Horodecki, and R. Horodecki, Phys. Rev. Lett. 89, 180402 (2002); M. Horodecki, K. Horodecki, P. Horodecki, R. Horodecki, J. Oppenheim, A. Sen(De), and U. Sen, ibid. 90, 100402 (2003). [27] For orthogonal bases $ \{\|j\rangle^{\dim \mathcal{H}_A} \} $ of $ \mathcal{H}_A(k=A,B,\ldots) $, $ \{\|j\rangle \otimes \|j\rangle^{\dim \mathcal{H}_B} \cdots \} $ is the corresponding multiorthogonal basis. Such a basis is trivially distinguishable by LOCC between $ A,B,\ldots $, and so has $ Q=0 $.	<urn:uuid:00c75b54-fbc0-4255-bdb3-755cea64f5d7>	CC-MAIN-2020-45	https://icfo.eu/images/publications/J07_081.pdf	2020-10-20T00:54:53+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-45/subset=warc/part-00004-6409130e-6e9b-44d1-90ec-9f9d0ade2504.c000.gz.parquet	382,850,624	9,353	eng_Latn	eng_Latn	0.848286	eng_Latn	0.95596	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 5714, 11552, 17267, 22373, 27879, 32448 ]
Seminars ALTERNATIVE INVESTMENTS FOR LOCAL AUTHORITY TREASURERS RISK & RETURN IN NON-SPECIFIED INVESTMENTS January 22 nd 2014 Senator House London Chaired by Stephen Fitzgerald Local Authority Finance Consultant A complimentary half-day seminar and buffet lunch for local authority cash managers, treasurers and S151 officers. Optional PLUS Roundtable Workshop Property market update and Q&A with LAPF fund manager Sponsored by Seminars AGENDA 09.30 – 09.45 Arrival & Coffee 09.45 Opening remarks Stephen Fitzgerald Local Authority Finance Consultant 09.50 Panel Session The changing use of non-specified investments and risk appetites Which alternative investments are becoming more commonplace in TM strategies? • What are the challenges to introducing new types of investment? • How are treasurers measuring and monitoring the risks? • How far will treasurers diversify across asset classes in 2014? • David Green Client Director, Arlingclose Justin Meadows Chief Executive, MyTreasury 10.40 Presentation Auditing and accounting for non-specified investments What will you auditor want to know about your non-specified investments? * Pooled funds with embedded derivatives and other financial instruments • The auditor's view of risk • Key principles of accounting for investments • Greg Macintosh Director, DPP Public Sector Audit Support, Accounting and Reporting, KPMG 11.00-11.20 Coffee 11.20 Presentation Focus on property risk and return A year on from the Local Authorities' Property Fund opening up to treasurers, how has the property market developed? John Kelly Director, CCLA 11.40 Panel Session How robust is the recovery and what expectations do portfolio managers have for alternative asset classes in 2014? Covering property, corporate bonds, equities and other non-specified investments James Bevan CIO, CCLA Philip Hebson Independent Investment Adviser AllenbridgeEpic David Whelan Managing Director of Treasury Solutions Capita Asset Services 12.20 Buffet Lunch 13.10 Optional Roundtable Q&A Panel Session Overview of current issues in the property market and impact on the Local Authorities' Property Fund Moderated by: John Kelly Director, CCLA Q&A with: Paul Hannam Fund Manager, CCLA	<urn:uuid:f4b5a904-ac70-4c27-92d4-6e7aa33f07a1>	CC-MAIN-2019-09	http://www.room151.co.uk/wp-content/uploads/2014/01/Jan-22-Seminar-2014.pdf	2019-02-23T14:54:55Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550249504746.91/warc/CC-MAIN-20190223142639-20190223164639-00364.warc.gz	413,494,414	509	eng_Latn	eng_Latn	0.869144	eng_Latn	0.957077	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 437, 2267 ]
Rustenberg Five Soldiers 2007 Redolent of flint, peach, lime and a hint of nuts. An elegant wine, fermented and matured in barrel for 15 months. Enjoy now or within 7 - 10 years of vintage. variety : Chardonnay \| 100% Chardonnay winery : Rustenberg Wines winemaker : Randolph Christians wine of origin : Stellenbosch analysis : alc : 14.06 % vol rs : 3.61 g/l pH : 3.35 ta : 5.26 g/l type : White style : Dry wooded pack : Bottle closure : Cork ageing : Up to 10 years from vintage. in the vineyard : This very small vineyard, once again, produced exceptional fruit in 2007. Situation: North West slopes of the Helderberg Mountain Altitude: 300 - 450m Distance from sea: ± 7km Soil type: Decomposed granite (Tukulu/Hutton) Rootstock: Unknown Age of vines: Planted 1984 Trellising: Vertically shoot positioned Pruning: 2-bud spur pruning Irrigation: Drip Irrigation about the harvest: Harvested: end of February 2007 Grape analysis: Acidity: 7.17 g/l pH: 3.4 Sugar: 23.5° Balling Yield: 4 tons/ha (± 2700 litres / 10 000m²) in the cellar : Whole bunch pressed directly to barrel for natural fermentation and maturation of 15 months. 100 % MLF (Malolactic Fermentation) occurred naturally. Oak used: 500 L Burgundian barrels. 70% new oak for 15 months. Production: 745 x 6 x 750ml Bottled: October 2008	<urn:uuid:0a397280-ad7b-4c94-9fd0-fa2fec6374d6>	CC-MAIN-2020-34	https://wine.co.za/wine/wine-pdf.aspx?WINEID=20652	2020-08-05T12:42:09+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-34/subset=warc/part-00092-157cb54e-5228-45b3-9530-e1132e1b63b2.c000.gz.parquet	568,883,116	416	eng_Latn	eng_Latn	0.88785	eng_Latn	0.88785	[ "eng_Latn" ]	false	rolmOCR	[ 1349 ]
Measuring Tumor Response: Lessons Learned from Clinical Trials Chaya Moskowitz, Ph.D. Department of Epidemiology and Biostatistics Memorial Sloan Kettering Cancer Center New York: Springtime Snow New York Times, March 21, 2016 Background * Information on the change in tumor burden over time is used in many early-phase and some late-phase clinical trials in oncology * Primary endpoint in Phase II studies * Phase III studies with progression-free survival or time to progression as a primary endpoint Measuring Tumor Burden * Patients imaged pre-treatment and then serial posttreatment imaging * Radiologists evaluate tumor burden at each time point * Read criteria provide guidelines to standardize process – Suggest imaging modalities, how to measure lesions, how many lesions to measure, how to choose which lesions to measure – Vary depending on indication – RECIST 1.1 (Response Evaluation Criteria in Solid Tumors) * Endpoints Based on RECIST * Target lesion: Measure up to 5 lesions, 2 per involved organ * Measure longest diameter of each target lesion – Use to define relative change in tumor burden: Baseline Baseline up Follow TB TB TB RC 100 Minimum Minimum up Follow TB TB TB RC 100 ``` – = longest diameter of l th target lesion at time T , (T = Baseline, visit 1, etc.) – ; tumor burden at time T l T l T X TB T l X ``` Response rate: Response criteria used in endpoint definitions (target response): – Complete Response (CR): Disappearance of all target lesions Subjects # PR CR RR – Partial Response (PR): RC ≤ -30% Time to PD or PFS – Progressive Disease (PD): RC ≥ 20% or new lesion appears – Stable Disease (SD): -30% ≤ RC ≤ 20% A Limitation of Response Criteria * Do not do a good job of suggesting which therapies will be successful in Phase III trials – Varies by indication * Variability in tumor measurements Variability in Tumor Measurements * Possible contributing factors include: – Patient-related sources of variability: e.g. indication, treatment, other biophysiological sources – Imaging-related sources of variability: e.g. modality, acquisition techniques, reconstruction parameters) – Reader-related sources of variability: e.g. reader expertise, choice of different target lesions, errors in tumor measurements * Studies in single tumor measurements, RC, response criteria * Most studies have small sample sizes, focus on a single disease site, and are designed experiments using retrospective research reads * RECIST acknowledges variability and mentions independent central review may be warranted Independent Central Review * All images collected for the clinical trial are transferred to a central location and reviewed by experts not involved in the study – Eligibility and trial endpoints * Independent central review encouraged by regulatory authorities * Different review paradigms, e.g: – Blinded – Two readers and adjudicator; most frequently used for industry-sponsored trials * Differences between investigators and independent central review * Lack of studies looking at differences between radiologists participating in an independent central review Aim * Evaluate factors associated with variability in independent central review response assessment Independent Central Review Database * Commercial Imaging Core Laboratory database capturing data from blinded independent central reviews of industry-sponsored Phase II and Phase III trials * All trials in the database for which the Imaging Core Laboratory used two reader and adjudicator paradigm * 79 clinical trials * 23,476 patients * Data available aggregated within de-identified clinical trial (no patient-level data) Trial Characteristics Available * Indication * Read criteria – Guidelines used for tumor evaluation * Adjudication variables – Variables related to study endpoints used to determine whether adjudication is required during the independent central review – Include best response, date of progression, time to progression * Average number of target lesions – Total number of target lesions selected at baseline visit divided by total number of patients * Average number of time points – Total number of time points at which patients were scanned and for which scans were received by the Imaging Core Laboratory divided by the total number of patients * Average number of exams per time point – Total number of imaging exams received divided by the total number of time points Methods * Excluded information on patients who have no imaging exams after baseline scan * Estimated and present proportion of cases where the two independent readers disagreed * Used generalized linear models with weighted least squares and F to test for associations Indication 963 526 286 154 748 509 44 169 0 .2 .4 .6 .8 0 .2 .4 .6 .8 Proportion Discordant by Indication Advanced Cancer 44% 38% 38% 40% 35% 55% 38% 29% 21% 23% 40% .8 % of patients for whom adjudication is required with 95% confidence intervals Read Criteria % of patients for whom adjudication is required with 95% confidence intervals Number of Adjudication Variables % of patients for whom adjudication is required with 95% confidence intervals Average Number of Target Lesions # Trials % of patients for whom adjudication is required with 95% confidence intervals Average Number of Time Points % of patients for whom adjudication is required with 95% confidence intervals Average Number of Exams % of patients for whom adjudication is required with 95% confidence intervals Multivariate Model Date of Progression Only: Read Criteria Date of Progression Only: Average Number of Target Lesions # Trials # Patients Proportion Discordant 45% 28% 39% 33% 38% 1 4 7 13 4 116 1,072 2,654 5,134 154 Date of Progression Only: Average Number of Time Points # Trials # Patients Proportion Discordant 26% 34% 38% 39% 46% 8 5 7 3 3 3,158 1,052 2,859 834 1,227 Date of Progression Only: Average Number of Exams Conclusions * There are several factors that may modify agreement between radiologists' assessment of clinical trial endpoints – Adjudication variable (endpoint), indication, number of lesions, number of time points * These sources of variability may exist even in the absence of true errors in measurement * Should aim to optimize study design and primary endpoint definitions so that variability in endpoint determination is reduced Collaborators BioClinica, Inc. Robert Ford Michael O'Neal John Fraunberger Disclosure: Funding provided by BioClinica, Inc. Spring in New York?	<urn:uuid:a3935c51-a4c1-4879-9385-8a90be53942e>	CC-MAIN-2020-45	http://www.canceropole-gso.org/download/fichiers/3641/12_MOSKOWITZ&disposition=attachment	2020-10-21T06:59:14+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-45/subset=warc/part-00150-6409130e-6e9b-44d1-90ec-9f9d0ade2504.c000.gz.parquet	129,377,219	1,459	eng_Latn	eng_Latn	0.802759	eng_Latn	0.963218	[ "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "unknown", "lvs_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "unknown" ]	false	rolmOCR	[ 172, 231, 509, 931, 1680, 1867, 2571, 3137, 3240, 3668, 4445, 4716, 4805, 4997, 5091, 5204, 5327, 5437, 5541, 5561, 5602, 5780, 5957, 6008, 6445, 6573, 6594 ]
MARJAN KRAJNA- ŽIVOTOPIS Marjan Krajna, rođen 1966. u Zagrebu, diplomirao 1990. na Državnoj ruskoj muzičkoj Akademiji Gnjesinih u Moskvi - odjel za harmoniku, u klasi prof. Viacheslava. Semjonova te dirigiranje u klasi prof. Vladimira Kozuharja . Bio je stipendist fonda Ive Pogorelića Koncertne direkcije Zagreb. Dobitnik je brojnih državnih i međunarodnih nagrada. Nastupao je u brojnim europskim zemljama, Latinskoj Americi, Australiji..... Surađuje sa Simfonijskim orkestrom HRT-a, Zagrebačkom Filharmonijom, Zabavnim orkestrom HRT-a, Tamburaškim orkestrom HRT-a..... Član je gipsy swing sastava Hot Club Zagreb s Matom Matišićem, Juricom Štelmom..... Član je instrumentalnog sastava „Zapadni kolodvor" koji prati Rade Šerbeđiju. Piše aranžmane za komorne sastave i orkestre. Član je brojnih žirija za soliste, komorne sastave i orkestre. Dobitnik je Priznanja Ministra prosvjete i športa za izvrsne rezultate u radu s učenicima na državnim natjecanjima. Dobitnik je specijalne nagrade na "Australian international accordion Championship & Festival" Sydney 2006. Agencija za odgoj i obrazovanje Republike Hrvatske imenovala ga je voditeljem stručnog vijeća za harmoniku. Od 1997. ravnatelj je G.Š. Zlatka Balokovića u Zagrebu. Marjan Krajna, prof. MARJAN KRAJNA-BIOGRAPHY Marjan Krajna, was born in 1966th in Zagreb, graduated from the 1990th the Russian State Academy of Music "Gnjesinih" in Moscow - Department of accordion, with prof. Viacheslav. Semjonov and conducting with prof. Vladimir Kozuharj. He was a visiting scholar fund Ivo Pogorelić Zagreb Concert Management. He has won numerous national and international awards. He has performed in many European countries, Latin America, Australia ..... Cooperating with the Symphony Orchestra, the Zagreb Philharmonic, the orchestra entertainment HRT Tamburica Orchestra HRT ..... Member of the gypsy swing band Hot Club Zagreb with Mate Matisic, Jurica Štelma ..... He is a member of instrumental band "West Rail Station" which follows Rade Šerbeđija. Writes the arrangements for chamber ensembles and orchestras. He is a member of numerous juries for soloists, chamber ensembles and orchestras. He has received awards of the Minister of Education and Sports for great results in working with students in national competitions. He was awarded a special prize at the "Australian International Accordion Championship & Festival" Sydney 2006th Agency for Education of the Republic of Croatian appointed him the Head of the Professional Council for the accordion. From 1997. Director of the Music school. Zlatko Balokovic in Zagreb. Marjan Krajna, prof.	<urn:uuid:459d61f2-eaf5-43ee-915e-a6c2e4b74035>	CC-MAIN-2017-13	http://serbedzija.info/pdf/krajna.pdf	2017-03-27T10:36:44Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-13/segments/1490218189471.55/warc/CC-MAIN-20170322212949-00225-ip-10-233-31-227.ec2.internal.warc.gz	310,779,968	775	eng_Latn	eng_Latn	0.49436	hrv_Latn	0.743865	[ "hrv_Latn", "eng_Latn" ]	false	rolmOCR	[ 1268, 2640 ]
2020 Endorsement Questionnaire South County Email address * [email protected] APA Democratic Caucus of Alameda County PLEASE COMPLETE AND SUBMIT BY SEPT. 9, midnight. Please take time to review the questions before filling in the boxes since you cannot save the responses for later completion. Thank you for your interest in being considered for an endorsement by the Asian Pacific American Democratic Caucus of Alameda County. Please answer each question in 250 words or less. Be honest and direct. Please note: your questionnaire will be posted on our website for Caucus members and the public to review. Personal Information Candidate Name * Michael Gonzales Union City 94587 mikeg4newhaven.com [email protected] City and zip code of residence. What is your campaign website address? What is your campaign email address? What is the office that you are seeking? * City of San Leandro City Council City of San Leandro School Board City of Hayward City Council City of Hayward, Unified School District Trustee City of Fremont, Mayor City of Fremont, City Council, Dist. 1 City of Fremont, City Council, Dist. 5 City of Fremont, City Council, Dist. 6 City of Fremont, Unified School District, Dist. 1 City of Fremont, Unified School District, Dist. 4 City of Fremont, Unified School District, Dist. 5 City of Union City, Mayor City of Union City, City Council New Haven School Trustee, Area 1 New Haven School Trustee, Area 2 New Haven School Trustee, Area 3 City of Newark, Mayor City of Newark, City Council City of Newark, School Board City of Newark, School Board, Short term Eden Healthcare District Washington Hospital Healthcare District Oro Loma Sanitary District Oro Loma Sanitary District Alameda County Water District AD 20, State Assembly Representative AD 25, State Assembly Representative Ohlone Community College, Area 2 Other: Yes No Yes No I registered in 1995 as a Democrat. I switched to Green Party for a couple of years and last year I switched back. I consider myself to be a progress democrat Are you the incumbent? Are you a registered Democrat? The APA Democratic Caucus can only endorse registered Democrats How long have you been a registered Democrat? If less than 5 years, please explain your reason for becoming a Democrat. Yes No Are you an APA Caucus member? Yes No I grew up in Union City and some of my best friends are Asian-American. Within my own family my cousins and nieces and nephews are Asian-Americans. There is no Union City without Asian-Americans their contributions. It would be an honor to represent the APA Caucus endorsement. These are some of the prominent endorsers of me. New Haven Teachers Association, Vice President of the California Teachers Association David Goldberg, President of Oakland Education Association Keith Brown, Board of Supervisors of Alameda County District 2 Richard Valle, Assembly member Dr. Bill Quirk, and President of the United Teachers of Los Angeles Cecily Myart-Cruz. Yes No Maybe 25 years and then moved away for 18 years and now I am back. Why are you seeking the Caucus's endorsement? List ONLY the top 5 endorsements that you have received. (Please reference your website if you want to alert us to more). If we endorse you, will you use our name in your campaign materials? How long have you lived in the district which you are seeking to represent? Educational background: What schools have you attended, date graduated, major and degree(s) earned. I graduated at James Logan High School in Union City. I graduated from Chabot Community College with an AA in Liberal Studies 2002. I graduated from California State University of Los Angeles with a BA and a Teaching Credential 2006. Employment: List the last three (3) paid positions, indicating name of employer, job title, and length of employment. From 2005-2006 I worked at Eastman Ave. Elementary School as a paraprofessional. From 2006-2011 I worked at 49th St. Elementary School as a teacher. From 2013-2020 I worked at Parthenia Academy Arts & Technology School as a teacher. What are the names of any community or nonprofit organizations with which you have been an active volunteer in the past 3-5 years. I have served on leadership positions such as; president of our school site council, vice-chair of our school PTA, school site representative for United Teachers of Los Angeles, California Teachers Association State Council Delegate, vice-chair of the CTA Hispanic Caucus, president of the Pacoima Neighborhood Council, chair of the PNC Education Committee, committee member of the CTA R.E.A.C. Racial Equity Affairs Committee, and UTLA P.C.O.C. Parent Community Organizer Committee. CANDIDATE QUESTIONS 1. What differentiates you from your opponents for the elected office that you are seeking? I have an outstanding record with my community. If you were to google search me there is no negative record or news story like my opponent. My opponent is known for walking out on the community when it comes to public comment time. They tried to run a recall campaign against her. 2. Describe one issue for the district you want to represent for which you have provided leadership and about which you are passionate. We have a major budget crisis in my district. I have spent my entire career fighting for progressive funding for public education. California has a major problem with per pupil spending on students and we are on the bottom of the nation. I have worked on the Millionaire's Tax Coalition, Proposition 30, Make It Fair Campaign, and now Schools & Community First Proposition 15. As much as I want to get elected to the New Haven School Board Trustee Area 3 we have to get Proposition 15 to pass. Proposition 15 brings in $11.5 billion a year and makes major corporations pay their fair share. I will not let you down. 3. What percentage of the district you [or intend to] represent are of APA heritage? 42.7% APA heritage in my Area 3. 4. Please identify the three largest APA ethnicities in your district. % of Asian Pop. 1. Filipino 41.7 2. Chinese 23.52 3. Indian 17.59 5. Please identify the most at-risk APA community in your district and explain why. The most at-risk APA community is Vietnamese Americans. They have never had any elected official positions. They have an active gang and they have low representation in UC. 6. List the three top concerns of members of the APAs in your district. The concerns are keeping schools safe, making virtual learning effective and not a waste of time, & affordable housing. 7. During the COVID-19 pandemic, reports of anti-Asian verbal and physical attacks have arisen. If you are the incumbent, how have you addressed this? If you are a candidate how will you address this? I would pass a zero tolerance resolution to stop these attacks in my school district from students. I believe they are but not all Asian-Americans are represented. Asian-Americans should be united working together. Judy Chu. I lived in the part of Los Angeles that did not have Asian-American candidates running for office. Yes No 8. Do you believe that Asian and Pacific Americans are adequately represented in local government? What can elected officials do to improve participation? 9. Please identify all Asian Pacific American candidates whom you have personally endorsed over the past 5 years including this election cycle. If there are none, please explain. 10. If you were faced with a situation that involved an Asian Pacific American community, would you seek consultation with our Caucus as a resource? Thank you for completing our questionnaire. Please submit your responses by Sept. 9, 2020 midnight. Our South County Endorsement Meeting is scheduled for Sat., Sept. 20 from 1 to 3 pm on Zoom. Only those candidates submitting the questionnaire on time will be on our endorsement ballot. No changes to your responses can be made after it is submitted. This content is neither created nor endorsed by Google.	<urn:uuid:296465e9-5298-41fd-aaad-2bffb4344e1c>	CC-MAIN-2021-04	http://apacaucus.org/wp-content/uploads/2020/09/Gonzales-Michael-New-Haven-School-Trustee-Area-3.pdf	2021-01-23T23:37:23+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00111-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet	6,550,410	1,747	eng_Latn	eng_Latn	0.93392	eng_Latn	0.997192	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 670, 840, 1712, 2310, 3413, 5120, 6594, 8030 ]
The objective of the Emergency Tracking Tool (ETT) is to collect information on large and sudden population movements. Information is collected through key informant interviews or direct observation. This dashboard provides information on movements which occurred from 21 to 23 March 2020 in three sites in Lac Province. An armed attack which occurred on 23 March 2020 in the village of Mboma located in the sous-préfecture of Kaiga-Kindjiria (département of Fouli) led 2,032 persons (including 40 separated children hosted in the site of Yakirom) to be forcibly displaced and flee towards two sites located in the sous-préfecture of Liwa (in the same département of Fouli). Additionnally, in the same sous-préfecture of Kaiga-Kindjiria, 336 persons preventively fled their houses on 21 March 2020 towards one site located in the sous-préfecture of Liwa. All locations hosting these persons are accessible. Details of these movements are in the below table. METHODOLOGY : Data was collected through interviews in the field with key informants and direct observations SUMMARY OF EVENTS Number of incidents and Internally Displaced Persons (IDPs) Movement details: LEGEND: Département Sous-préfecture Boundaries Country Location of departure Host location Direction of movement 1 Displacement information This map is for illustration purposes only. The depiction and use of boundaries, geographic names and related data shown on maps and included in this report are not warranted to be error free nor do they imply judgment on the legal status of any territory, or any endorsement or acceptance of such boundaries by IOM. Non-Food items Health Non-Food items When quoting, paraphrasing, or in any other way using the https://dtm.iom.int/chad Contact: [email protected] information mentioned in this report, the source needs to be stated appropriately as follows: "Source: The International Organization for Migration [Month, Year], Displacement Tracking Matrix (DTM)" # 1 2 3	<urn:uuid:1ca1ba60-9709-44e3-a1e3-56f67f9d27a1>	CC-MAIN-2020-29	https://displacement.iom.int/system/tdf/reports/ETT_45_Chad_25_mars_2020_Final-eng.pdf?file=1&type=node&id=8065	2020-07-16T14:06:02+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-29/subset=warc/part-00222-18f202a6-71a6-4cdb-b350-51e72c917b97.c000.gz.parquet	368,986,932	450	eng_Latn	eng_Latn	0.9884	eng_Latn	0.9884	[ "eng_Latn" ]	false	rolmOCR	[ 1990 ]
World Scientist and University Rankings 2024 National Institute on Aging Dan Benjamini \| \| Scores \| Rankings \| \| \| \| \| \| \| \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| \| 19 \| \| \| \| \| \| \| \| \| \| Last 6 year H \| 17 \| #29 \| #108,234 \| #122,080 \| #367,071 \| \| \| \| \| \| \| 0.895 \| \| \| \| \| \| \| \| \| \| Total i10 \| 26 \| #31 \| #131,759 \| #149,181 \| #489,355 \| \| \| \| \| \| \| 23 \| \| \| \| \| \| \| \| \| \| Last 6 years i10 / Total i10 \| 0.885 \| \| \| \| \| \| \| \| \| \| \| 967 \| \| \| \| \| \| \| \| \| \| Last 6 years Citation \| 795 \| #31 \| #151,314 \| #169,368 \| #493,595 \| \| \| \| \| \| \| 0.822 \| \| \| \| \| \| \| \| \| \| Others * Edit Form Stadtman Tenure-Track Investigator, NIA, NIH Multidimensional MRI \| brain microstructure \| astrogliosis \| Alzheimer's \| aging \| \| - \| - \| - \| - \|	<urn:uuid:6a41d30b-825e-4e1e-8583-2ef5aa33958c>	CC-MAIN-2024-10	https://www.adscientificindex.com/scientist_print.php?id=4393587	2024-03-01T17:06:06+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-10/subset=warc/part-00158-d9675c6d-5c8d-45bb-9c98-c56e42022a4d.c000.gz.parquet	623,469,278	371	eng_Latn	eng_Latn	0.625486	eng_Latn	0.625486	[ "eng_Latn" ]	false	rolmOCR	[ 814 ]
VACATION RENTAL AGREEMENT PO Box 5129 Ocean Isle Beach, NC 28469 Phone: 866.320.1344 www.sunsetproperties.travel Fax: 910.579.0172 THIS IS A VACATION RENTAL AGREEMENT UNDER THE NORTH CAROLINA VACATION RENTAL ACT. THE RIGHTS AND OBLIGATIONS OF THE PARTIES TO THIS AGREEMENT ARE DEFINED BY LAW AND INCLUDE UNIQUE PROVISIONS PERMITTING THE DISBURSEMENT OF RENT PRIOR TO TENANCY AND EXPEDITED EVICTION OF TENANTS. YOUR SIGNATURE ON THIS AGREEMENT, OR PAYMENT OF MONEY OR TAKING POSSESSION OF THE PROPERTY AFTER RECEIPT OF THE AGREEMENT IS EVIDENCE OF YOUR ACCEPTANCE OF THE AGREEMENT AND YOUR INTENT TO USE THIS PROPERTY FOR A VACATION RENTAL. This Vacation Rental Agreement (this “Agreement”) is entered into as of ____________________________, 20___, by and between Sunset Properties, Inc. , as agent for the homeowner (hereinafter, the “Owner”) of the real property described in the reservation confirmation (hereinafter, the “Premises”) and _______________________________________. Sunset Properties, Inc. shall be referred to hereinafter as “Agent.” _______________________________________ shall be referred to hereinafter as “Guest”, whether one or more. In consideration of the mutual covenants and conditions herein, Owner, by and through Agent, does hereby lease and rent the Premises to Guest upon the terms and conditions of this Agreement and on those shown on www.sunsetproperties.travel. TERMS AND CONDITIONS 1. PAYMENTS: This Agreement shall be signed and returned to Agent with the first payment immediately upon making the reservation, or the reservation shall be automatically cancelled. The remaining balance shall be received in full by Agent 30 days prior to check-in date. Failure to pay balance due 30 days prior to check-in date shall result in cancellation of the reservation. All payments shall be made by eCheck, personal, travelers or bank check, money order, cash, Discover®, Visa®, or MasterCard®. For all reservations made within 10 days of check-in date, only credit card or cash payments shall be accepted. 2. FUNDS RECEIVED: a. All monies received by Agent shall be held in an interest bearing account with First Citizens Bancshares, a North Carolina banking corporation, with interest to be paid to Agent. b. In accordance with Chapter 42A of the North Carolina General Statutes (hereinafter, referred to as "NCGS"), commonly known as the North Carolina Vacation Rental Act, up to fifty percent (50%) of the total rent may be disbursed prior to occupancy. All fees owed to third parties to pay for goods, services, or benefits secured for the Guest may be disbursed prior to occupancy. 3. CHECK-IN TIME IS AFTER 4:00 PM LOCAL TIME: Dates are set forth in the reservation confirmation. Agent cannot release the Premises to begin occupancy that are not ready, nor can Agent provide refrigeration facilities for groceries. 4. CHECK-OUT TIME IS BEFORE 10:00 AM LOCAL TIME: No occupancy of the Premises, including driveways or outside showers shall be allowed after check-out. Guest may be charged up to 1 additional day rental if the Premises are occupied after 10:00 am local time. No refunds shall be given for early departures. Two sets of keys shall be issued to Guest at check-in. Guest shall be assessed a $15.00 plus tax replacement charge for each key lost or not returned to the appropriate check-out office on check-out day. 5. SURRENDER OF PREMISES: Departure cleaning is provided as part of the rental stay. However, Guest shall load and start dishwasher, remove all food and trash from the Premises and roll trash and recycle carts to the street the night before departure. Any damages to the Premises occurring during Guest's occupancy are Guest's responsibility and shall be reported to Agent immediately. 6. CANCELLATIONS AND TRANSFERS: If Guest cancels this Agreement and the Premises are re-rented, Guest shall receive a refund, less any difference in rental rate, travel insurance premium, any third-party booking fee, and $150 cancellation fee, and all applicable taxes. If the Premises cannot be re-rented, no monies shall be refunded, and Guest is responsible for fulfilling obligations set forth in this Agreement, including full payment of rents and fees. Agent reserves the right to discount the rental rate for the re-rental at its own discretion. Any discounts in the rental rate shall reduce Guest's refund. All cancellation requests shall be submitted in writing and are effective when received by Agent. In the event Guest needs to change its week after Guest's reservation has been confirmed, transfers shall only be made within the same home of Guest's initial reservation and charged the higher of the two rental rates. All transfer requests shall be submitted in writing and are subject to approval of Owner. 7. SECURITY DEPOSIT AND ACCIDENTAL DAMAGE PROGRAM (ADP) Sunset Properties requires a refundable Security Deposit or the optional payment of an accidental Property Damage Waiver for all rental properties. a. Tenant's security deposit, if any, shall be applied to the cost of repair or replacement of damage to the Premises caused by Tenant, guests or invitees beyond ordinary wear and tear. Security deposits will be refunded within 45 days of Tenant's departure (less any allowable deductions). Tenant agrees to reimburse the Owner for any damage to the Premises caused by Tenant, guests or invitees that is in excess of the security deposit. Damages shall include reasonable attorney fees and court costs incurred by Agent or Owner in enforcing this agreement. The provisions of N.C.G.S. Chapter 42A (North Carolina's "Vacation Rental Act") shall apply to Tenant's use and occupation of the Premises. The Vacation Rental Act imposes certain duties upon the Tenant, and Tenant agrees to comply with all such duties including but not limited to, the provisions of N.C.G.S. 42A-32 which provisions are incorporated herein by reference as if fully set forth. Tenant shall be responsible for, assumes all liability, for all damage, defacement or removal of property inside or outside the Premises that is in Tenant's control, unless the damage, defacement or removal is due to ordinary wear and tear, acts of the Owner or Agent, defective products supplied or repairs authorized by the Owner, acts of third parties not invitees of the Tenant or natural forces. All breakage and property damage during the Tenant's occupancy shall be reported to Agent by Tenant. Tenant will be notified in writing concerning the application and use of security deposit funds. Tenant agrees that the cost of repair or replacement in excess of the security deposit may be processed on Tenant's credit card, if a credit card is on file with Agent, without further authorization. If there is no credit card on file for Tenant, then Tenant agrees to pay all damages in excess of the security deposit within 10 days of written demand by Agent b. In lieu of a Security Deposit, Sunset Properties offers an Accidental Damage Program (ADP) for a non-refundable fee of a $79, plus tax. The ADP does not negate your responsibility as leaseholder. If you occupy a Premises and you accidentally damage the real or personal property assigned to that Premises during the reservation period, you may not be held responsible for home repairs and/or replacement costs up to $2,000. ADP is provided to you and all travelers under the Premises reservation during the term of the reservation provided on the rental agreement. ADP does not provided for loss due to: a. inclement weather or natural disaster; b. your intentional acts or gross negligence; c. normal wear and tear of the real or personal property assigned to the Premises; d. any damage that occurs if you are in violation of the lease agreement; e. loss, theft or damage to any personal effects owned by you or brought on the covered reservation period by you; f. pet damage; g. loss, theft or damage caused by any person other than you or your traveling companions with whom you share the Premises reservation unless substantiated by a police report. Your Duties in the Event of Accidental damage: You must: 1. take all reasonable, necessary steps to protect the property and prevent further damage to it; 2. report the damage immediately to Sunset Properties staff. The leaseholder remains subject to all obligations imposed by the North Carolina Rental Act. 8. ADDITIONAL PROVISIONS/DISCLOSURES: a. Agent may have an ownership interest in the Premises. b. Agent may be paid commission on linen rentals, entertainment packages, vacation insurance, pet fees, and may also receive commissions from other vendors. c. Guest shall be charged a $35.00 fee plus tax on any returned check. Returned checks shall not be re-deposited. Payment shall be made by money order, cashier's check, or credit card within 5 days of notification. If it is less than 10 days prior to arrival, payment shall be made immediately by credit card. d. Any check issued to Guest by Agent, not negotiated within 6 months of issuance, shall be subject to a $35.00 plus tax stop payment fee and a $25 re-issuance fee. e. Guest shall be charged a $25.00 plus tax nonrefundable fee if locked out after hours. f. RVs are not permitted on the Premises at any time. g. Temporary items, including, but not limited to, tents, hot tubs, swimming pools, and soft tubs are not permitted. h. Charcoal and propane gas grilling shall not be allowed on decks or porches or under or close to any structure on the Premises. Charcoal must be extinguished immediately after grilling. i. Smoking is prohibited in every structure on the Premises. Violation of the NO SMOKING policy is grounds for immediate eviction and retribution for future lost income, including, but not limited to, the relocation of future guests, restoring property and contents to a satisfactory level as solely determined by Agent, and all associated costs. j. Agent and its employees represent the Owner, and is acting at all times, in and for the best interests of the Owner. 9. MINIMUM ACCEPTABLE AGE/FAMILY GROUPS: Agent is authorized by Owner to rent the Premises only to a family group. The individual executing this Agreement shall be 25 years of age or older. A family group is defined as immediate and extended family (e.g., parents, children, grandparents, aunts, uncles, and cousins). No fraternities, sororities, church, school, civic, or other non-family groups are permitted. In the event Agent determines, in Agent's sole discretion, that a non-family group is renting the Premises, Guest shall be in material breach of this Agreement. Guest shall be denied access to the Premises and/or evicted immediately. All rents and fees paid to Agent by or on behalf of Guest shall be forfeited. 10. SUBLETTING: Subletting is not permitted and Guest shall not assign this Agreement or sublet the Premises in whole or part without written permission of Agent. 11. EVACUATIONS AND TRIP INSURANCE: Guest acknowledges being offered insurance to compensate Guest for certain unforeseen circumstances that may cause trip cancellation or interruption, including mandatory evacuation. Guest must choose to purchase or decline to purchase trip insurance at the time of making a reservation. Coverage goes into effect once the premium is paid. If Guest does not accept said offer, Guest shall not be entitled to a refund of monies paid as provided in NCGS §. 42A-36. Guest agrees to comply with all mandatory orders of evacuation whether given by federal, state, or local authorities, time being of the essence. Guest is allowed no more than 3 hours from the issuance of the evacuation order to vacate the Premises. Occupancy of the Premises thereafter shall constitute a trespass and law enforcement authorities shall be notified. Guest acknowledges that following the lifting of a mandatory evacuation, the Premises may not be available for occupancy. Agent shall not be responsible in any manner whatsoever if the Premises are not available for occupancy following the lifting of a mandatory evacuation. 12. TERMINATION OF RENTAL: In the event Owner removes the Premises from availability, or if the Premises becomes unavailable for any reason, Agent reserves the right to substitute comparable accommodations or refund payments made. Any additional costs shall be the sole responsibility of Guest. 13. UNSAFE CONDITIONS: Agent reserves the right to relocate Guest in the event that, in Agent's sole discretion, an unsafe or potentially unsafe situation exists. Any additional costs shall be the sole responsibility of Guest. 14. EMERGENCY CALLS: For after-hours emergencies (e.g., leaks, electrical outage, or lock out) please call 910-579-2596. Agent shall return your call as soon as possible. After-hour non-emergency calls (e.g., clogged toilets, internet/cable issues, appliance malfunction) shall be made during normal business hours the following day. After-hours Non-emergency calls may be charged a service fee. 15. INTERNET ACCESS: The Premises may provide internet access for Guest's laptop, phone, or tablet. If so, it may include either wireless internet or wired internet (Ethernet cable and computer are not provided). Please refer to the property description to determine the types of services and equipment offered. Remember to bring a network cable to connect to the modem box for non-wireless connections or in case of Wi-Fi configuration difficulties. Refunds shall not be given for interruption in internet service. Free wireless internet is available for guest use at Agent's office. Guest is prohibited from using Internet access for any purpose that is unlawful, threatening, libelous, defamatory, obscene, scandalous, inflammatory, pornographic, misleading, tortuous, profane, infringing, damaging, or in any manner that could give rise to civil or criminal liability under the law. 16. EQUIPMENT AND FURNISHINGS: All equipment and furnishings are privately owned and are to Owner's taste and are set up for normal housekeeping. The descriptions of the Premises were accurate at the time of publication but subsequent renovations by Owner may have been made. Upon Guest's arrival, Agent is not responsible for changes made to the Premises by Owner or for any conditions in or on the Premises beyond Agent's control. Mattress pads, pillows, and bedcovers are provided. Guest shall furnish toiletries, cleaning supplies, all food items, and linens unless rented separately. Under no circumstances shall Guest receive a reduction in rent or be relocated for any equipment or amenity failure. Rearranging of the furniture is not permitted. Guests shall not transfer furniture, cookware, or accessories from the Premises to another property. Guest shall not move interior furniture outdoors. Certain areas on the Premises are locked for Owner's personal storage and are not included as part of this Agreement. Agent, upon being notified by Guest of any malfunction on the Premises shall make every reasonable effort to have such appliances or amenities repaired. Replacement or repair during Guest’s stay cannot be guaranteed. 17. APPLIANCES AND AIR CONDITIONERS: The Premises is equipped with central heating, air conditioning, and basic appliances. Please refer to the property description for details regarding the Premises. No full or partial refunds shall be issued for HVAC unit or an appliance mechanical failure. Once Agent is notified of any mechanical problems, Agent shall make every effort to have it repaired as quickly as possible. Please follow all HVAC and appliance instructions posted in the home. Under no circumstances shall Guest receive a reduction in rent or be relocated for any equipment or amenity failure. 18. LISTINGS AND PRICING: Guest is responsible for reviewing the description, photos, location, and amenities listed online for Premises to confirm that it will meet the needs of Guest. Information regarding the Premises is believed accurate but cannot be guaranteed. Agents makes every effort to ensure that all information on its website is current and accurate. However, the possibility of errors and omissions exists. A representative of Agent shall be happy to confirm all data contained herein or answer any questions regarding details of the Premises Guest may have prior to booking its reservation. Rates for different seasons, holidays, special events, and weekends may be higher. Rates are subject to change. Agent's "Simple Pricing" rental rates include all fees for rental services including, but not limited to, lodging, departure cleaning, reservation, and payment processing. Fees range from $205-$435 depending on property size, configuration and rental rate. Taxes, trip insurance, pet fees, and any fees for additional services are not included. 19. DISABILITY FRIENDLY PROPERTIES: Some of our properties Agent leases have ground floor living and/or sleeping facilities or may be equipped with elevators and/or ramps. Please refer to the description of the Premises for details. Agent does not guarantee complete Americans with Disabilities Act compliance for the Premises but Agent will gladly assist with finding a property which best suits Guest's needs. 20. SUBSTITUTION OF ACCOMMODATIONS: Agent reserves the right to substitute comparable accommodations without notice or liability in the event of a sale or if the Premises becomes unavailable. If a comparable property is not available, Guest shall have the option of either choosing from Agent's other available properties or a refund of total rents paid by Guest. Agent shall make every attempt to notify Guest as soon as possible if a substitution must be made. 21. CONSTRUCTION NEAR PREMISES: Sunset Beach is a growing community and there is a chance that the Premises may be located near some construction. Noise and altered views due to construction are beyond Agent's control. Agent is not responsible for notifying Guest of said noise or altered views at any time. Refunds, discounts, substitutions, or cancellations shall not be made due to nearby construction. 22. PETS: Pets are NOT permitted on the Property unless specifically provided in CONFIRMATION PROVISIONS. If pets are permitted, there shall be no more than 2 dogs in or on the Premises. No other type of pet whatsoever is allowed in or on the Premises. The description of the Premises may list additional restrictions. If pets are not permitted and a pet is found on the Premises, this shall be a material breach of this Agreement. Guest shall be evicted immediately, and shall be subject to additional cleaning charges, including, but not limited to, a flea treatment charge, potential retribution for future lost income, costs and expenses to relocate future guests, restoring property and contents to a satisfactory level as solely determined by Agent, and other associated costs. No pets are permitted in either hot tubs or pools. If pets are found to have been in pools or hot tubs Guest shall be charged an additional fee. At no time should a pet be left alone in any structure located on the Premises. If, in the event of an emergency, the pet is left unattended it must be placed in a Guest supplied crate-like container made for a pet. 23. BUGS AND WILDLIFE: Unfortunately for locals and visitors alike, coastal North Carolina is home to many species of insects and types of wildlife, especially during the summer and warmer months. In addition to the expected rodents and reptiles, the American Cockroach (fondly referred to as the "Palmetto Bug"), ants, mosquitoes, and sand gnats are common to our sub-tropical environment. Palmetto Bugs live in the trees and ground cover outside but can occasionally find their way inside the structures located on the Premises. Agent does its best to keep the insects and wildlife away. The Premises are cleaned after every rental and receives monthly pest control treatments. Finding dead bugs is confirmation of effective treatments. An occasional cockroach or line of ants does not mean the Premises is infested or has been poorly maintained. Keep food sealed. All food should be stored either in the refrigerator or in sealed packages or containers. Keep the Premises clean. Bugs are attracted to food and water. Be sure to clean up all areas where food is prepared and served, clean up spills and crumbs from snack foods immediately, and do not leave dirty dishes lying around the Premises. Agent will not relocate Guest or issue refunds or discounts due to insect or wildlife sightings. 24. HOUSEKEEPING AND FEES: A departure clean is performed after each check-out. This includes a light cleaning that focuses on sanitizing the baths and kitchen, light dusting, vacuuming, and straightening of accessories and contents of the Premises. Accordingly, Agent requests that Guest be attentive to the check-out requirements and departure times. Note: If the Check-Out Procedures have not been completed or the Premises needs additional cleaning, Agent may bill guest for the additional housekeeping costs, which is a minimum charge of $35.00. 25. OWNER'S/AGENT'S OBLIGATIONS: Agent shall conduct all brokerage activities in regard to this Agreement without respect to the race, color, religion, sex, national origin, handicap, familial status, sexual orientation, or gender identity of Guest or the guest of Guest. Pursuant to NCGS § 42A-31, Owner and Agent agree to provide the Premises in a fit and habitable condition. If at the time Guest is to begin occupancy of the Premises, Owner or Agent cannot provide the Premises in a fit and habitable condition or substitute a reasonably comparable property in such condition, Agent shall refund to Guest all payments made by Guest and still held by Agent, which shall be Guest's sole remedy. In no event shall Owner or Agent be liable for any consequential damages, including but not limited to, any expense incurred as a result of Guest's moving or renting another property at additional cost. 26. TRANSFER OF PROPERTY: In the event ownership of the Premises is transferred, either voluntarily or involuntarily, earlier than 180 days prior to end of Guest's occupancy, Guest shall have no right to enforce the terms of this Agreement unless the new owner agrees in writing. Chapter 42A of the NCGS requires notification to Guest of such transfer and any transfer of advanced rentals and fees to Owner's successor in interest. Agent may continue to hold same under contract with the new owner. In the event this Agreement is not honored by the new owner, Guest shall be entitled to a refund of all advanced rent paid and shall be paid by the party holding the rent at that time. 27. FORECLOSURE: If Agent learns of the foreclosure of the Premises after Guest signs this Agreement, Agent shall: a. Notify Guest: b. Not disburse further sums to Owner: c. Request Owner return to Agent the rents Guest has paid; and d. Attempt to relocate Guest to a reasonably comparable property. 28. GUEST'S OBLIGATIONS / RIGHT OF ENTRY: During occupancy Guest agrees that Agent reserves the right to enter the Premises anytime to investigate disturbances, check occupancy, check for damage, deliver household items, or have a scheduled necessary service carried out. Such scheduled necessary services include repairs, alterations, or improvements thereto as Agent deems appropriate. Guest agrees to comply with all obligations imposed by NCGS § 42A-32, with respect to maintenance of the Premises, including but not limited to, keeping the Premises as clean and safe as possible and causing no unsafe or unsanitary conditions on the Premises. Guest shall notify Agent of the need of replacement of, or repairs to, a smoke detector or carbon monoxide detector, and replacing the batteries as needed during the tenancy. Charcoal grilling shall not be allowed on decks or porches or under or close to any structure on the Premises. If a telephone is available on the Premises, Guest shall be responsible for all toll calls. Guest agrees not to use the Premises for any activity or purpose that violates any criminal law or governmental regulation. In the event of the Premises are listed for sale, Agent shall make every effort not to show the Premises during Guest's tenancy. In the event that Agent needs to schedule a showing of the Premises, Agent shall make every attempt to provide Guest with a minimum of 12 hours advanced notice and complete such showing between 9am and 5pm. Guest's breach of any duty contained in this paragraph shall be considered material and a breach of this Agreement. A breach may result in a termination of Guest's tenancy and may result in Guest's eviction and loss of all monies paid. POOLS AND HOT TUBS: Guest acknowledges the Premises may be equipped with a private pool or hot tub or has access to a community pool or hot tub (the "Facilities"). Guest hereby accepts and agrees to the following: a. Owner provides pool and/or hot tub maintenance through a third party that is unaffiliated with Agent; b. Guest shall ensure that the Facilities are used in a safe manner at all times and that non-adult use of the Facilities is supervised by a responsible and mature adult of suitable supervisory skills; c. Unsafe and/or unsupervised use of the Facilities by Guest or guests of Guest is a material breach of this Agreement and shall permit Agent to terminate IMMEDIATELY WITHOUT NOTICE Guest's occupancy of the Premises; d. Guests are prohibited to tamper with chemicals or equipment. If Guest is found to have tampered with chemicals or equipment, Guest shall be responsible for any expenses incurred; e. NO REFUNDS shall be given for pools not heating to what Guest believes to be an acceptable level due to adverse weather conditions; f. Pool heat added to a reservation within 14 days of check-in may incur an additional fee. Pool heat charges shall not be pro-rated except in the event of additional nights being added to full week reservations; g. In the event Guest requests additional cleaning of pool and/or hot tub, an additional fee shall apply; and h. Pregnant women, persons taking medication, elderly persons, including those with diabetes, high blood pressure, heart disease, or other cardiovascular conditions should consult their physician prior to entering a hot tub. Children under the age of 12 are prohibited from entering hot tubs at any time. Removal of chemical dispensers, misuse, and/or overuse of hot tubs may result in health related problems, such as folliculitis. Guest assumes risk of illness from improperly maintained pools and/or hot tubs and releases Agent from any liability for injury or damage. 29. REFUNDS, BREAKDOWNS & MAINTENANCE: This Agreement is a legally binding agreement between Guest, Agent, and Owner. Guest's reservation and Rental Agreement binds Guest to the Premises for a specific period of time. There shall be no refunds, discounts, or reductions in rent because Guest is disappointed with the Premises or something associated with the Premises is not working to Guest's satisfaction. Unlike a hotel, Agent cannot relocate Guest without specific authorization from the Owner. Each Owner makes every attempt to keep Premises and its equipment in good working order. All appliances shall be checked and should be in working order at the time of Guest's arrival at the Premises. Agent does not guarantee against mechanical problems that may arise. Agent is not responsible and cannot control the amount of time repair service calls may take. Please report any problems, breakdowns, or damages as soon as possible to Agent during regular business hours. There shall be no refunds, discounts, or reductions in rent for mechanical failure of any items such as the HVAC unit, TV, internet, dishwasher, washer, dryer, refrigerator, ice maker, freezer, stove, oven, microwave, hot water heater, water leaks, garbage disposal as well as pool and/or spa heater, pool and/or spa pump, telephone, toilet(s), clock radio, fireplace, grill and other appliances, electronics, or luxury items. Service interruptions and outages can occur for water, electric, internet, telephone, or cable. Any breakdowns or malfunctions shall be repaired as quickly as possible during normal business hours. There shall be no refunds, discounts, or reductions in rent for inclement weather conditions. 30. LOST AND FOUND: Items left by Guest on the Premises after check-out are not Agent's responsibility. If items are discovered, they shall be returned to Guest if Guest notifies Agent of missing items within 10 days of check-out. Agent shall mail the item(s) COD. Guest shall pay a handling fee of $25 (plus tax), plus shipping and handling. Any items not claimed within 10 days after check-out shall be donated to a local charity. 31. BREACH BY GUEST: Agent may terminate this Agreement upon breach of any of the terms hereof by Guest. Guest shall not be entitled to the return of any of the rental monies paid under the terms of this Agreement and shall vacate and quit the Premises immediately. Guest is also subject to the expedited eviction proceedings under said Chapter 42 of the NCGS, on the grounds set forth therein. In such event, Guest shall be responsible for court cost and cost of litigation, including reasonable attorney's fees for the enforcement of this Agreement. 32. INDEMNIFICATION AND HOLD HARMLESS; RIGHT OF ENTRY; ASSIGNMENT: Guest shall indemnify and hold Agent (its officers, employees, agents, and equity holders) and Owner of the Premises harmless from and against any and all liabilities, claims, and expenses for personal injury or property damage resulting from unsafe and/or unsupervised use of the Facilities or the Premises by Guest or guests of Guest. 33. GOVERNING LAW: This Agreement shall be governed by and interpreted in accordance with the laws of the State of North Carolina. Tax rates are determined by the State of North Carolina and the County of Brunswick and are subject change without notice. Guest is responsible for additional taxes imposed. Any action relating to this Agreement shall be instituted and prosecuted in the courts of Brunswick County, North Carolina. 34. MODIFICATIONS OR CHANGES: Any modifications or changes of this Agreement shall not be effective unless such modifications or changes are agreed to in writing by both Agent and Guest. 35. ENTIRE AGREEMENT: This Agreement constitutes the entire agreement of Agent and Guest. It supersedes all prior or contemporaneous oral or written agreements concerning the subject matter contemplated herein. By signing below, Guest acknowledges having read, understood, and accepted the terms and conditions of this Agreement. Please type name exactly as it appears on page 1 of this Agreement. GUEST By: _______________________________________ Print Name: _______________________________________ Date: _______________________________________	<urn:uuid:95fd332c-4431-4db2-aa49-ad5212d8cbe8>	CC-MAIN-2023-50	https://www.sunsetbeachnc.com/uploads/vra(1).pdf	2023-12-04T23:21:15+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00183-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	1,137,034,666	6,440	eng_Latn	eng_Latn	0.996365	eng_Latn	0.996771	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 4803, 10039, 15742, 22017, 27676, 30969 ]
Regional Differences of Leptospirosis in Sri Lanka: Observations from a Flood-Associated Outbreak in 2011 Suneth B. Agampodi\textsuperscript{1,2,3}, Niroshan J. Dahanayaka\textsuperscript{2,4}, Anoma K. Bandaranayaka\textsuperscript{5}, Manoj Perera\textsuperscript{5}, Sumudu Priyankara\textsuperscript{4}, Prassana Weerawansa\textsuperscript{2,4}, Michael A. Matthias\textsuperscript{3}, Joseph M. Vinetz\textsuperscript{5,6,7} \textsuperscript{1} Department of Community Medicine, Faculty of Medicine and Allied Sciences, Rajarata University, Saliyapura, Sri Lanka, \textsuperscript{2} Tropical Disease Research Unit, Faculty of Medicine and Allied Sciences, Rajarata University, Saliyapura, Sri Lanka, \textsuperscript{3} Division of Infectious Diseases, Department of Medicine, University of California San Diego, School of Medicine, La Jolla, California, United States of America, \textsuperscript{4} Department of Medicine, Faculty of Medicine and Allied Sciences, Rajarata University, Saliyapura, Sri Lanka, \textsuperscript{5} Teaching Hospital, Anuradhapura, Sri Lanka, \textsuperscript{6} Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Peru, \textsuperscript{7} Departamento de Ciencias Celulares y Moleculares, Laboratorio de Investigación y Desarrollo, Facultad de Ciencias, Universidad Peruana Cayetano Heredia, Lima, Peru Abstract Leptospirosis is known to be an important cause of weather disaster-related infectious disease epidemics. In 2011, an outbreak of leptospirosis occurred in the relatively dry district of Anuradhapura, Sri Lanka where diagnosis was resisted by local practitioners because leptospirosis was not known in the area and the clinical presentation was considered atypical. To identify the causative \textit{Leptospira} associated with this outbreak, we carried out a cross-sectional study. Consecutive clinically suspected cases in this district were studied during a two-and-a-half-month period. Of 96 clinically suspected cases, 32 (33.3%) were confirmed by qPCR, of which the etiological cause in 26 cases was identified using 16S rDNA sequencing to the species level. Median bacterial load was $4.1 \times 10^8$/mL (inter-quartile range 3.1–6.1 $\times 10^7$/mL). In contrast to a 2008 Sri Lanka leptospirosis outbreak in the districts of Kegalle, Kandy, and Galle in which a predominant cause of \textit{Leptospira interrogans} serovar Iai and Geyewa was found, most cases in the 2011 outbreak were caused by \textit{Leptospira kirschneri}. Seven (21.9%) confirmed cases had acute renal failure; five (15.6%) had myocarditis; severe thrombocytopenia (<20,000/μL) was seen in five (15.6%) cases. This outbreak of leptospirosis in the relatively dry zone of Sri Lanka due primarily to \textit{L. kirschneri} was characterized by markedly different clinical presentations and low leptospiremia. These observations and data demonstrate the public health relevance of molecular diagnostics in such settings, possibly related to the microgeographic variations of different \textit{Leptospira} species, but of particular value to public health intervention in what appears to have been a regionally neglected tropical disease. Citation: Agampodi SB, Dahanayaka NJ, Bandaranayaka AK, Perera M, Priyankara S, et al. (2014) Regional Differences of Leptospirosis in Sri Lanka: Observations from a Flood-Associated Outbreak in 2011. PLoS Negl Trop Dis 8(1): e2626. doi:10.1371/journal.pntd.0002626 Editor: Sheila Lulekhat, University of Washington, United States of America Received April 17, 2013; Accepted November 23, 2013; Published January 16, 2014 Copyright: © 2014 Agampodi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was partially supported by US Public Health Service Grant from the Fogarty International Center D43TW007120. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. E-mail: [email protected] Introduction Sri Lanka is a tropical island located southeast of India. Annual rainfall varies from <1,500 mm in “dry” zones, where water reservoirs may dry to completeness, to 5,000 mm in the “wet” zones with a mean annual temperature between 26.5°C to 28.5°C. Based on Ministry of Health notification data, leptospirosis is common in nine of 24 districts in Sri Lanka with annual disease incidence rates varying from 31 to 164/100,000 population [1]. All leptospirosis endemic districts are within wet zones and have an annual rainfall in excess of 2,000 mm. In wet zone districts, paddy farming activities, high rainfall, moist soil, year-round water retention in paddy fields, the use of buffalo in agriculture and peri-domestic animal farming in rural areas provide ideal environments for the transmission of leptospirosis. In 2011, a large outbreak of leptospirosis was observed in Anuradhapura district of Sri Lanka, which has not previously classified as an endemic area for leptospirosis. Anuradhapura is located in North Central province of Sri Lanka, in the dry zone of the country. The annual rainfall is 1,200–1600 mm and the mean annual temperature is ~30°C. In the Anuradhapura area, paddy farming is carried out by traditional, full-time farmers and provides the main mode of income. Paddy fields are often much larger than leptospirosis-endemic areas. There are no wetlands or marshy lands in these areas, except the paddy fields during working seasons. Paddy field work depends on irrigation systems, so that between farming seasons, paddy fields become completely dry (Figure 1). The soil structure, water quality and ecological systems in Anuradhapura contrast with those of the wet zones of Sri Lanka where leptospirosis is endemic. In January, 2011, there was a 7-fold increase in rainfall compared to the previous year, with flooding in Anuradhapura district affecting nearly 300,000 people [2]. In 2011, after two weeks of massive flooding in Anuradhapura, physicians from Anuradhapura reported an increase in the number of febrile patients with liver and renal complications. Based on clinical presentation alone this cluster of suspected cases was considered to be an outbreak of leptospirosis [3]. There were 18 suspected leptospirosis cases reported from the Teaching Hospital Anuradhapura (THA) in January rising to 82 clinically suspected cases. Leptospirosis outbreaks occur predictably in Sri Lanka after seasonal rains and flooding in the endemic wet zone. Molecular investigations with quantification of a post-flood leptospirosis outbreak in the non-endemic dry zone of Sri Lanka in 2011 suggest variation of biological, clinical, and molecular characteristics compared to previous reported leptospirosis outbreaks in the endemic areas, probably showing a micro-geographic variation of leptospirosis. This work demonstrates the direct clinical and public health impact of modern molecular diagnostic technologies to identifying an endemic neglected tropical disease where previously not suspected, especially in the resource-poor setting. Because the clinical presentation of these suspected cases was different from that reported previously, some clinicians challenged the diagnosis of leptospirosis—especially since only a few cases could be diagnosed serologically, i.e. by microscopic agglutination test (MAT). However the performance of the gold standard serological Figure 1. Geography of Anuradhapura showing paddy fields and water reservoirs. (A) Partially dried water reservoir (Nuwara Wewa) during dry season (B) Females removing weeds in paddy fields (C) Water reservoir during the rainy season (D) Dried up reservoirs during dry season (E) Flooding in Anuradhapura (F) Paddy field during the cultivation season. Figure 2. Suspected cases of leptospirosis reported to the regional epidemiologist Anuradhapura during 2000–2012 period. doi:10.1371/journal.pntd.0002626.g002 test for leptospirosis—the MAT—was limited because only genus-specific antigen (Leptospira biflexa serovar Patoc) was used for detection of anti-leptospirosis antibodies. In the present study we use a recently published qPCR assay [4] to attempt to confirm that this outbreak of febrile illness with renal and liver complications was indeed due to leptospirosis, and if so, to quantify the bacterial load and determine whether this flood-associated outbreak was caused by the same strains implicated in the island-wide outbreak of 2008 [5]. Methods Enrollment We carried out a prospective hospital based study in THA from the 21st of February to the 12th of May 2011. The heavy rains continued until the first week of February resulting in most of the paddy fields in the area become partially submerged even during the harvesting period which extended to April. The appearance of new leptospirosis cases declined after the first week of May (around 3–4 weeks after the end of the harvesting period). THA is the only tertiary care institute in the district of Anuradhapura, Sri Lanka. It has four general medicine wards with an average of 1500 admissions per month. The study population included all febrile patients >13 years of age with probable leptospirosis admitted to medical wards of THA. Probable cases of leptospirosis were identified using clinical criteria as outlined by the epidemiology unit of Sri Lanka (Table 1) [6]. Based on previous observations [5], this definition was relaxed to include “any patient suspected as having leptospirosis” by a treating physician. The protocol and case definitions for patient recruitment, sample collection and molecular methods were designed to be consistent with the protocol used during previous outbreak investigation in 2008 [5]. All suspected patients admitted to THA during the study period were screened using a clinical data checklist on admission to the ward and throughout the hospital stay. Socio-demographic data and exposure history were obtained using an interviewer-administered questionnaire. A data extraction sheet was used to collect laboratory and other investigation data from patient records. In this study, we used a published qPCR assay validated previously using Sri Lankan samples [4]. A total of 5 mL of venous blood was obtained from suspected cases following standard procedures. Samples were sent to the Faculty of Medicine, Rajarata University of Sri Lanka within two hours of collection. Serum was separated; serum and whole blood samples were stored at −20°C until analyzed [7]. Preparation of standard curve For use in preparing standard curves (with spiked bacteria) and negative controls, venous blood was collected from a healthy individual. Exponential-phase L. interrogans serovar Copenhageni strain L1-130 [8] cultured in liquid EMJH media was inactivated in 10% formalin for 1.5 minutes then counted in a Petroff-Hauser counting chamber (Hauser Scientific). Known numbers of live L. interrogans L1-130 were then spiked into whole blood or serum and diluted to give final concentrations of $10^5$ to $10^8$ Leptospira/mL. DNA was extracted from spiked samples as described below. For Leptospira-negative controls, unspiked whole blood or serum from the same healthy individual was extracted as described. DNA extraction. DNA was extracted from 100 µL of spiked (or unspiked) whole blood or serum using the DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s directions. Following extraction, DNA was eluted in 200 µL buffer AE in two elution steps (100 µL each) and stored at −20°C prior to use. qPCR primers and probes. qPCR was performed according to a previously published protocol using primer pair “16S Taqman” (GAGTTTGGGAGAGGCAGTGGAATCCCA) and “16S Taqman” (CGCTTTTCGTGCTCAGGCTGTTT-TTA)” and probe “16S Taqman probe” labelled with the fluorescent reporter dye FAM (6-carboxyfluorescein) at the 5’ end, and Black Hole quencher one (BHQ-1) at the 3’ end. These pathogen-specific primers amplify a conserved region within the 16S gene of infectious leptospiral species. qPCR conditions and identification of positive samples PCR reaction mixes were prepared using the iQ Supermix (BioRad) with final primer and probe concentrations of 0.5 µM and 0.2 µM, respectively, and 5 µL DNA (samples/standard curves and Leptospira-negative controls) or no-template control in a total reaction volume of 20 µL. Samples were amplified using a previously published qPCR assay [8]. All reactions were performed in triplicate. Fluorescence was measured at the end of the each cycle. The cycle threshold was set to two standard deviations above the mean fluorescence value for the first three cycles. A positive PCR was defined when all three replicates had a fluorescence signal above threshold. Reactions with one or two positive replicates were repeated and confirmed (or labeled as not-detected). All positives had a quantitative signal within the linear part of the standard curve greater than the cycle threshold. Table 1. Inclusion criteria for probable cases of leptospirosis, during the 2011 post-flood outbreak of leptospirosis in Anuradhapura, Sri Lanka. \| Inclusion criteria \| \|--------------------\| \| 1. Presenting complain – acute febrile illness (fever less than 5 days) with Headache, Myalgia and Prostration, associated with any of the following signs (at least one): \| \| • Conjunctival suffusion/conjunctival haemorrhage \| \| • Meningeal irritation \| \| • Anuria or oliguria/proteinuria/haematuria \| \| • Jaundice \| \| • Haemorrhage \| \| • Purpuric skin rash \| \| • Cardiac arrhythmia or failure \| \| 2. Any febrile patient who is clinically suspected as having leptospirosis, without conforming to surveillance case definition \| doi:10.1371/journal.pntd.0002626.t001 Single-tube nested PCR (STNPCR) and sequencing All qPCR positive samples were amplified using a previously published nested PCR protocol [5]. This single-tube nested PCR was used to amplify a region of the 16S ribosomal DNA gene specific for pathogenic and intermediate Leptospira spp. The PCR primers were rrs- outer-F (5'-CTCAGAAACTAACGCTGGCGGC CGCG-3'), rrs- outer-R(5'-GGTTTCGTACTGAGGGTAAAACCCCC-3'), rrs-inner-F (5'-CTGGCCGGCGCGTCTTTA-3'), Figure 5. Phylogenetic tree based on the region of leptospira rrs gene. The sequences were aligned in MEGA4 using CLUSTALW, and phylogenetic distances were calculated in MEGA4 using the maximum likelihood. Numbers of nodes were bootstrap support after 500 replicates. doi:10.1371/journal.pntd.0002626.g005 Table 2. Exposure to probable sources of Leptospira during the period of three weeks prior to the onset of fever, 33 confirmed cases of leptospirosis during 2011 post-flood outbreak in Anuradhapura, Sri Lanka. \| Exposure \| n \| % \| \|---------------------------\|-----\|------\| \| Paddy field \| 27 \| 84.4 \| \| Drains \| 14 \| 43.8 \| \| Manmade running water sources \| 11 \| 34.4 \| \| Natural running water \| 5 \| 15.6 \| \| Other water sources \| 10 \| 31.3 \| \| Flooded area \| 7 \| 21.9 \| \| Marshy land \| 6 \| 18.8 \| \| Animal handling \| 5 \| 15.6 \| doi:10.1371/journal.pntd.0002626.t002 and rs-inner-R (5’-GTTTTTCACACCTTGACTTACA-3’). PCR products were purified using the USB ExoSAP-IT PCR product cleanup kit (Affymetrics) according to manufacturer’s instructions. At least two forward and two reverse sequencing reads were obtained for all samples; sequences were assembled and aligned using Geneious software then the alignments trimmed to yield a 443 bp region for phylogenetic analysis [positions 89–531 of the rO gene of L. interrogans serovar Lai strain 56601 (NC_004342) for phylogenetic analysis. For species identification, maximum likelihood trees with support from bootstrap 500 replicates were created in MEGA5. Statistical analysis Data were analyzed using SPSS version 17. All categorical data were presented as proportions. Statistical tests for categorical data were done using chi-square test. Ethics statement This study conformed to the Helsinki Declaration and to local legislation. All participants gave written informed consent to participate in this study. Ethical clearance was obtained from the Research and Ethics Committee, Faculty of Medicine and Allied Sciences, Rajarata University of Sri Lanka. Results Demographic information of the study sample From 21st of February to 12th of May 2011, 96 probable leptospirosis cases were enrolled (Figure 3). Of these probable cases, 61 (63.5%) were adult males. The mean age of the study sample was 40 years (Standard deviation (SD) +/- 12 years). None of these patients were admitted directly to the medical wards of THA. Before coming to THA, all 96 patients sought health care from either private clinics (33, 34.3%) or other government facilities. These 96 cases were from 14 administrative divisions (of the total of 20) showing a large scale rather than a focal outbreak. The median duration of fever on admission was four days (interquartile range; IQR 3–7). Paddy farmers accounted for 63.5% of the study sample. Disease confirmation, bacterial load and strain identification Of the 96 clinically suspected cases of leptospirosis, 32 (33%) were confirmed using qPCR. Bacterial load in serum/blood ranged from $10^2$ to $10^4$ Leptospira/mL among 32 positive cases (Figure 4). Median bacterial load was $4.1 \times 10^2$ Leptospira/mL (inter-quartile range 3.1–6.1 $\times 10^2$/mL). The 16S rRNA gene could be amplified and sequenced from 26 (31.3%) of these qPCR-positive samples. Based on phylogenetic analysis of the 16S rRNA gene, L. icterohaemorrhagiae was the most common cause of disease among outbreak cases ($n=20$), with strains belonging to L. borgpeterseni and L. interrogans also identified (Figure 5). Exposure All 32 confirmed cases reported exposure to either a single (14, 43.8%) or multiple sources (18, 46.2%) of natural/man-made water catchments during the three-week period prior to the onset of disease (Table 2). Direct exposure to floodwater was reported by seven cases. 27 (84.4%) were engaged in paddy farming activities and all 27 reported farming as the main income source for their families. Regular exposure in paddy fields (>2 days per week) during this period was reported by 22 (67.8%) confirmed cases. Though frequent exposure in paddy farms was slightly more common in confirmed cases, the difference was not statistically significant. The presence of skin wounds was observed among 11 (34.4%) confirmed cases. However, 23 (71.9%) of the confirmed cases had skin breaches in the form of cracks around the heel, which was equally common among suspected (unconfirmed) patients. Clinical profile The median duration of fever among confirmed cases was 6 days (IQR 2–8 days) compared to 7 days (IQR 2–10 days) among probable cases. This difference was not statistically significant. Median duration of hospital stay among confirmed cases was 5 days (IQR 3–6 days). All patients had fever and headache. Of the symptoms/signs included in the proposed WHO surveillance case definition, oliguria was the most common symptom (Table 3). Table 3. Clinical features of 32 qPCR confirmed cases of leptospirosis during 2011 post-flood outbreak in Anuradhapura, Sri Lanka. \| Symptom/sign \| n \| % \| \|-----------------------\|-----\|------\| \| Fever \| 32 \| 100 \| \| Headache \| 32 \| 100 \| \| Myalgia \| 26 \| 81.2 \| \| Prostration \| 13 \| 40.6 \| \| Oliguria \| 11 \| 34.4 \| \| Diarrhea \| 7 \| 21.9 \| \| Dyspnea \| 7 \| 21.9 \| \| Hypotension \| 6 \| 18.8 \| \| Photophobia \| 5 \| 15.6 \| \| Jaundice \| 4 \| 12.5 \| \| Bleeding manifestations\| 4 \| 12.5 \| \| Pharyngitis \| 4 \| 12.5 \| \| Bycardia \| 2 \| 9.4 \| \| Anuria \| 1 \| 6.3 \| \| Hepatomegaly \| 1 \| 3.1 \| \| Convulsions \| 1 \| 3.1 \| doi:10.1371/journal.pntd.0002626.t003 Table 4. Comparison of selected features of 2008 outbreak and 2011 outbreak of leptospirosis in Sri Lanka. \| Feature \| 2008 outbreak \| 2011 outbreak \| \|-------------------------------\|--------------------------------\|--------------------------------\| \| Outbreak \| Island wide (mainly in wet zones) \| Anuradhapura district (dry zone) \| \| Period \| Throughout the year \| Following heavy rains and floods in first quarter of the year \| \| Predominant species \| L. interrogans (20/26) \| L. kirschneri (26/32) \| \| Median duration of fever (IQR)\| 6 (4–8) \| 6 (2–8) \| \| Median bacterial load (IQR) \| $9.5 \times 10^7$ ($4.6 \times 10^5 – 4.9 \times 10^8$) \| $4.1 \times 10^8$ ($3.1 – 6.1 \times 10^8$/mL) \| \| Renal failure (%) \| 13.8 \| 21.9 \| \| Myocarditis (%) \| 10.3 \| 15.6 \| \| High serum urea (%) \| 49.3 \| 53.1 \| \| Thrombocytopenia (%) \| 47.0 \| 78.1 \| \| Elevated liver enzymes (%) \| 29.2 \| 46.9 \| \| Elevated serum bilirubin (%) \| 4.2 \| 18.8 \| doi:10.1371/journal.pntd.0002626.t004 Sequelae Of the 32 confirmed cases, seven (21.9%) had acute renal failure as confirmed by serum creatinine >1.5 mmol/L; two had ultrasound evidence of acute renal parenchymal disease. In addition, 17 (53.1%) cases had elevated blood urea (>40 mg/dL). Elevated liver enzymes (SGPT/SGOT) were observed in 15 (46.9%) and serum bilirubin >2 was recorded for 6 cases. Of five (15.6%) patients with myocarditis, four had ECG changes and two were confirmed by echocardiogram; three of them required isotropic drugs and two required positive pressure ventilation. There were no fatalities. Laboratory findings of confirmed cases Leukocytosis of more than 11,000/mL was observed in nine (28.1%) cases, and in six (18.8%), leukopenia of less than 4000/mL was observed. All confirmed cases had a normal neutrophil count. Thrombocytopenia (<150,000/μL) was observed in 25 (78.1%) patients during the course of illness; in five (15.6%), platelet count was less than 20,000/μL. Discussion In this study we demonstrate important principles of a combined public health and clinical approach to the identification and management of a difficult-to-diagnose neglected tropical disease in a resource-poor setting. A large outbreak of leptospirosis occurred in 2010 in the district of Anuradhapura, Sri Lanka, a notably dry zone of Sri Lanka where an unusually rain-associated flooding preceded the outbreak. The context of this outbreak differed from the vast experience of leptospirosis in Sri Lanka that occurs in wet zones associated with paddy farming, impeded clinical diagnosis and public health intervention. In the two and half months period extending from third week of February 2011, because of our previous experience and molecular diagnostic infrastructure development, we confirmed 32 of 96 (33.3%) clinically suspected cases using a previously published qPCR assay, which demonstrated that bacteria load in patients ranged from $10^7$ to $10^{11}$ Leptospira/mL. This outbreak, the first reported in this so-called dry zone in Sri Lanka, was characterized by atypical clinical and biological features of leptospirosis. In contrast to previous outbreak reports, we found that most cases in the 2011 outbreak in Anuradhapura were caused by strains belonging to L. kirschneri, not previously known to be a common cause of human leptospirosis in Sri Lanka. Acute renal failure and myocarditis were common in the study population and the proportion of patients with complications was higher than the previous outbreak (Table 4). Renal failure and myocarditis were confirmed among 21.9% and 15.6% cases compared to 14.8% and 7.1% in 2008 outbreak. In addition, 53.1% of the patient had high blood urea nitrogen showing higher rate of acute kidney injury. In our previous studies using nearly identical study protocols including the laboratory tests to confirm leptospirosis [3], the observations regarding infecting Leptospira species and serovars were different from the present study. Previous outbreak reports from Kandy, Matale and Kegalle show L. interrogans to be responsible for the vast majority of human leptospirosis in Sri Lanka [4,5,9]. Although, L. interrogans has historically been the pre-eminent cause of human leptospirosis in Sri Lanka [10,11,12], isolates of L. borgpeterseni serovar Ceylonica were reported in 1964 [13] and L. kirschneri serovar Ratnapura was isolated in 1966 from a patient and subsequently from buffalo and cattle [11]. L. kirschneri has not been a reported cause of human leptospirosis in Sri Lanka since these original reports in the 1960s. However, because of its location in the dry zone, no recent studies have included the district of Anuradhapura. No studies are also available from this region to show the presence of leptospirosis disease or Leptospira species/serovars affecting livestock or other animals in the region. Severe complications were more common in the current study than reported previously. During the 2008 outbreak investigation thrombocytopenia and leukopenia were uncommon. Acute renal failure was observed in only 14.8% of the confirmed cases and myocarditis was seen in 7.1%. In the present study, ARF was noted and also more than 50% of the confirmed cases had renal function impairment. Liver failure was not observed, but more than 50% of confirmed cases had elevated liver enzymes. In the previous report range of bacterial load was up to $10^8$/mL, that was much higher than the present study. Whether these differences are due to strain or host factors is unknown. But, is noteworthy that while L. interrogans was the confirmed cause of 27/29 infections in the 2008 outbreak, the majority of cases reported here were caused by L. kirschneri. However, in the 2008 outbreak report, inclusion criteria were slightly less stringent resulting in the inclusion of a higher proportion of mild to moderate cases [5]. Thus, the rates of severe complications reported here might be partially due to the particular selection bias. One another concern about these marked variation in Leptospira strain and the clinical disease is whether this is due to microgeographical variations. It has been shown for other disease like malaria [14,15] and schistosomiasis [16,17,18] that microgeography may have a major influence of disease epidemiology. Geochemistry is well described as a major contributory factor in human health [19]. The previous reports are from the central, hilly, wet zones of the country, which is only around 100 km away from the present study site. However, the microgeography of these two areas are different in relation to elevation, rainfall, temperature, soil structure, crop and the ecology. Despite the extensive literature available on leptospirosis, studies on the microgeographic variation of Leptospira is scarce. We recommend further studies on this aspect based on our preliminary findings, which would be useful in disease control and prevention strategies. This study shows that the unusual clinical features observed during the 2011 leptospirosis outbreak in Sri Lanka could be due to uncommon L. kirschneri strains that arose in the context of dry rather than wet season epidemiology and perhaps due to changing human-animal interactions or introduction of novel Leptospira to the region. Whether these differences are due microgeographical variations of Leptospira strains or due to changing populations of reservoir animals necessitates further investigation. Supporting Information Checklist S1 STROBE checklist. (DOC) Author Contributions Conceived and designed the experiments: SBA NJD. Performed the experiments: NJD AKB MP SP PW. Analyzed the data: SBA MAM JMV. Contributed reagents/materials/analysis tools: JMV. Wrote the paper: SBA MAM JMV. Screened, basic investigations were carried out and clinical management of the of the patients were done: AKB MP. Interpretation of clinical finding together with investigations and classified the outcomes: PW. References 1. Agarwal S, Petocek SJ, Thevarman V (2009) The potential emergence of leptospirosis in Sri Lanka. Lancet Infect Dis 9: 521–526. 2. Ministry of disaster management (2011) Heavy rain and flood damages 2011. Colombo. Available: http://www.disastermin.gov.lk/web/index.php?option=com_content&view=article&id=97%3Aheavy-rain-and-flood-damages-10012011&catid=52%3Apress-release&Itemid=66&lang=en. 3. Epidemiological Unit (2011) RE: Controlling and preventing the current Leptospirosis outbreak following floods and heavy rains. Colombo: Epidemiology unit of Sri Lanka. 4. Agarwal S, Maniatis MA, Moreno C, Vineiz JM (2012) Utility of Quantitative Polymerase Chain Reaction in Leprosy: Correlation Analysis of Level of Leptospiraemia and Clinical Manifestations in Sri Lanka. Clin Infect Dis 54: 1419–55. 5. Agarwal S, Petocek SJ, Thevarman V, Nuwgeda DB, Smythe L, et al. (2011) Leprosyiosis outbreak in Sri Lanka in 2008; lessons for assessing the global burden of disease. Am J Trop Med Hyg 85: 471–478. 6. Epidemiological Unit (2005) Leprosyiosis. Surveillance Case Definitions for Notifiable Diseases in Sri Lanka. Colombo: Epidemiology Unit, Ministry of Health, pp. 19–20. 7. Thaipadungsapni J, Wuthikannu V, Chirazak W, Smythe LD, Perkanchanapong W, et al. (2007) A Dominant Clone of Leptospira interrogans Associated with an Outbreak of Human Leprosyiosis in Thailand. PLoS Negl Trop Dis 1(1): e100. 8. Ganoza CA, Mathias MA, Collins-Richards D, Brouwer KC, Cunningham CB, et al. (2006) Determining risk for severe leptospirosis by molecular analysis of environmental surface waters for pathogenic Leptospira. PLoS Med 3(8): e208. 9. Kotzam N, Ganage CD, Mino M, Kalawana SA, Redagoda BD, et al. (2009) Serological and genetic analysis of leptospirosis in patients with acute febrile illness in kandy, sri lanka. Jpn J Infect Dis 62: 474–473. 10. Niyamanda K (1962) Isolation of Leptospira in Ceylon. Ceylon Med J 17: 95–96. 11. Rajamanda K (1969) Leptospirosis in Ceylon - Epidemiological and laboratory investigation. Colombo: Medical Research Institute. 12. Rajasinha K, Somasaram M, Nagaratnam N (1959) Leptospirosis in Ceylon. J Trop Med Hyg 62: 205–216. 13. Niyamanda K, Sadler CR (1962) A new leptospiral serotype in the Javanica serogroup from Ceylon. Trop Geogr Med 21: 207–209. 14. Myers WP, Myers AP, Cox-Singh J, Lau HC, Moktan M, et al. (2009) Microgeographic variation in falciparum malaria infection in Malaysia. PLoS 10: 27. 15. Weldeberhan JA, Newell JD, Snow RW, Mung’ala V, Marsh K, et al. (1998) An analysis of the geographical distribution of severe malaria in children in Kilifi District, Kenya. Int J Epidemiol 27: 323–329. 16. Hamel MJ, Asiedu AK, Diu-Agbodji M, Adeleke MA, Mohiti MA, et al. (2011) Microgeographical patterns of schistosomiasis and anthropogenic indices of children in ekowe-ende south west, nigeria. Int J Environ Res 2: 636–650. 17. Khos H, Gazarek GA, Van Zandt P (1986) Microgeographical patterns of schistosomiasis and water use behavior: examples from Africa and Brazil. Mem Inst Oswaldo Cruz 93 Suppl 1: 37–50. 18. Baliraine FN, Afrane YA, Anonya DA, Bonneton M, Moore DM, et al. (2009) High prevalence of leprosy and Mycobacterium tuberculosis infections in a highland area of western Kenya: a cohort study. J Infect Dis 200: 667–73. 19. Dissanayake CB, Chandrasekiri R (1999) Medical geochemistry of tropical environments. Earth-Science Reviews 47: 219–258.	<urn:uuid:90b5250d-49cf-442c-9d6b-5e74d375d5d1>	CC-MAIN-2017-22	http://journals.plos.org/plosntds/article/file?id=10.1371/journal.pntd.0002626&type=printable	2017-05-27T21:16:41Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463609061.61/warc/CC-MAIN-20170527210417-20170527230417-00509.warc.gz	266,387,265	8,075	eng_Latn	eng_Latn	0.952379	eng_Latn	0.987389	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 6670, 8225, 14059, 14508, 14816, 20359, 27021, 32323 ]
March 18, 2020 Oki Parents/Guardians: On March 16, 2020, Blood Tribe Chief and Council declared a State of Emergency. As a result, only essential services provided by Blood Tribe Administration Departments and Entities will remain open. Effective March 19 to April 2, 2020, all Kainai Board of Education schools and district office will be closed. This is a difficult decision, however, we must do our part to respond appropriately to this extraordinary and rapidly evolving public health situation. Only essential employees (finance, cafeteria staff, transportation drivers, operations and maintenance and superintendents) will report to work on a modified working schedule. The remaining Kainai Board of Education staff will be working from home. Student and staff safety remains the top priority for Kainai Board of Education. We are taking this step as a precautionary measure and with the best interests of our students and staff in mind. Schools will contact parents/guardians as to when students personal belongings can be picked up. Kainai Board of Education will take this time to clean, sanitize and disinfect all our schools and district office. We will continue to keep parents/guardians informed as information is provided to Kainai Board of Education. Sincerely, Cam Shade Superintendent of Schools Kainai Board of Education	<urn:uuid:d0088c91-6dc3-4562-962d-60c3a84e8b8a>	CC-MAIN-2020-16	https://kainaied.ca/UserFiles/Servers/Server_687160/File/KBE%20Temporarily%20Two%20Week%20School%20Closure.pdf	2020-03-28T15:00:22+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-16/subset=warc/part-00011-5e0433ee-fa15-4837-b2dc-d6f38301af97.c000.gz.parquet	565,567,394	276	eng_Latn	eng_Latn	0.996066	eng_Latn	0.996066	[ "eng_Latn" ]	false	docling	[ 1348 ]
Successful Experiences in Chemistry Teaching in Bulgaria: Role of Interactive Teaching Materials in Teaching/Learning Process Milena Koleva Technical University of Gabrovo Gabrovo, Bulgaria [email protected] Abstract The paper presents successful experience and good pedagogic practices in teaching chemistry at Bulgarian secondary schools in the context of the European educational policy for development of key competences for the young people. Basic strategies, approaches, new teaching methods and technologies as problembased approach, experimental work, project-based activities and other are discussed as effective way to improve the students' scientific literacy and their motivation to study chemistry. Good practices in Implementation of information and communication technologies in educational process using multimedia presentation, videolessons, and interactive materials are described. The paper pays special attention to the role of Chemistry is all around Network Project, including networking activity and testing of interactive teaching resources, in sharing of successful experience and practice in Chemistry teaching at school. 1. Key competences and their development in chemistry education The term "key competence" is cearly defined in Key Competences for Lifelong Learning - European Reference Framework as "combination of knowledge, skills and attitudes appropriate to the context" [1]. Key competences in the form of knowledge, skills and attitudes appropriate to each context are fundamental for each individual in a knowledge-based society. Key competences should be acquired by young people at the end of their compulsory education and training, preparing them for adult life, particularly for working life, whilst forming a basis for further learning. The framework defines eight key competences and describes the essential knowledge, skills and attitudes related to each of them [2]. Competence in science refers to the ability and willingness to use the body of knowledge and methodology employed to explain the natural world, in order to identify questions and to draw evidence-based conclusions. Competence in technology is viewed as the application of that knowledge and methodology in response to perceived human desires or needs. Competence in science and technology involves an understanding of the changes caused by human activity and responsibility of individuals. Essential knowledge for science and technology comprises the basic principles of the natural world, fundamental scientific concepts, principles and methods, technology and technological products and processes, as well as an understanding of the impact of science and technology on the natural world. These competences should enable individuals to better understand the advances, limitations and risks of scientific theories, applications and technolog y in societies at large (in relation to decision-making, values, moral questions, culture, etc.". Skills include the ability to use and handle technological tools and machines as well as scientific data, to achieve a goal or to reach an evidence-based decision or conclusion. Individuals should also be able to recognise the essential features of scientific inquiry and have the ability to communicate the conclusions and reasoning that led to them. Attitudes related to this competence are critical appreciation and curiosity, an interest in ethical issues and respect for both safety and sustainability, in particular as regards scientific and technological progress in relation to oneself, family, community and global issues [2]. Modern education defines few basic strategies and instruments for development of key competences in natural sciences including chemistry: context-based real-life problems; project-based learning; hands-on activities; inquiry-based learning; extracurricular activities – competitions, olimpiads, club activity etc. Approaches for development of key competences in Chemistry regarding to its experimental nature could be found in: - work with natural objects - observations, assumptions, searching for proofs, conclusions); - transfer of information from graphic to verbal phorm and vice versa; - search, selection and presentation of information on certain topic; - work with graphs, charts, diagrams - application of knowledge on unknown objects (i.e., physical and chemical knowledge on biological objects); - formation of communication skills to present and solve problems; - comprehension of text (abilities to comprehend and use written text and ability to use characters for practical purposes, the so called functional literacy); - calculation of values of unknown parameters in a formula; - device measurements (precise measurement, proper recording of results, incl. units) - construction of experimental setup, closely following the instructions, resourcefullness and dexterity. Development of key competence in chemistry is part of a common process of cultivation of natural science literacy among students, which is the basic aim of science education during the obligatory school stage. International studies and assessements as Trends in International Mathematics and Science Study (TIMSS), the Progress in International Reading Literacy Study (PIRLS) and Programme for International Student Assessment (PISA) allowed the identification of the most important factors responsible for the good achievements in school science education. Based on the experience of European countries with best achievements, following factors could be defined: teacher's high social status; good school athmosphere; the science education is directed toward formation of key competences; enough number of classes especially for chemistry; the stress of school education in Chemistry, Biology and Physics is put on experimental work and development of practical skills [3]. 2. Successful experience in Chemistry teaching in Bulgaria and ways for its popularization Good Bulgarian practice in teaqching Chemistry at school. There are many examples of good teaching practice used in Bulgarian schools for development of key competences in chemistry in the context of the strategies defined above. Solving real scientific problems is an approach which helps teacher to overcome students' low motivation and to attract their interest in natural sciences. According to chemistry teachers, ignoring the scientific research approach in natural sciences leads to rote memorization without any possibility of application in everyday life [4]. The ambition of institutions responsible for the school chemistry education is to apply this approache not only on school but on national level also – for example, the National contest for key comepences in natural sciences [4], the model of problem-based learning in teaching chemistry at school developed in Comprehensive High School – Mirkovo [5], the model for building of specific competence on chemistry and environmental protection created and experimented by teachers in National Highschool of Science „Academic Lyubomir Chakalov" – Sofia [6] etc. Experimental work is an approach which is very highly appreciated by chemistry teachers - combined with the problem-based learning, experimental work gives very good opportunities for solving of experimentallylogical problems with research character, which leads to more lasting knowledge and skills of students. That is proved by the result from experimental testing of a pedagogical model, developed and implemented in chemistry laboratory exercises for work with substances in 9 th grade of Comprehensive High School "P. Beron" - Pernik [7]. Extracurricular training in chemistry in various forms - club activities, school projects, and others - is an effective way to extend students' knowledge and to develop deeper interest in natural sciences. The practice of school projects is well developed in Aprlinov National Highschool – Gabrovo [8]. As a form of partnership between schools with different profiles and level of chemistry learning, it was applied in chemistry and biology training process at Vocational High School of Electronics and American College Arcus - V. Tarnovo. 2 Such an interschool collaboration allows the integration of students into a new school environment but also gives the opportunity to students from schools with insufficient or no laboratory base (which are most of the schools in Bulgaria), to participate in experimental work in chemistry which increases student's interest in the subject [9]. An example of successful experience in Chemistry club activity was presented during the International Conference on Training Issues of Chemistry Teachers (2013, Gabrovo) by chemistry teachers from Vocational High School of Mechanical and Electrical Engineering – Sevlievo [10]. Enriching the learning content with scientific achievements - there are a number of ways to implement the science in the educational content, to make knowledge practically oriented and the way of its presentation more attractive. A very successful practice has been developed over the last few years in Private American College in Sofia. It is performed as "live scientific show" combining science and art in teaching of complicated chemical issues [11]. The most successful practice in implementation of science in chemistry school education was developed through the "university – business" collaboration, and was successfully applied at school – it is a common initiative of BASF (Bulgaria) and the Faculty of chemistry and pharmacy of Sofia University called "Portable chemistry laboratory for students Chemgeneration Lab". The laboratory travels to schools in Sofia and the country where under the guidance of the hosts - outstanding students of the Faculty of chemistry and pharmacy, students are able to make some experiments, corresponding to the school educational content [12]. Implementation of contemporary ICT in the learning process is an approach used by Bulgarian teachers in their efforts to restore the students' interest toward natural sciences and chemistry at every stage of their training by number of teaching instruments - application of multimedia products and interactive materials for visualization of specific problems of curriculum content in chemistry [13-15]; development of interactive materials by teachers, using their own skills in ICT sphere [16]; e-learning, self-education and self-control [17]; efficient control over knowledge absorption. Popularization of good teaching practice. Development of competency and natural science literacy is a long process in which teachers play the main role - they have to provide conditions for its effective implementation through innovative approaches. Teacher training and permanent development of new skills are key factors for the successful performance of this role. Sharing of good practices and successful teaching experience is a way to help teachers in their activity and happens with the joint efforts of state institutions, universities involved in teachers training, business and other (mostly private) organizations. As state institution in charge with the organization and implementation of the educational process at national level Ministry of education and science (MES) works on the research and popularization of the good teaching practices in all spheres of education, including science – by national forums, journal, specialized printed editions, websites. The most significant forum for exchange of professional experience and good teaching practices in chemistry education in Bulgaria is the National Conference of Chemistry Teachers, which takes place every two years thanks to the joint efforts of MES, Sofia university „St. Kliment Ohridski" and the Union of Chemists in Bulgaria - apart from chemistry teachers from across the country, it involves university professors and experts from institutions in charge with the national policy on science and chemistry education. The Ministry publishes the only national weekly newspaper on education and science "Az Buki" [18] and nine science journals - each of them presents successful educational practice, including in chemistry education: Chemistry: Bulgarian journal of science education [19]; Еducational Journal "Strategies of the Educational and Scientific Policy" [20]; Еducational Journal "Pedagogy" [21] etc. Last year the Ministry published Digest with good practices for interactive education [22], which summarizes teachers best practices in interactive teaching, as a result from workshops organized in Bulgarian schools under the motto „School – student's desired territory". As a step to implement the e-learning as educational practice in Bulgarian schools MES developed National education portal [23] – it is an important web-based form offering platform for sharing successful teaching experience. Bulgarian universities, providing education of chemistry teachers offer also ways to exchange pedagogical experience organizing university, national or international scientific forums and conferences. Opportunity for exchange of successful experience and good practice in teaching chemistry at school is Autumnal scientificeducational forum, organized by the Department for information and teachers' qualification of Sofia University. Papers presented during the forum are full length online accessible by electronic journal „Lifelong education", published on the Department's Portal [24]. MICROSOFT Bulgaria supports National network of innovative teachers (or Teacher.bg) - the portal aims to improve the teachers' qualification and skill in implementation of ICTs in educational process and also to share the best examples of teaching practice in their applicaton at school [25]. The role of Chemistry is all around Network Project. Popularization of successful teaching experience and practices is a way to help the chemistry teachers in their efforts and contributes to restore the students' motivation to study Chemistry. In this sense Chemistry Network Project plays important role because trough the project network it helps established pedagogical experience and good practice to be shared with chemistry teachers from large number of schools within European countries. The whole networking activity during the last project year was dedicated to this thematic area. Workshop on Successful experience and good practice in teaching chemistry at school within the national network allowed teachers and experts to discuss innovative approaches and good practice in chemistry teaching in the other European countries and the possible application in the Bulgarian school system. Beside the workshops on national level and the international virtual meetings, there are also opportunities for exchange of successful experience and good practice provided by international conferences within the activities of the project International Conference on Training Issues of Chemistry Teachers (Bulgaria) and International Conference on Successful Experiences and Good Practices in Chemistry Education (Portugal) where successful experience in application of ICTs based products in chemistry classes at Bulgarian secondary schools was presented [26-28]. 3. Role of interactive materials and ICT in Chemistry teaching/learning process: what the experiment says? One of the main questions which educational specialists face at all levels is whether the application of ICT can change the quality of teaching in the particular learning environment of Bulgarian secondary schools. In response to this question experimental testing of interactive teaching materials based on ICTs, as a part of Chemistry Network Project activities, was performed in the chemistry classes in Bulgarian secondary schools. The strategy of experimental testing was discussed with chemistry teachers and experts involved in the project activities. The materials to be tested were carefully identified by chemistry teachers on the basis of clear defined criteria like school profile, level of students' knowledge, available technical equipment. Following factors limited the choice of teaching resources for testing in chemical classes: language of the teaching resource; level of students' basic knowledge; lack of laboratory equipment; lack of computers and other supporting technical equipment; level of teacher's competence to use ICTs. Students' opinion about the effect of tested resources on the way of understanding of learning content, and teachers' conclusions about their applicability in the chemistry training at Bulgarian school were studied at the end of the testing process. Nine interactive teaching resources have been chosen to be experimentally tested in the real Chemistry teaching/learning process at 6 schools involved in the project activities – among them 5 project partner schools and 1 associated school. The testing procedure was performed by 11 chemistry teachers - 9 from the partner schools and 2 from the associated school. 175 students 8 – 10 th grade from Bulgarian secondary school attended the testing: 162 in regular chemistry classes and 13 in research club activity. Resource "The world of chemistry (Carbon)" [29] was tested at Aprilov National High School – Gabrovo with 24 students, 10 th grade, specialized English language education. Teachers find the reasons to choose the resource in the easy and understandable way to present basic knowledge, and special effects and animations enable simulation of processes, dangerous for real lab visualization. Learning topics were to show the chemistry in the real life and thus, to rise the students motivation. Students find the material interesting, easy to understand and efficient - it stimulates the curiosity to the world around, to the meaning of chemical knowledge in everyday life and to forming of proper attitude towards health care and environmental protection. Teacher's conclusions is that the use of material influenced positively the chemistry education - the topic is directly linked to applications, including industrial and environmental problems announced through opinions of representatives of academic and industrial sphere. The resource also offers efficient approach to mastering chemistry knowledge through improving of English language. Resource "Explore & Discover Chemistry!" [12] was tested at two secondary schools: Vocational High School of Electronics – V. Tarnovo, with 18 students, 9 th grade, education in ICTs and Private Specialized High School "American Arcus College" – V. Tarnovo, with the participation of 18 students, 9 th grade. The resource has been choosen because it enlarges the students' basic knowledge, allows integration of science in educational content and visualization of 3-dimensional structures, and combines learning with entertainment. The experimental testing aimed at enhancing students' motivation by presenting advances in science and technologies, at developing notion about environmental sustainability. The results obtained by the students' questionnaires show that students like the idea of team working with students from other schools. Concerning the resource's content the most liked are electronically presented animated models. Teacher's conclusion is that the resource ensures utilization and interpretation of educational content by stimulating the student's cognitive activity. It provides the student with motivation and willingness to learn. The resource is easily accessible and promotes students' self study also. Two interactive teaching resources - "PhET" [30] and "National Education Portal" [31] - were tested at Vocational High School of Electronics and Chemical Technologies – Pleven, with 28 students, 9 th grade, specialised education in Chemical Products and Technologies. Topics related to the first resource were: Chemical equations balancing; Isotopes and atomic mass; Atom and molecule structure. Use of e-lessons in chemistry classes – theory and practice was the learning topic related to the second one. Reasons to choose the teaching resources were: educational content is suitable for both theoretical and practical classes; possibility to visualize chemical processes with simulations. In addition to that "PhET" allows presentation the content in amusing and understandable way, and "National Education Portal" is in Bulgarian language. Following learning topics have been defined during the "PhET" testing: generation of simple atom models; visualization of chemical bonds; development of stereo-imagines about molecule structure. Students tested with great enthusiasm the simulations – they enjoyed learning chemistry by using computers. Teacher's conclusion about the tested interactive simulations is very positive: they are easy to use and of a good scientific value; through them, the teacher can receive feedback, whether the learning content is absorbed; when used appropriately by the teacher, they can increase students' interest in studying the subject; through these simulations, by having fun the students can demonstrate and apply what they have learned; they are very suitable in lessons for exercise and summary, as well as new knowledge with difficult theoretical concepts, which are presented through them in a very accessible and understandable way /e.g. atomic structure, chemical bonds, etc/. Another interactive resource based on the National Education Portal (Alkanes) [32] was tested at Vocational High School of Electronics – V. Tarnovo. Eighteen students 9 th grade, specialized education in ICTs attended the experimental classes. According to the chemistry teacher the resource covers a great part of educational content relating to alkanes, visualizes the bonding between carbon atoms and allows visualization of burning process – that is why the teaching resource has been chosen. The experimental lesson aimed at developing knowledge about alkanes and helping students in analyzing of chemical properties through chemical experiment. The evaluation of testing results shows that students' reaction has been definitely positive - they like the diversified lesson in different learning environment like computer lab. Most of them have recognized the role of self-study and self-examination of knowledge in the course of the lesson. Students' attention has been strongly attracted by the demonstrations watched also. Teacher's conclusions about the tested resource are also positive - it increases student's skills for visualization of content and understanding of concepts, helps to develop self-study skills for the designation of a given formula, to draw patterns in chemical formulas, to associate properties with application, to transfer acquired knowledge and skills in a new unfamiliar situation. Two interactive teaching resources were tested at Vocational High School of Electrotechnic "M. V. Lomonosov" – G. Oriahovitza: Virtual chemical laboratory [33] and A Química das coisas [34] with the participation of 48 students, 10 th grade, specialized education in System engineering. Teachers involved in the testing have a long pedagogical practice in teaching chemistry. The Virtual chemical laboratory is a resource developed in Bulgarian so it allows easy working and has education content developed according to the requirements of MES. Tested topics, related to the resource were "Sulphuric acid" (Chemistry content for 8 th to 10 th grade) and "Compounds of aluminium". Experimental learning aimed at developing of skills for performing of chemical experiment and working with scientific resources and handbooks. Students liked working with the product - most of them have used the website after the school classes, at home also. They have been interested in mastering new knowledge in chemistry.Teacher's opinion is that the resource is very well structured - it offers a wide range of options for the organisation or the teaching process by presenting the learning content in various methodological units. The teacher has also observed that the activity and interest of students increases when they find themselves in a position to take independent decisions and apply them in solving scientific problem. Experimental testing of A Química das coisas (Chemistry of things) tried to give students scientific answer about some chemical processes related to human health: why ethyl alcohol is protoplasmic poison and what happens with ethanol inside human body; is ethyl alcohol food, how does it affect the human body. Reasons to choose the teaching resource were the rich education content and availability of equipment for implementation of the resource in the learning process. Students liked the work with the resource because beside the educational effect it has emotional effect, too. The teacher finds the resource useful because it allows: systematization and summary of the matter, expanding and improving knowledge; individual learning of something new in relation to the lessons learned in class and aspiration to clarify more thoroughly the studied phenomenon; use of knowledge, skills and habits obtained during the lesson in other situations. Chemistry teachers from Vocational High School of Mechanical and Electrical Engineering – Sevlievo experimentally tested two interactive resources: Chemistry Online [35] and Learn Chemistry [36]. Two groups of students attended the testing: 26 students, 9 th grade, specialized education in Computer Engineering, taking an intensive English language course; 13 students, 8-10 th grade, members of „Research laboratory"club. Testing of Chemistry Online (Trends in the Periodic Table) aimed at enlarging students' knowledge about the chemical elements. Students like the resource as all the notions and relations which they consider difficult and abstract are explained in an interesting and user friendly way. The lesson helped them to understand the relations in the periodic system and they are willing to use it in other chemistry lessons. Teacher's opinion is that the resource conveys great amount of information and facilitates the study of the theory for the atomic construction and the chemical elements. The combination of videos, pictures, experiments and interesting facts about the substances make the resource interesting for students. But they also realize that in spite of its advantages, the resource has been successfully applied in the real training owing to the students' linguistic and computer skills also, as well as to the modern labs at school. "Interactive Periodic Table" and "Chemical elements (metals and non-metals)" were topics related to Learn Chemistry tested with a mixed group of students 8-10 th grade, invovled in club activity. Learning topics have been defined by chemistry teacher to be developing of skills in formula writing and determination of chemical bonds. Although different level of chemistry knowledge is a limitimg factor, results obtained by the experimental testing are more than positive. Students like the website having special preferences to videos, simulations and experiments - according to them, these materials increase the interest in chemistry, contain synthesized and interesting information and facilitate the study of lessons. Experiments produced largest discussions among students during the training process – they consider experimental work interesting as it contributes to the exploring of the real world. According to the teacher's opinion the website is very attractive and very well structured - it offers a wide range of materials and enables teachers to share and exchange ideas and materials. It contributes not only to the development of competences in natural sciences but also the ones of digital and linguistic skills. The resource application could be only limited by the need of good command in English. In summary, the reaction of the students involved in the teaching resources testing could be defined as very positive. They were "interested in mastering new knowledge", "enjoyed learning chemistry by using computers, electronically presented animated models, simulations", videos. According to them, these materials increase the interest in chemistry, contain synthesized and interesting information and facilitate the study of lessons. Students consider chemical experiments as the most interesting because they contribute to the exploring of the real world. Using these teaching resources, many of them recognize the role of selfstudy and self-examination of knowledge in the course of the lesson. Based on the summarized teachers' considerations, few important points should be marked: - Use of interactive teaching resources has a positive influence on implementation of objectives of chemistry education. ICTs based educational products ensure utilization and interpretation of educational content by stimulating student's cognitive activity and provide with motivation and willingness to learn; - Many of the resources help students to develop self-study skills for the designation of a given formula, to draw patterns in chemical formulas, to associate properties with application, to transfer acquired knowledge and skills in a new unfamiliar situation etc.; - The combination of videos, pictures, experiments and interesting facts about the substances and processes make the resources interesting for students. - Without ignoring the role of the real experiment, based on the testing results, chemistry teachers appreciate also the place of the simulations in the training process: * Interactive simulations are easy to use and of a good scientific value; * Through them, the teacher can receive feedback, whether the learning content is absorbed. * When used appropriately by the teacher, they can increase students' interest in studying the subject. * Through these simulations, by having fun the students can demonstrate and apply what they have learned; * They are very suitable in lessons for exercise and summary, as well as new knowledge with difficult theoretical concepts, which through them are presented in a very accessible and understandable way Besides of the quality of the experimentally tested interactive teaching resources, their successful implementation in the real educational process depends in large degree on the students' linguistic and computer skills, teacher's ICTs skills as well as on the modern equipment at the school. 4. Conclusions Achievement of scientific literacy and development of key competences of students become one of the main objectives in natural sciences and particularly Chemistry training in Bulgarian school education. This is a product of a long process whose quality and final results are influenced by factors as quality of educational plans and programs in terms of their volume and content, modern and adequate technical support, implementation of ICTs in educational process. Crucial for the successful implementation of this objective is the leading role of teachers and their skills to present the educational content in attractive and understandable way, to involve students as active participants in the educational process, to develop their scientific and innovative thinking, and ability for team working. To perform this role Bulgarian chemistry teachers apply innovative approaches as problem-based approach (solving of context-based real-life problems), experimental work (hands-on activities), projectbased and inquiry-based learning. To make these approaches effective and to improve the quality of Chemistry education, teachers implement ICTs in school educational practice – multimedia, interactive teaching materials, e-learning etc. – to make the complicated chemical content more understandable, to stimulate students' activity and to direct their interest toward chemical science. The utility of interactive ICTs based teaching materials was prooved by the results obtained during the experimental testing of selected by the chemistry teachers resources in the real process at Bulgarian secondary schools. The common opinion both of chemistry teachers and students, attended the testing is that the implementation of ICTs in Chemistry education and use of interactive teaching resources facilitates students in understanding of complicated educational content, helps chemistry teachers in their pedagogic activity and contributes to restore the students' motivation to study Chemistry. 7 5. Bibliography and References [1] http://www.EQF_bg.pdf [2] http://europa.eu/legislation_summaries/education_training_youth/lifelong_learning/c11090_en.htm [3] Tafrova, A. Contemporary trends in pupils' Science education, Bulgarian Journal of Science and Education Policy (BJSEP), Volume 7, Number 1, 2013, pp 121 – 200. [4] Kirova, M., E. Boyadjieva, V. Ivanova. Active and interactive learning in „Chemistry and environment" school subject 7 th and 8 th grades, Pedagod 6, Sofia, 2011. [5] Tzvetkov, Vl., E. Boiadjieva. Application of the problem-based approach in chemistry classes. Proceedings of International Conference on training issues of Chemistry teachers, 26th of June 2013, Gabrovo, Bulgaria [6] Dyankova, N. Education-cognitive tasks for implementation of key competences approach in Chemistry and environmental protection classes in 10 th grade. Lifelong education (e-jurnal of Department of information and teachers qualification, Sofia University), N 29, 2012 (in Bulgarian). [7] Ganeva,M. Practically oriented experimentally-logical problems in chemistry laboratory exercises in 9th grade. Lifelong education (e-journal of Department of information and teachers qualification, Sofia University), special edition, 2012, pp 505 – 515, (in Bulgarian) [8] Nikolova, M. Setting up a scientific school project as a method of increasing students' motivation for studying natural sciences and ecology. Proceedings of International Conference on Innovative Learning in Chemistry, December'2012, Prague, Czech Republic. [9] Kirova, G. and J. Staykova, "Earth belongs to all of us" – an interschool project on the impact of mineral fertilizers. Proceedings of International Conference on Training Issues of Chemistry teachers, 26th of June 2013, Gabrovo, Bulgaria. [10] Tomeva, К. Club activities as a pedagogical approach to increase interest in science. Proceedings of International Conference on Training Issues of Chemistry teachers, 26th of June 2013, Gabrovo, Bulgaria [11] International Conference on Training Issues of Chemistry Teachers (TICT) [12] http://chemgeneration.com/bg/ [13] Kirova, M. Interactive multimedia as an instrument for presentation of Chemistry educational content. Proceedings of International Conference on E- learning and distance education, April, Sofia, 2011, pp 288-295 (in Bulgarian). [14] www.ucha.se [15] Hikolova, M., D. Madjarov. Online video lessons on the platform "Ucha.se" (http://ucha.se/) – innovative approach for high quality education in Chemistry, Proceedings of International Conference on Training Issues of Chemistry teachers, 26th of June 2013, Gabrovo, Bulgaria [16] Chekanova, D. Electronic handbook application model at the initial review on chemistry and environmental protection in 8th grade, Lifelong education (e-jurnal of Department of information and teachers qualification, Sofia University), N 25, 2011 (in Bulgarian). [17] Pangalova, V.Chemistry and environmental protection e-learning in 9th grade. Continuous education (ejurnal of Department of information and teachers qualification, Sofia University), N 21, 2011 (in Bulgarian). [18] http://www.azbuki.bg/en/ [19] http://khimiya.org/scope.htm [20] http://www.azbuki.bg/en/editions/journals/strategies [21] http://www.azbuki.bg/en/editions/journals/pedagogics [22] http://www.minedu.government.bg/opencms/export/sites/mon/left_menu/projects/unesco/sbornik-dobripraktiki.pdf [23] http://start.e-edu.bg/ [24] http://www.diuu.bg/ispisanie [25] http://www.teacher.bg/ 518300-LLP-2011-IT-COMENIUS-CNW [26] Konstantinova, V. Contemporary Possibilities in the Chemistry Education for Building Positive Motivation and Strong Interest to Natural Sciences. Proceedings of International Conference on Suxessful Experiences and Good Practices in Chemistry Education, 21 st May 2014, Braganca (Portugal). [27] Tomeva, K. Approaches to Developing Key Competences in Natural Sciences. Proceedings of International Conference on Suxessful Experiences and Good Practices in Chemistry Education, 21 st May 2014, Braganca (Portugal). [28] Kirova, G., J. Staykova. Integrative Internet-Based Case Study for Sustainable Development. Proceedings of International Conference on Suxessful Experiences and Good Practices in Chemistry Education, 21 st May 2014, Braganca (Portugal). [29] http://www.learner.org/resources/ [30] http://phet.colorado.edu/en/simulations/category/chemistry [31] http://resursi.e-edu.bg/zmon/action [32] http://resursi.e-edu.bg/zmon/action/goToProgram?id=Prog9.908 [33] http://chemistry.dortikum.net [34] http://www.aquimicadascoisas.org/en/ [35] http://askthenerd.com/chemistryonline [36] www.rsc.org/learn-chemistry	<urn:uuid:1d1cbf6d-0129-4603-9142-38cf9f35daaa>	CC-MAIN-2025-05	https://chemistrynetwork.pixel-online.org/files/SUE_papers/genoa/BG/BG_Paper_ENG.pdf	2025-01-20T13:18:33+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-05/subset=warc/part-00230-88b30a59-3c73-48ba-a167-077611bfd245.c000.gz.parquet	157,735,312	6,838	eng_Latn	eng_Latn	0.906685	eng_Latn	0.993365	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3924, 8187, 13207, 17991, 23191, 28363, 32416, 35944, 37071 ]
APPRENTICESHIP AND CERTIFICATION BOARD MINUTES 100- 111 LOMBARD AVENUE JANUARY 06, 2016 BOARD MEMBERS Campbell, Anita Charron, Brent Ducharme, Steve Harris, Bruce Hajer, Jesse McInerney, Betty Miller, Harvey Munro, Colleen Senff, Bob Webb, Ken REGRETS Graveline, Natasha Lafond, Marc Keeper, Michael Siemens, Trent Wilson, James GUESTS Dunn, Scott Chornoby, Todd Public Interest Representative Employee Representative Employee Representative Employee Representative A/Secretary and Ex-Officio Member Employer Representative Employer Representative Employer Representative Public Interest Representative Employer Representative Apprentice Representative Employee Representative Employee Representative Employer Representative Chair Manitoba Hydro Manitoba Hydro STAFF Janes, Anne McPike, Kevin Peters, Janice A/Director, Certification Standards and Legislation A/Manager, Policy, Legislation and Board Operations Apprenticeship and Certification Board Co-ordinator 2016.01.01 OPENING 1. Call to Order The Chair called the meeting to order at 9:09 a.m. 2. Approval of Agenda Motion 2016.01.01 To accept the agenda as written. Moved by Marc Lafond Seconded by Brent Charron Carried. All in favour 9 in favour 0 opposed 0 abstained 3. Approval of past minutes deferred to the next scheduled Apprenticeship and Certification Board meeting. 2016.01.02 UPDATES: BOARD AND EXECUTIVE DIRECTOR 1. Chair's Update Bob Senff, the Apprenticeship and Certification Board (Board) Vice-Chair advised that there were no updates. Review of the Post Training Letter received from Hugh Goldie, facilitator, Exchange Group, deferred to the next Board meeting. 2. Executive Director's Update Jesse Hajer, the Acting Secretary and Ex-Officio Member, indicated that he has been meeting with stakeholders over the past two months to discuss industry concerns and issues. Apprenticeship Manitoba strives to be responsive and proactive in providing exceptional services to Manitobans. Apprenticeship Manitoba continues to improve the delivery of the apprenticeship system by making sure apprentices attend technical training on a timely basis, and ensure classes are not cancelled and continue to engage industry. Jesse also indicated his interest in bringing forward more policy issues to the Board for advice going forward. 3. Review of previous Board Meeting Evaluation Review of the October 21, 2015 meeting evaluation feedback deferred to the next scheduled Board meeting. 2016.01.03 COMMITTEE REPORTS 1. Nominating Standing Committee (NSC) No update. The next meeting is currently in the process of being scheduled. 2. Program Standards Standing Committee (PSSC) No update. The next meeting is currently in the process of being scheduled. 3. Community Liaison Standing Committee (CLSC) No update. The next meeting is currently in the process of being scheduled. 4. Governance Standing Committee (GSC) Strategic Plan: PAC Appointment Process & Review of Regulatory technical training process deferred to the next scheduled Board Meeting 2016.01.04 CONTINUING BUSINESS 1. Powerline Technician (PLT) The Board, Apprenticeship Manitoba (AM) and Manitoba Hydro have worked closely to finalize the Powerline Technician (PLT) Trade Regulation. The Board reviewed the draft regulation at its December 09, 2015 meeting and determined the PLT Trade Regulation would go to consultation. The Consultation Discussion Guide was circulated to industry on December 23, 2015 and closed on January 04, 2016. Five industry comments were received in response to the Consultation Discussion Guide. A number of industry stakeholders outside of Manitoba Hydro voiced broad support for designating PLT as a trade in Manitoba and the benefits that the apprenticeship and certification system will bring, including access to subsidized technical training and essential skills supports. One industry response raised safety concerns. A robust discussion regarding the industry comments ensued. Industry concerns were raised regarding the proposed PLT tasked-based 4:1 ratio and the potential safety issues. It was confirmed that the 4:1 ratios were implemented on limited, specialized tasks specific to Manitoba Hydro only. Employers and apprentices who are not employed with Manitoba Hydro (including contractors) must adhere to the Apprenticeship and Certification General Regulation (General Regulation) 1:1 ratio. Board members concluded that Manitoba Hydro demonstrated stringent guidelines and training models that reflect accountability on the 4:1 ratio. Manitoba Hydro representatives joined the meeting and provided a presentation on the current PLT program offered within Manitoba Hydro. The representatives indicated that the training is among the best training programs in Canada and widely recognized internationally. Training is currently offered in Stonewall Manitoba. A training facility is scheduled to open in Gillam, Manitoba. Board members questioned if a fourth year level apprentice can supervise apprentices in levels one, two and three. Manitoba Hydro advised that a fourth year Manitoba Hydro apprentice would have the opportunity to supervise the junior apprentices on entry level tasks, and only after the junior apprentices has demonstrated competency in the task under the supervision of a journeyperson. It was also confirmed by Manitoba Hydro that a journeyperson is always present to assist apprentices, especially during the fourth year level apprentices' mentorship training and that hazardous tasks are monitored at all times by qualified journeypersons. Manitoba Hydro expressed that maintaining the integrity and structure of their current training program is of paramount importance and their terms of their participation in a PLT apprenticeship program, including the process for the development of the regulation and the governance structure of the proposed trade. The Board noted that the value of a PLT Apprenticeship program would be significantly reduced without Manitoba Hydro's participation, as Manitoba Hydro employs the vast majority of workers in the industry. The Board also noted that Manitoba Hydro is currently the only training provider equipped and able to deliver the capital intensive technical training for PLT, and has also indicated that it is willing and supportive of discussions to include non-Hydro employees in technical training at its facilities. The majority of the Board supported the proposed regulation. Motion 2016.01.03 To approve-in-principle the proposed PLT trade regulation and approve translation into regulation certificates for final approval by the Board Chair and the Minister of Jobs and the Economy. Moved by Anita Campbell Seconded by Betty McInerney Carried. All in favour 5 in favour 1 opposed 2 abstained 2. Heavy Duty Equipment Technician (HDET) Trades Qualification Applications – CN Letter In September 2015, Canadian National Railroad (CN) submitted 11 Trade Qualification applications in the Trade of Heavy Duty Equipment Technician on behalf of their employees who were enrolled in a 13 week exam preparation course and had experience in the Diesel Engine Mechanic trade. Scope of trade assessments conducted by the Branch for each of the applicants revealed significant gaps in their on-the-job work experience. Apprenticeship Manitoba staff met with CN in December 2015 to discuss this issue and options for solution. The A/Secretary and Ex-Officio Member requested that the Board provide guidance regarding Apprenticeship Manitoba's response to CN's request. The following solutions are being proposed for consideration: o Approve CN's request in isolation and on this occasion only with the condition that certification examinations are sealed and not graded until candidates can demonstrate sufficient on-the-job experience. o Establish a branch policy prescribing the criteria and procedures for considering and approving cross trade credit for trades qualification candidates o Partner with CN to develop a training program that responds to CN's unique business model and meets on-the-job training criteria for trades qualification applicants required by the General Regulation. The Board discussed CN's request and established that it would not be fair to allow the applicants to write and seal the exam until the applicants could demonstrate the ability to meet the requisite on the job experience. In no other circumstances are exams sealed and kept from apprentices. Board members concluded that the applicants should not challenge the exam if the applicants have not met the hours and seventy percent scope of trade requirements. Board members expressed that the integrity of the Apprenticeship and Certification System must be maintained and industry standards upheld. The Board advised that AM should continue to work on establishing a policy and criteria for considering cross trade credits for trade qualification candidates. In addition, the Board supported partnership with CN to develop a training program that responds to CN's needs. In response to the branch's request for advice and guidance, the Board formalized its advice through the following non-binding motions: Motion 2016.01.04 That Apprenticeship Manitoba deny CN's request to allow its 11 candidates to write the certification examination for the trade of Heavy Duty Equipment Technician in isolation and on this occasion only with the condition that certification examinations are sealed and not graded until candidates can demonstrate sufficient on-the-job experience. Moved by Anita Campbell Seconded by Betty McInerney Carried. All in favour 9 in favour 0 opposed 0 abstained That a branch policy prescribing the criteria and procedures for considering and approving cross trade credit for trades qualification candidates be developed and returned to the Board at a later time for review Moved by Ken Webb Seconded by Harvey Miller Carried. All in favour 9 in favour 0 opposed 0 abstained Motion 2016.01.05 Motion 2016.01.06 That Apprenticeship Manitoba partner with CN to develop a training program that responds to CN's unique business model and meets on-the-job training criteria for trades qualification applicants. Moved by Betty McInerney Seconded by Steve Ducharme Carried. All in favour 9 in favour 0 opposed 0 abstained 2016.01.05 NEW BUSINESS 1. No new business. 2016.01.06 BRANCH UPDATES 1. No updates. 2016.01.07 RECENTLY REGISTERED REGULATIONS / INFORMATION 1. No recently registered regulations. 2016.01.08 FUTURE AGENDA ITEMS 1. Strategic Plan: PAC Appointment Process & Review of Regulatory technical training process 2016.01.09 CORRESPONDENCE / INFORMATION 1. No correspondence update. 2016.01.10 NEXT MEETING & EVENTS 1. Late February or early March 2016. 2016.01.11 ADJOURN 1. Meeting adjourned at 12:04pm.	<urn:uuid:0d4c2c80-6d9f-44b3-a0ef-a5c77df76433>	CC-MAIN-2023-40	https://www.gov.mb.ca/aesi/apprenticeship/pdfpubs/pubs/board/minutes/2016/board_minutes_2016_01.pdf	2023-09-28T05:29:43+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-40/subset=warc/part-00036-7aa0a1e5-33a6-434b-89a2-950f294b40c1.c000.gz.parquet	870,934,010	2,200	eng_Latn	eng_Latn	0.85607	eng_Latn	0.986271	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 998, 2653, 5252, 8230, 10066, 10908 ]
The Use of the Socratic Method in Legal Education Mark A. Visger This paper was completed and submitted in partial fulfillment of the Master Teacher Program, a 2-year faculty professional development program conducted by the Center for Faculty Excellence, United States Military Academy, West Point, NY, 2013 Abstract This paper examines the debate over the Socratic method in law school education. First, the teaching method its application in law schools is explained and how it is applied in law schools. Next, criticisms and defenses of the Socratic method are reviewed. Finally, the paper concludes with conclude with Stuckey's (2007) recommendations in his seminal work, Best Practices for Legal Education. Stuckey concludes that the method has value, but should be used properly to support educational objectives. One of the defining features of law school education is the Socratic, or case, method of instruction. Popularized by the novel/movie The Paper Chase and Scott Turow's One L, the aggressive questioning method is a well known rite of passage for all law students. In this method, students, frequently chosen at random, are questioned closely about a particular appellate case and the rule derived from the case. Through a rigorous question and answer format, the class as a whole is expected to learn the legal rules and apply them to similar factual scenarios. The Socratic method is not without controversy. It has largely remained unchanged since 1870, when Christopher Langdell established this method at Harvard Law School (Davis and Steinglass, 261). The method has continued without significant research into its effectiveness. Many legal educators have criticized the method as unduly harsh, ineffective, unnecessary, and harmful to women and minorities. On the other hand, defenders of the method maintain that it is vital for imparting vital legal skills to new students, so that they learn how to "think like a lawyer." Before it is possible examine the critique of the Socratic method, it is necessary to examine how the method is utilized. Davis and Steinglass (1997) offer the most comprehensive description of the method. Generally, a student is selected to recite the case, with a view towards developing a "fact-and-rule-fit" (FARF) (Davis and Steinglass, 266). The questioning is designed to elicit the facts before the court and the applicable rule of law that was applied to these facts (265). From there, the questioning will proceed to a series of hypothetical situations to examine the contours of the legal rule and highlight significant aspects of the law (267). Other students in the class are expected to follow and be engaged in the discussion, gleaning the necessary knowledge and skills along the way (Schwartz, 352). The intent of this approach is to engage in a "cognitive apprenticeship" whereby students learn legal analysis skills, so that they can "think like a lawyer." (Stuckey, 134). Criticisms of the method are numerous. Schwartz (2001) calls the model a "vicarious learning/self-teaching" method (351) and compares it to teaching swimming vicariously (35456). In addition, the method has not kept up with modern educational theory, which emphasizes multiple modes of instruction to account for various learning styles (Schwartz, 363). The method almost exclusively favors the verbal/aural method of learning to the exclusion of other methods (Madison 300-301). Similarly, oftentimes the method is used exclusively without reference to specific educational objectives (Stuckey, 133; Madison, 323). Because of its extensive use, students quickly "get it" and become bored with the legal instruction (Stuckey 134). As a result, little attention is paid to practical lawyering skills and students graduate law school with little practical ability to practice law (Stuckey, 138). Other criticisms focus on the harmful effects of the method. The method can be harsh and degrading, and is viewed by some as a form of hazing. Some claim that the method is particularly harmful to women and minorities, who are particularly intimidated by the aggressive questioning. Others have complained that the method induces moral relativism into law students, where considerations of justice, fairness or other values are rendered irrelevant (Stuckey, 139-40). Critics charge that these harmful effects are unnecessary due to the fact that other teaching methods can achieve the same educational objectives without these negative side effects (Madison, 323-26). While many criticisms abound, many defenders continue to argue that the Socratic method is vital and necessary to the legal education process. Vitiello (2005) writes the strongest defense of the method. He argues that the criticisms are overstated and not supported by objective evidence (971-79). Instead, the Socratic method is necessary to prepare law students for the rigors of law practice (Vitiello, 987-90). The intense questioning involved in the method teaches students to think on their feet and learn to express themselves orally, a vital skill no matter the type of law practice (Vitiello, 989-90). He also notes that the practice of law favors aural learners (much like the practice of Art History favors visual learners), and that other types of learners need to adapt to succeed in the practice of law (1009-1011). Similarly, Stropus (1996) argues that the method is necessary to force students to learn to properly "analyze cases," "think independently" and develop verbal skills (465-468). All advocates for the continued use of the method indicate that criticism is due to the misuse and/or overuse of the method and that the method itself imparts valuable skills. One of the missing pieces in this back-and-forth between the two camps is objective research into the effectiveness of the method. Teich (1986) conducted a meta-analysis of the nine experimental comparisons of methods and found that no particular method was found to be superior, as assessed by test performance, with the exception of group instruction that was assisted by computer-assisted instruction (185-88). The great majority of the criticisms of the technique is that they are anecdotal and not empirical (Ogloff et al., 181). As a result, we are left with anecdotal evidence on the effectiveness of the Socratic method. Despite the criticisms, the method appears to be effective when used properly. The Carnegie Foundation report concludes that the method provides for "rapid socialization into the standards of legal thinking" but also concludes that law schools rely too strongly on the Socratic method. (Sullivan et al., 5). Stuckey's Best Practices monograph reaches a similar conclusion, and prescribes an extensive list of best practices for using the Socratic method. Stuckey's recommendations are as follows: 1. "Use the Socratic dialogue and case method for appropriate purposes." (211) Stuckey notes that even critics concede effectiveness of the method in teaching critical skills, particularly the legal analysis, case analysis and the ability to "think on their feet." (211) However, he recommends that it only be used for those purposes and limit its use to those times that it "achieves clearly articulated educational goals more effectively and efficiently than other methods of instruction could achieve." (211) 2. "Be skilled in using Socratic discourse."(213) Relying heavily on the Davis and Steinglass article, Stuckey recommends that teachers be skilled in understanding the progression and use of the method (213). Other critics have highlighted the fact that law professor receive minimal instruction on teaching and are generally chosen based on their success in legal practice and it is assumed that they will excel at teaching (Schwartz, 36465). As a result, Stuckey details the steps in the progression and the purpose of each step (213216). New law professors would do well to examine these steps. 3. "Do not intentionally humiliate or embarrass students." (216) Much of the criticism of the method involves the potential for harm. As a result, Stuckey recommends several practices to avoid this pitfall. Included within this recommendation are admonitions to explain why the Socratic method is used so that students can contextualize their experience (218) and "reassure flustered students and move on" (219). At the end of the day, professors should use the method "to illuminate lessons, not to expose students' lack of understanding." (220). 4 "Do not rely exclusively on Socratic dialogue." While the method is effective for achieving some educational goals, Stuckey notes that it is obviously less effective in reaching other goals (221). As a result, the educator should vary his method depending on the particular educational objectives (222-23). The controversy over the Socratic method is not likely to end. However, when used properly, the method can provide a way to effectively meet the educational objectives. Law professors should not simply employ the technique mindlessly. Instead, she should think through the educational objectives and apply the method when it allows her to meet those objectives. In addition, legal educators should remain mindful of the potential for harm and emplace mitigation measures to minimize this potential. When these steps are followed, the Socratic method will serve both the teacher and the students well. References Peggy Cooper Davis and Elizabeth Ehrenfest Steinglass, A Dialogue About Socratic Teaching, 23 N.Y.U. Rev. L. & Soc. Change 249 (1997). Benjamin V. Madison III, The Elephant in the Law School Classrooms: Overuse of The Socratic Method as an Obstacle to teaching Modern Law Students, 85 Univ. Detroit Mercy L. Rev. 285 (2008). James R.P. Ogloff et al., More than "Learning to Think Like a Lawyer": The Empirical Research on Legal Education, 34 CREIGHTON L. REV. 73 (2000). Michael Hunter Schwartz, Teaching Law by Design: How Learning Theory and Instructional Design Can Inform and Reform Law Teaching, 38 San Diego L. Rev. 347 (2001). Ruta K. Stropus, Mend It, Bend It, and Extend It: The Fate of Traditional Law School Methodology in the 21st Century, 27 LOY. U. CHI. L.J. 449 (1996). Roy Stuckey et al, Best Practices for Legal Education, A Vision and A Road Map, (2007). William M. Sullivan et al., Educating Lawyers: Preparation for the Profession of Law, (2007). Paul F. Teich,Research on American Law Teaching: Is There a Case Against the Case System? 36 J. LEGAL EDUC. 167 (1986). Michael Vitiello, Professor Kingsfield: The Most Misunderstood Character in Literature, 33 Hofstra L. Rev. 955 (2005) Annotated Bibliography Phillip E. Areeda, The Socratic Method (SM) (Lecture at Puget Sound, 1/31/90), 109 HARV. L. REV. 911 (1996). This article, which is in a Harvard Law Review volume memorializing the author, contains the author's notes on the Socratic Method which he gave in a speech. It provides a detailed approach to the topic and responses to criticisms from an expert practitioner's perspective. According to Areeda, the method is necessary for students to learn legal reasoning and analysis, and, properly done, many of the harms cited by critics can be avoided. Areeda's notes provide many helpful, practical tips for using the method properly and avoiding these harms. Peggy Cooper Davis and Elizabeth Ehrenfest Steinglass, A Dialogue About Socratic Teaching 23 N.Y.U. Rev. L. & Soc. Change 249 (1997). , Davis and Steinglass perform an in-depth review of the development of the case-method in law schools, beginning with a detailed examination of the original Socratic method, the case-method utilized by Langdell and its modern variant. This extensive discussion, combined with examples of the method, is then broken down into its constituent parts and critiqued. The authors conclude that the method does effectively provide a well-rounded legal education, but aspects of the method hinder learning, particularly: the context in which the method is administered, the lack of student control and the over-reliance on questions. Steven Friedland, How We Teach: A Survey of Teaching Techniques in American Law Schools, 20 SEATTLE U. L. REV. 1 (1996). This helpful article conducted a survey of 358 law school professors as to educational objectives, methods of teaching and rationale for their choices. The survey found a strong use of the Socratic method in the first-year courses, with a declining use in upper-level and seminar courses. Similarly, this use of the Socratic method in the first-year corresponded with the goal of teaching legal reasoning skills. The survey indicated a willingness to try new methods. The author concluded that law professors do care about how they teach and are not automatically reverting to the Socratic method. Lani Guinier et al., Becoming Gentlemen: Women's Experiences at One Ivy League Law School 143 U. PA. L. REV. 1 (1994). , Guinier designed a cohort study of student attending University of Pennsylvania Law School who responded to a voluntary survey on gender in legal education. The narrative responses showed that women showed a much higher degree of alienation and outrage from their law school experience. While many aspects of law school contributed, the Socratic method was also identified as a contributing factor to the alienation. Women almost unanimously described the first year (when the Socratic method is used most heavily) as a "radical, painful, or repressive experience, one that they will never forget." The Socratic method was especially difficult for them, and they tended to not speak up in class and were strongly intimidated by the method. As a result, she recommends that the large Socratic classroom method should be reconsidered Gerald F. Hess, Heads and Hearts: The Teaching and Learning Environment in Law School, 52 J. LEGAL EDUC. 75 (2002). Hess surveys the current law school learning environment, noting the high levels of stress and adversarial interaction which are generally not conducive to a positive learning environment. To remedy this problem, he surveys current teaching theory for higher education and endorses several recommendations to improve the law school educational process. To that end, he recommends the following classroom practices: mutual respect, high expectations, supportive attitudes, collaboration, inclusion, engagement, delight, and feedback. Orin S. Kerr, The Decline of the Socratic Method at Harvard, 78 NEB. L. REV. 113, 118-22 (1999). Kerr surveyed a sample of law professors who teach first-year courses at Harvard Law School. He found three general schools of approach—traditional Socratic method, a quasi-Socratic method which also utilizes other teaching styles and no Socratic method (usually adopted by instructors who approach the law from non-traditional perspectives). This article presents helpful viewpoints and perspectives form all three camps and also presents accounts of how the professors' experiences with the Socratic method impacted their teaching choices. Benjamin V. Madison III, The Elephant in the Law School Classrooms: Overuse of The Socratic Method as an Obstacle to teaching Modern Law Students, 85 Univ. Detroit Mercy L. Rev. 285 (2008). Building on the Best Practices Report, Madison expounds on the virtues of teaching law through multiple methods, including the Socratic Method. Madison catalogues the objections to the method, particularly the fact that it is not tied to specific educational objectives and it does not address the variety of ways in which students learn. Madison proposes techniques which provide the necessary context and which incorporate diverse teaching techniques. He demonstrates how he utilizes them in his Civil Procedure class, a class commonly taught to first year law students. Through visual demonstrations, slides, in-class scenarios, practical exercises, Madison argues that it is possible to retain a challenging course in which student learn legal concepts through active learning. Myron Moskovitz, Beyond the Case Method: It's Time to Teach with Problems, 42 J. LEGAL EDUC. 241 (1992). Moskovitz argues for the adoption of the "problem-solving" method of instruction. By combining assigned cases with an application problem for students to work out, students can better learn legal analysis and method in an atmosphere which mimics that found in law practice. The problem solving method contains many of the features of the Socratic method, but he argues that it avoids the pitfalls of the Socratic method. Moskovitz presents practical guidance for adopting this method in lieu of the Socratic method. James R.P. Ogloff et al., More than "Learning to Think Like a Lawyer": The Empirical Research on Legal Education, 34 CREIGHTON L. REV. 73 (2000). This article comprehensively chronicles all significant empirical research on legal education. This survey includes law students, including characteristics and the effect of law school; the law school itself, including characteristics of professors and administrators, curriculum and methods of instruction; and post-law school performance. The articles concludes that, despite the large number of studies, "little is known, overall, about legal education." Ogloff notes that the methodological designs of studies conducted on legal education are "flawed" and that is very difficult to draw sound conclusions regarding legal education. He recommends the assistance of social scientists to craft and analyze further studies. Michael Hunter Schwartz, Teaching Law by Design: How Learning Theory and Instructional Design Can Inform and Reform Law Teaching, 38 San Diego L. Rev. 347 (2001). Schwartz is a strong critic of the case method, which he claims is in fact a Vicarious Learning/Self-Teaching Model of instruction. This is so because the instruction is composed entirely of one-on-one interactions with a student in a classroom setting, with the remainder of class expected to learn from the dialogue. As a result, students are expected to "figure out on their own what the students need to know." This is further exacerbated by the large classroom size (generally 50-120 students) where instructor interaction is inherently limited. He memorably likens this method to teaching swimming vicariously. This method, Schwartz asserts, has failed to keep up with modern educational theory and does not account for the variety of learning styles of the students. Ruta K. Stropus, Mend It, Bend It, and Extend It: The Fate of Traditional Law School Methodology in the 21st Century, 27 LOY. U. CHI. L.J. 449 (1996). Stropus catalogues the criticisms of the Socratic/Langdellian method of law instruction, but argues that it is critical in order to properly prepare students for the practice of law. Specifically, the method forces student to "analyze cases," to "think independently," to develop verbal skills. In addition, these skills are expected of newly-licensed practicing attorneys when they are hired. Instead of abandoning the method, Stropus argues that the method should be modified to address the criticisms. In particular, context should be provided in which teachers explain the method and why it is being utilized; additional methodologies are utilized as students advance and learn the basic skills imparted by the Langdellian method; and focused academic support programs are instituted to assist at-risk populations in mastering the skills necessary to succeed. Roy Stuckey et al, Best Practices for Legal Education, A Vision and A Road Map, (2007). The report chronicles two main objections to the Socratic method. First, that, while it does have some value in teaching legal methodology, it is incomplete and limited as a teaching tool standing alone. Second, and more importantly, the technique is frequently abused and inflicts unnecessary damage on students. This damage is frequently in the form of de-moralization where law students learn that values such as fairness and justice are not longer relevant. The Best Practices report recommends that the Socratic method be utilized only when it supports the stated educational objectives. When the method is used, professors should use it properly and not in a way to demean or humiliate students. William M. Sullivan et al., Educating Lawyers: Preparation for the Profession of Law, (2007). In this monograph published by The Carnegie Foundation for the Advance of Teaching, Sullivan and his team extensively survey the legal education practices across the U.S. and Canada. They find that the case method successfully provides for "rapid socialization into the standards of legal thinking." This method successfully results in students being able to sift through complicated facts, frame arguments from both sides of an issue , focus on legal precedents and use precise language. This method, however, has several downsides. First, it does not transfer this thought process to actual legal practice, leaving students lacking the skills necessary for legal practice. Second, it does not allow for development of "legal professionalism"—consideration of moral, ethical and social aspects of resolution of legal problems. As a result, they recommend a more holistic approach, particularly in the second and third years of law school, after students have been effectively socialized into the mental processes of thinking like a lawyer. Paul F. Teich,Research on American Law Teaching: Is There a Case Against the Case System? 36 J. LEGAL EDUC. 167 (1986). Teich conducted a meta-analysis of empirical assessments of group teaching techniques of law. He found that no particular method was found to be superior, as assessed by performance on examinations. This finding was similar to studies in other post-secondary educational fields, most of which yielded similar findings. The only significant method that increased test scores was group instruction supplemented by computer-assisted instruction. Michael Vitiello, Professor Kingsfield: The Most Misunderstood Character in Literature, 33 Hofstra L. Rev. 955 (2005) Vitiello offers a vigorous defense of the traditional case-method. He attempts to refute the criticisms that the method is discriminatory (when outcomes are controlled against LSAT results, the method is not discriminatory); that it is ineffective (the data is inconclusive); that it makes students cynical, anxiety-prone, and amoral (it necessarily prepares students for the rigors of law practice and oral advocacy); and that it does not take into account different learning styles (successful law practice tends to favor an aural learning style, students of less-favorable learning styles must adapt in order to practice law). Ultimately, he argues for a properly-administered, rigorous use of the Socratic method, which challenges students and prepares them for the challenges of practicing law.	<urn:uuid:a742d1ff-2ca6-4706-b9ac-86708cb93fc6>	CC-MAIN-2018-34	https://www.westpoint.edu/cfe/Literature/Visger_13.pdf	2018-08-21T16:25:55Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221218357.92/warc/CC-MAIN-20180821151743-20180821171743-00589.warc.gz	1,013,481,320	4,792	eng_Latn	eng_Latn	0.980229	eng_Latn	0.995997	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2965, 6191, 9027, 10689, 13548, 16104, 19192, 22076, 23000 ]
Utilizing remote sensing technology for monitoring chemically managed giant salvinia (Salvinia molesta) populations BRADLEY T. SARTAIN, JONATHAN P. FLEMING, AND CHRISTOPHER R. MUDGE* ABSTRACT Thousands of acres of giant salvinia (Salvinia molesta) are managed annually in Louisiana and Texas, but management success is difficult to measure quantitatively. The objective of this research was to evaluate and develop remote sensing techniques to quickly and accurately assess giant salvinia health and herbicide efficacy in a field scenario. Field sampling data from Saline Lake, LA documented a negative correlation ($R^2 = -0.785$) between Landsat near-infrared (NIR) reflectance and visual percent control ratings. Additional research utilizing high-resolution WorldView-3 reflectance data indicated that percent control and NIR reflectance of giant salvinia in sampled plots were significantly correlated at 2 and 6 wk after treatment, with $P = 0.047$ and $P < 0.0001$, respectively. Additional data collected with a DJI Phantom drone and low-cost RGNIR Sentera Single Sensor during an 8-wk mesocosm study documented the strongest linear relationship ($R^2 = -0.914$) between percent control and NIR reflectance values, and the resulting linear regression equation was used to predict percent control values utilizing data collected in previous studies. The relationship between predicted and observed percent control values was linear and significant ($P \leq 0.0001$) and yielded $R$ and $R^2$ values of 0.918 and 0.843, respectively. On the basis of the NIR spectral response of giant salvinia to herbicide applications, remote sensing can provide beneficial information on the success or failure of large-scale herbicide applications. Key words: drone, efficacy, herbicide, near-infrared, predict, reflectance, regression, satellite imagery. INTRODUCTION Giant salvinia (Salvinia molesta D.S. Mitchell) is a floating aquatic fern that has spread from its native range in South America to over 20 countries worldwide (Oliver 1993), including the United States (Johnson 1995). The ornamental plant trade is the likely vector for the intercontinental spread of giant salvinia. Botanical gardens and commercial horticulture have been linked to its introduction in Asia, Africa, North America, and Australia (Harley and Mitchell 1981, Nelson 1984, Thomas and Room 1986, Oliver 1993). It thrives in the southern United States, exhibits rapid growth, and forms dense mats that negatively affect water resources immediately after infestation. Extensive giant salvinia growth impedes waterborne navigation, transportation, irrigation, and recreational activities within infested water bodies (Pimentel et al. 1999). From an ecological and economic standpoint, this free-floating fern has the ability to degrade water quality and wildlife habitat, outcompete native plant species, lower property values, and lead to public health concerns (McFarland et al. 2004). Large-scale management techniques such as lake drawdowns, salvinia weevil (Cyrtobagous salviniae Calder and Sands) release, and mechanical harvesting are often implemented for giant salvinia management; however, aquatic herbicides are one of the most commonly used and effective management tools (Netherland 2014). Thousands of acres of giant salvinia are chemically managed annually, but management success is difficult to measure quantitatively. Treatment sites can encompass large areas, upward of 500 ha, and certain areas within these sites can be difficult to access or completely inaccessible by boat. Large-scale applications often use spot assessments and visual injury rating scales as a method to quantify herbicide efficacy; however, these can be subjective and biased to the observer (Madsen and Bloomfield 1993). Numerous environmental factors including coastal tide movement, wind, precipitation, water flow, human interactions, and plant decomposition can also affect assumptions of successful or unsuccessful control. These factors make it difficult for managers to determine if plants remaining within treatment areas are the result of plant recovery or reinestation from nontreated areas. Currently, minimal effort has focused on monitoring herbicide efficacy, use patterns, and long-term control after operational management of giant salvinia. Widespread plant infestations, diminished funding, and limited trained personnel make it difficult to evaluate postherbicide application effectiveness. Although small-scale studies are beneficial and provide useful information regarding herbicide evaluations (Nelson et al. 2001, Mudge et al. 2016), additional monitoring tools need to be developed to determine if the best herbicides are being utilized in a field setting. Remote sensing may be a potential monitoring method for assessing herbicide efficacy after field applications. It has become an important tool for wetland resource managers because of limited access and large expanses of aquatic ecosystems (Carter 1982). Remote sensing involves the use of one or more sensors mounted on various platforms (e.g., aircraft, satellite, unmanned aerial vehicles) that collect information based on the reflection of electromagnetic (EM) radiation from a particular area or object (Thorp and Tian 2004). The EM spectrum is composed of different forms of EM radiation that are grouped according to wavelength (Thorp and Tian 2004). For instance, the human eye detects red, green, and blue EM radiation in the visible spectrum, which ranges from 400 to 700 nm in wavelength; however, this is only a small percentage of the EM spectrum (Thorp and Tian 2004). Near-infrared (NIR) light (700 to 1,300 nm) makes up another portion of the spectrum and is considered a good indicator of vegetation health. Unfortunately this spectrum is not visible to the human eye (Thorp and Tian 2004). Optical remote sensors have the ability to detect and quantify reflectance of EM radiation from vegetation, including that in the NIR region (Thorp and Tian 2004). In the visible region of the spectrum, green vegetation often displays very low reflectance and energy transmission because of energy absorption by photosynthetic and plant pigments (Chappelle et al. 1992). In contrast, reflectance and transmittance is typically high in the NIR spectral region (700 to 1,300 nm) because of minute absorption of energy by subcellular particles/pigments and scattering at the interfaces of mesophyll cell walls (Gausman 1974, Gausman 1977, Slaton et al. 2001). The ability of a herbicide to alter the physiological condition of a plant is also assumed to alter the plant’s spectral reflectance characteristics (Robles et al. 2010). Temporal herbicide injury and changes of energy reflectance have been documented in terrestrial plants (Adcock et al. 1990). However, little or no research is available that details changes of giant salvinia NIR reflectance in response to herbicide exposure. In aquatics, research has primarily focused on species differentiation (Best et al. 1981, Everitt et al. 2002, Jakubauskas et al. 2002, Everitt et al. 2008,), and success of biological control methods using reflectance data collected in the visible and NIR spectra (Everitt et al. 2005). Everitt et al. (2005) reported that moderate and severe feeding damage in plants infested with salvinia weevils during May and July had significantly lower NIR reflectance values in comparison with healthy plants. The mean NIR reflectance of giant salvinia with moderate feeding damage was reported as $16 \pm 1.2$ and $14.5 \pm 0.09$ in May and July, respectively (Everitt et al. 2005). Lower values of $9.5 \pm 0.4$ (May) and $10.3 \pm 1.3$ (July) were reported for plants with severe feeding damage (Everitt et al. 2005). In contrast, healthy plants in May and July documented a significantly higher mean NIR reflectance of $38.3 \pm 2.6$ and $35.7 \pm 2.6$, respectively (Everitt et al. 2005). In addition, Robles et al. (2010) documented that spectral data collected via a handheld spectroradiometer and transformed to simulate a Landsat 5 thematic mapper (TM) multispectral data set was capable of detecting and predicting herbicide injury on the floating aquatic plant water hyacinth [Eichhornia crassipes (Mart.) Solms]. It is important to note that the validation of satellite-acquired data requires the collection of ground-truth data to be used as a reference (Kharbouche et al. 2017). These data are often collected by in situ instrumentation (i.e., radiometers, spectrometers) either ground based, handheld, airborne, etc. (Kharbouche et al. 2017), or visual assessments by visiting predetermined sampling points within an area of interest. High-resolution multispectral satellite imagery and ground-truth sampling measurements have been used to successfully distinguish giant salvinia from mixed woody and mixed aquatic vegetation in large reservoirs (Everitt et al. 2008). Although this is very beneficial for natural-resource managers interested in mapping healthy giant salvinia infestations, management programs could be improved if a reliable low-cost monitoring protocol were established that could differentiate changes in plant health after large-scale control programs. The goal of this research was to determine the applicability of using remote sensing to monitor and potentially predict control of giant salvinia treated with a combination of the aquatic registered herbicides glyphosate + diquat in a field scenario. Thus, the objectives of this study were to 1) investigate the relationship between visual percent control ratings of giant salvinia treated with glyphosate + diquat in Saline Lake, LA and NIR reflectance data acquired from Landsat 7 ETM+ and Landsat 8-OLI satellites, 2) investigate the relationship between NIR reflectance data collected from high-resolution WorldView-3 satellite imagery and percent giant salvinia control in a small-scale field application, 3) investigate the relationship between NIR reflectance data collected via drone with a low-cost NIR sensor payload and the percent giant salvinia control under controlled experimental conditions, and 4) develop a simple regression model from these data to predict and monitor giant salvinia control when exposed to glyphosate + diquat treatments. MATERIALS AND METHODS Saline Lake pilot study Visual percent control of giant salvinia was evaluated using point-intercept surveys in Saline Lake, LA during the summer of 2015. Control ratings were recorded at specific points within a 20.2 ha$^{-1}$ plot of giant salvinia located on the northern shore of Chee Chee Bay in the southwestern portion of Saline Lake (Figure 1). Before surveying, giant salvinia within the plot was chemically managed on 2 to 4 July 2015. The treatment consisted of a foliar application of glyphosate$^1$ (3.3 kg ae ha$^{-1}$), diquat$^2$ (0.5 kg ai ha$^{-1}$), and two surfactants$^{3,4}$ (0.25 and 0.01% v/v, respectively). Pretreatment assessment on 1 July 2015 indicated that giant salvinia was healthy, mature, and actively growing throughout the plot. Posttreatment point-intercept surveys were conducted 2, 3, 6, and 10 wk after treatment (WAT). Surveys were conducted by navigating via boat to equally spaced (50 m) points created in ArcMap$^3$ 10.3® ArcGIS computer software (ESRI 2017) and recording visual percent control at each point. Percent control was determined in 10% increments where 0% = healthy plants/no control and 100% = complete Figure 1. The 20.2 ha$^{-1}$ point-intercept sampling plot on the northern shore of Chee Chee Bay in the southwestern portion of Saline Lake, LA. The points shown in the inserted image represent the locations visited during each survey to evaluate giant salvinia (Salvinia molesta) control after applications of the aquatic herbicides glyphosate (3.3 kg ae ha$^{-1}$) + diquat (0.5 kg ai ha$^{-1}$) and two surfactants (0.25 and 0.01% v/v, respectively). Table 1. Point-intercept survey dates, number of weeks after treatment each survey was performed, the date of satellite imagery acquisition, and the corresponding sensor platform used to acquire remotely sensed data for Saline Lake, LA during the summer of 2015. \| Survey Date \| Weeks after Treatment (WAT) \| Satellite Imagery Date \| Sensor Platform \| \|-------------------\|-----------------------------\|-------------------------\|----------------------------------\| \| 20 July 2015 \| 2 WAT \| 23 July 2015 \| Landsat satellite 7 ETM \| \| 3 August 2015 \| 3 WAT \| 31 July 2015 \| Landsat satellite 8 OLI TIRS \| \| 17 August 2015 \| 6 WAT \| 16 August 2015 \| Landsat satellite 8 OLI TIRS \| \| 10 September 2015 \| 10 WAT \| 17 September 2015 \| Landsat satellite 8 OLI TIRS \| control/no plants present. Data were recorded electronically with a Trimble Yuma™ tablet computer and Farm Works® Farm Site Mate™ software version 11.4 (Cox et al. 2011). A total of 50 points was visited during each survey. Landsat-7 ETM+ and Landsat 8-OLI multispectral imagery data were acquired from the U.S. Geological Survey EarthExplorer image database. The Landsat-7 ETM+ and Landsat 8-OLI sensors are capable of measuring visible (450 to 690 and 433 to 680 nm, respectively) and NIR (770 to 900 and 845 to 885 nm, respectively) portions of the EM spectrum. Both Landsat platforms were used to get imagery that was most synchronous to the survey dates and imagery of the study site were acquired within 7 d of each point-intercept survey (Table 1). Previous work by Robles et al. (2010) indicated that the NIR band 4 from Landsat 5 TM consistently related phytotoxicity of herbicides to water hyacinth using a simple regression model; therefore, only NIR bands were used in the analysis. In addition, only NIR bands were utilized to create a more user-friendly model for a less experienced user. Each image was geometrically corrected and rectified to the World Geodetic Survey 1984 datum and universal transverse Mercator (zone 15 north) coordinate system. Landsat imagery was corrected to top of atmospheric (TOA) reflectance following the instructions listed in the Landsat 7 (USGS 1998) and Landsat 8 data user handbook (USGS 2016). Reflectance conversions of all Landsat data were performed using Earth resource data analysis system (ERDAS) Imagine® software. NIR reflectance values were extracted using ArcMap Spatial Analyst and averaged to determine the mean NIR reflectance for each 10% increment of visual percent control (Table 2). These data were subjected to a simple linear regression model relating percent visual control to NIR reflectance of giant salvinia using SigmaPlot® version 11.0 statistical software. A total of 200 points was used in the analysis. Small-pond study A small-pond study was conducted during the summer of 2017 at the University of Louisiana Lafayette Cade Research Farm in Cade, LA. Four adjacent 0.10-ha⁻¹ ponds, 0.3 to 0.6 m in depth, were utilized during the study (Figure 2). Each pond was inoculated with giant salvinia during the spring of 2017 and allowed to acclimate until plants achieved 100% coverage of the water surface. WorldView-3 imagery (1- to 1.5-m spatial resolution) of the study site was obtained from the commercial satellite imaging company DigitalGlobe™ through the NextView license agreement with the U.S. Army Engineer Research & Development Center (Vicksburg, MS). The WorldView-3 satellite is capable of measuring visible and NIR portions of the EM spectrum. On 20 June 2017, three of the four ponds were treated with a tank mix of glyphosate (3.3 kg ae ha⁻¹), diquat (0.5 kg ai ha⁻¹), and surfactant¹⁰ (0.25 % v/v) at a spray volume of 934 L ha⁻¹. Treatments were applied with a handheld spray gun attached to a Kappa¹¹ 55 diaphragm pump. The fourth pond was designated as a reference pond and not treated. Table 2. Mean near-infrared (NIR) reflectance (± SE) and the total number of points recorded for each 10% control increment during point-intercept surveys after the application of the aquatic herbicides glyphosate (3.3 kg ae ha⁻¹) and diquat, (0.5 kg ai ha⁻¹) in 2015 at Saline Lake, LA. \| Percent Control \| NIR Reflectance (Mean ± SE) \| No. of Points \| \|-----------------\|----------------------------\|---------------\| \| 0 \| 0.2398 ± 0.051 \| 93 \| \| 10 \| 0.1879 ± 0.011 \| 7 \| \| 20 \| 0.1872 ± 0.014 \| 10 \| \| 30 \| 0.1852 ± 0.009 \| 11 \| \| 40 \| 0.1746 ± 0.009 \| 15 \| \| 50 \| 0.1610 ± 0.007 \| 23 \| \| 60 \| 0.1569 ± 0.007 \| 14 \| \| 70 \| 0.1450 ± 0.013 \| 14 \| \| 80 \| 0.1111 ± 0.013 \| 9 \| \| 90 \| 0.0949 ± 0.000 \| 1 \| \| 100 \| 0.1466 ± 0.011 \| 3 \| \| \| Total = 200 \| \| Figure 2. World View-3 true-color image of the four ponds utilized in the small-pond study at Cade, LA. Ponds were treated with the aquatic herbicides glyphosate (3.3 kg ae ha⁻¹) + diquat (0.5 kg ai ha⁻¹) and surfactant (0.25% v/v) on 20 June 2017. Imagery was acquired on 3 July 2017 (2 wk after treatment). The red arrow indicates a sampling plot in treatment pond 2 surrounded by open water. Before treatment, eight 1.5 by 1.5 m plots, constructed of polyvinyl chloride (PVC) pipe, were placed within each pond. Plot area was determined on the basis of the spatial resolution of the WorldView-3 imagery. Plots were anchored to the substrate to prevent movement within ponds. Imagery was acquired on 3 July 2017 (2 WAT) and 28 July 2017 (6 WAT). It was anticipated that imagery would be acquired a minimum of once every 2 wk; however, afternoon rain showers and cloudy conditions only allowed the acquisition of images at two time periods. Biomass was harvested at 2 WAT and 6 WAT from multiple PVC plots throughout each pond, transported back to Louisiana State University (LSU), dried (65 C) to a constant weight, and percent giant salvinia control was determined by the comparison of biomass in treated plots with biomass in reference plots using the following equation: $(\text{reference biomass} - \text{treatment biomass})/\text{reference biomass} \times 100 = \% \text{ control}$. WorldView-3 imagery was geometrically corrected to control points using ground measurements and visual targets to ensure the accuracy and location of each plot within the sampled ponds. Multispectral data were processed and corrected to TOA reflectance in ERDAS Imagine software following the user guidelines provided by DigitalGlobe (Kuester 2016). For each sampling period, NIR reflectance and percent control data of each harvested plot were subjected to a simple linear regression $(y = a - bx)$ using SigmaPlotion 11.0 statistical software. Mesocosm study On 23 August 2017, giant salvinia was planted at the LSU Aquaculture Research Facility (Baton Rouge, LA) into 30 (76-L) plastic containers (49.5 cm diameter by 58.4 cm height) filled with approximately 60 L of pond water (pH 8.5) and amended with 14 g of sphagnum moss to lower the pH to $< 7.0$. In addition, 2.1 g of Miracle-Gro® water-soluble lawn food (24–8–16) was applied to each container at planting and every 2 wk throughout the 8-wk study. Plants were allowed approximately 14 d to acclimate to experimental conditions. Plants were healthy, actively growing, and were beginning to form multiple layers at the conclusion of the 2-wk acclimation period. Plants in 25 of the 30 tanks were treated with the same herbicide combination utilized in the small-pond study, with the remaining 5 designated as reference tanks. Biomass was collected from 5 of the 30 tanks at 2, 4, 6, and 8 WAT. Reference tanks and the remaining five treated tanks were harvested at the conclusion of the 8-wk study. All harvested biomass was dried (65 C), weighed, and percent control was determined using the same methods as in the small-pond study. Imagery of the study area was collected via a DJI Phantom™ drone equipped with a low-cost Sentera™ Single Sensor™ capable of capturing images in 575- to 1,050-nm wavelengths (e.g., green to NIR) of the EM spectrum. AgVaults™ data management software was utilized for autonomous flight control, image acquisition, and mosaicking of acquired images. Images of the study area were acquired before biomass collection on cloudless days between 11:00 A.M. and 12:00 noon at a flight altitude of 18.3 m with 80% image overlap. Reflectance targets were placed within the study area and used to calibrate sensor reflectance on the basis of values previously generated using a FieldSpec3™ spectroradiometer during appropriate solar and weather windows. Image analysis was performed in ArcMap by overlaying a 0.10-m-radius polygon feature in the center of each tank, followed by the conversion of each raster image pixel inside the polygon to individual points containing reflectance values using ArcMap Spatial Analyst tools. Polygons were placed in the center of each tank to avoid shadowing or edge effects that may affect pixel values (Figure 3). This process converts individual pixels of the image to individual points containing the reflectance values for each respective point. The number of points within each tank polygon ranged between 79 and 81. A spatial join was then performed to create a new polygon feature class containing... the average reflectance values of each polygon within each tank. NIR reflectance and percent control data were subjected to a simple linear regression using SigmaPlot version 11.0 statistical software. The resulting regression equation was then used in conjunction with NIR reflectance values collected during the small-pond study at 6 WAT to predict giant salvinia percent control. The predicted percent control values were then compared with the observed percent control values established in the small-pond study at 6 WAT. RESULTS AND DISCUSSION Saline Lake pilot study NIR reflectance of chemically managed giant salvinia and visual percent control ratings in Saline Lake, LA were significant and negatively correlated ($R^2 = -0.785$) (Figure 4); thus control decreased as reflectance increased. These data are comparable with Robles et al. (2010), who documented the same response between band 4 (NIR) of Landsat 5 TM and phytotoxicity ratings of water hyacinth treated with glyphosate and imazapyr. Although visual observations and reflectance data documented a negative linear relationship of $R^2 = -0.785$, factors such as sample size, spatial resolution, plant movement, and other co-occurring species likely had an impact on the analysis. A total of 200 visual observations was used in the analysis, but the number of observations for each percent control increment was not equal. For instance, only three observations documented 100% plant control compared with 23 observations documenting 50% control (Table 2). Although satellite imagery was collected within 7 d of each survey, it was not synchronous for the day of surveys. The small number of samples with 100% control ($n=3$) and the ability of giant salvinia to move into areas that were essentially “open water” between surveying and image collection most likely contributed to the higher average reflectance of the 100% control ratings than that observed for 80 and 90% control. In addition, considerable amounts of healthy bald cypress [Taxodium distichum (L.) Rich.] trees were present throughout the sampling plot. Bald cypress, combined with the low spatial resolution of multispectral Landsat images (i.e., 30 m), likely had an impact on the true NIR reflectance of giant salvinia within the plot. Despite these limitations, there was a clear distinction between the NIR reflectance of injured and noninjured plants. The availability of Landsat data at no cost makes this technology useful for monitoring management success of giant salvinia in a large-scale field scenario. These results increased the expectations of the applicability of this study; however, it was hypothesized that precision could be improved if tested on a smaller scale. Small-pond study Percent control and NIR reflectance of giant salvinia in sampled plots were significantly correlated at 2 and 6 WAT, with $P=0.047$ and $P<0.0001$, respectively. Data collected 6 WAT was more representative of actual percent control and documented a stronger negative linear relationship ($R^2 = -0.843$) compared with 2-WAT data ($R^2 = -0.579$) (Figure 5). The low rate of diquat (0.5 kg ai ha$^{-1}$) in combination with glyphosate (3.3 kg ae ha$^{-1}$) likely influenced the 2-WAT data. Diquat is a fast-acting contact herbicide that leads to rapid wilting and desiccation several hours after application and complete foliar necrosis in 1 to 3 d (Senseman 2007). Because diquat provides rapid visual injury a few hours after application, it is commonly used as a marker to distinguish treated versus nontreated sites (Mudge and Netherland 2014). The low rate of diquat likely resulted in a NIR reflectance value not representative of actual percent control at 2 WAT. Sampling at 6 WAT allowed ample time for treated plants to become necrotic and degrade, thus providing a stronger negative linear relationship between giant salvinia NIR reflectance and percent control within sampling plots. These data are contrasting to those of Robles et al. (2010) that documented the strongest linear relationship between phytotoxicity and reflectance of water hyacinth 2 WAT when treated with glyphosate and imazapyr. Contrasting results are most likely due to herbicide rate, species being tested, and experimental design. The current study was implemented to simulate a field-based application, as opposed to a controlled mesocosm experiment where complete herbicide-to-plant contact is easily attainable. In addition, the current study utilized biomass data, as opposed to visual phytotoxicity ratings. Mesocosm study Data collected from the 8-wk mesocosm study documented a strong negative linear relationship ($R^2 = -0.914$) between percent control and NIR reflectance values of giant salvinia (Figure 6). Because the strongest relationship between percent giant salvinia control and NIR reflectance was documented during this study, the resulting linear regression equation was used to predict percent control values utilizing data collected during the small-pond study. The predicted control values were plotted against observed control values to examine the relationship. The following formula, also depicted in Figure 6, was used to predict percent control values: predicted percent control = $104.61 - (306.60 \times \text{NIR reflectance})$. The relationship between predicted and observed percent control values was linear and significant ($P \leq 0.0001$), yielding $R$ and $R^2$ values of 0.918 and 0.843, respectively (Figure 7). Data in all three studies documented a negative linear relationship; thus it is clear that as herbicide control increases, NIR reflectance of the plant canopy decreases. A similar response was documented by Everitt et al. (2005), who documented decreased NIR reflectance values as giant salvinia damage increased in response to the biological control agent salvinia weevil. Everitt et al. (2005) also documented NIR reflectance values of healthy, moderate, and severely damaged giant salvinia to be $35.7 \pm 7$, $14.5 \pm 0.9$, and $10.3 \pm 1.3$, respectively, which are comparable with the results reported in the current mesocosm study that documented 0, 50, and 75% control to correspond to a NIR reflectance of 34.1, 17.9, and 9.7, respectively. Results from these data indicate that it is possible to predict and monitor percent giant salvinia control within treatment areas. On the basis of the NIR spectral response of giant salvinia to herbicide applications, remote sensing can provide beneficial information on the success of large-scale herbicide applications. Estimations of percent control can be determined by using NIR values of a remotely sensed Figure 7. Linear relationship between observed percent control and predicted percent control of giant salvinia (Salvinia molesta) treated with the aquatic herbicides glyphosate (3.3 kg ae ha$^{-1}$) + diquat (0.5 kg ai ha$^{-1}$) and surfactant (0.25% v/v) 6 wk after treatment at Cade, LA. Predicted percent control values represent the estimated percent control using near-infrared reflectance data from Worldview-3 imagery and the linear regression equation in Figure 6. The solid black line represents the regression line and dashed lines represent 95% confidence intervals of the regression line. image and the aforementioned equation. Increases or decreases in predicted control values and differentiation between treated and nontreated plants within an area will provide natural resource managers with critical information about the success of a treatment, potential plant recovery or reinestation, and the total amount of acreage treated. Future research should evaluate the accuracy of the prediction model on a larger scale and its precision with data collected from other NIR sensors. In addition, research investigating additional spectral bands and/or band combinations may provide more information for monitoring aquatic plant management operations. ACKNOWLEDGEMENTS This research was funded by the Aquatic Plant Management Society, LSU AgCenter Vice President for Agriculture Assistantship, and the Louisiana Ag Consultants Ray and Dorothy Young Endowed Assistantship. Thanks are extended to the U.S. Army Engineer Research & Development Center, Glenn Suir, and Shea Hammond for their support acquiring WorldView imagery and providing sensor reflectance values; Allie Cozad and Nathan Vercher for providing point-intercept sampling assistance; Mississippi State University GeoResources Institute for sampling equipment; and University of Louisiana Lafayette for generously providing the small ponds used in this project. Thanks to Dr. Rodrigo Diaz for providing access to his DJI Phantom drone, sensor, and AgVault subscription. Also thanks to Trista Gallivan and Nick Firmin for their much-appreciated assistance in multiple areas of this project. Permission was granted by the Chief of Engineers to publish this information. Citation of trade names does not constitute endorsement or approval of the use of such commercial products. LITERATURE CITED Adcock TE, Nutter RW Jr, Banks PA. 1990. Measuring herbicide injury to soybeans (Glycine max) using a radiometer. Weed Sci. 38:625–627. Best RG, Wehde ME, Linder RL. 1981. Spectral reflectance of hydrophytes. Remote Sens. Environ. 11:27–35. Carter V. 1982. Applications of remote sensing to wetlands, pp 284–300. In: C. J. Johannsen and J. L. Sanders (eds). Remote sensing in resource management. Soil Conservation Society of America, Ankeny, IA. Chappelle EW, Kim MS, McMurtrey JE. 1992. Ratio analysis of reflectance spectra (RARS)—An algorithm for the remote estimation of the concentrations chlorophyll-a, chlorophyll-b, and carotenoids in soybean leaves. Remote Sens. Environ. 39(3):239–247. Cox MC, Madsen JD, Wersal RM. 2011. Aquatic Plant Community Assessment with the Littoral Zone of the Ross Barnett Reservoir, MS in 2010: A Six Year Evaluation. GeoResources Institute Report 5044. [ESRI] Environmental Systems Research Institute. 2017. ArcMap® 10.3 ArcGIS Desktop. Environmental Systems Research Institute, Redlands, CA. Everitt JH, Fletcher RS, Elder HS, Yang C. 2008. Mapping giant salvinia with satellite imagery and image analysis. Environ. Monit. Assess. 139:35–40. Everitt JH, Flores D, Yang C, Helton RJ, Davis MR. 2005. Assessing biological control damage of giant salvinia with field reflectance measurements and aerial photography. J. Aquat. Plant Manage. 43:76–80. Everitt JH, Yang C, Helton RJ, Hartmann LH, Davis MR. 2002. Remote sensing of giant salvinia in Texas waterways. J. Aquat. Plant Manage. 40:11–16. Gausman HW. 1974. Leaf reflectance of near infrared. Photogramm. Eng. Remote Sensing. 15:1459–1470. Gausman HW. 1977. Reflectance of leaf components. Remote Sens. Environ. 6(1):1–9. Harley KLS, Mitchel DS. 1981. The biology of Australian weeds, 6. Salvinia molesta D.S. Mitchell. J. Aust. Inst. Ag. Sci. 47:67–76. Jakubauskas ME, Peterson DL, Campbell SW, Campbell SD, Penny D, deNoyelles F, Jr. 2002. Remote sensing of aquatic plant obstructions in navigable waterways. In: Proceedings of 2002 ASPRS-ACSM Annual Conference and FIG XXII Congress, 22–25 April 2002, Washington, DC. ASPRS, Bethesda, MD, CD-ROM. Johnson D. 1995. Giant salvinia found in South Carolina. Aquatics 17(4):22. Kharbouche S, Muller JP, Gatebe CK, Scanlon T, Banks AC. 2017. Assessment of satellite-derived surface reflectances by NASA’s CAR airborne radiometer over Railroad Valley Playa. Remote Sens. 9(562):1–17. Kuester M. 2016. Radiometric Use of WorldView-3 Imagery. Technical Note. DigitalGlobe™. https://www.digitalglobe.com/resources/technical-information. Accessed July 5, 2017. Madsen JD, Bloomfield JA. 1993. Aquatic vegetation quantification symposium: An overview. Lake Reserv. Manage. 7:137–140. McFarland DG, Nelson LS, Grodowitz MJ, Smart RM, Owens CS. 2004. Salvinia molesta D.S. Mitchell (Giant Salvinia) in the United States: A review of species ecology and approaches to management. U.S. Army Engineer Research and Development Center, Environmental Laboratory. ERDC/EL SR-04-2. Mudge CR, Netherland MD. 2014. Response of invasive floating plants and non-target emergent plants to foliar applications of imazamox and penoxsulam. J. Aquat. Plant Manage. 52:1–7. Mudge CR, Perret AJ, Winslow JR. 2016. Evaluation of foliar herbicide and surfactant combinations for control of giant salvinia at three application timings. J. Aquat. Plant Manage. 54:32–36. Nelson B. 1984. Salvinia molesta Mitchell: Does it threaten Florida? Aquatics 6(3):6–8. Nelson LS, Skogerboe JG, Getsinger KD. 2001. Herbicide evaluation against giant salvinia. J. Aquat. Plant Manage. 39:48–53. Netherland MD. 2014. Chemical control of aquatic weeds, pp. 65–78. In: L. A. Gettys, W. T. Haller, and M. Bellaud (eds.). Biology and control of aquatic plants: A best management practices handbook. 3rd ed. Aquatic Ecosystem Restoration Foundation, Marietta, GA. Oliver JD. 1993. A review of the biology of giant salvinia (Salvinia molesta Mitchell). J. Aquat. Plant Manage. 31:227–331. Pimentel D, Lach L, Zuniga R, Morrison D. 1999. Environment and economic costs associated with non-indigenous species in the United States. College of Agriculture and Life Sciences, Cornell University, Ithaca, NY. Robles R, Madsen JD, Wersal RM. 2010. Potential for remote sensing to detect and predict herbicide injury on waterhyacinth (Eichhornia crassipes). Invasive Plant Sci. Manage. 3:440–450. Senseman SA (ed.). 2007. Herbicide handbook. 9th ed. Weed Science Society of America, Lawrence, KS. 186 pp. Slaton MR, Hunt ER, Smith WK. 2001. Estimating near-infrared leaf reflectance from leaf structural characteristics. Am. J. Bot. 88(2):278–284. Thomas PA, Room PM. 1986. Taxonomy and control of Salvinia molesta. Nature 320:581–584. Thorp KR, Tian LF. 2004. A review on remote sensing of weeds in agriculture. Precis. Agric. 5:477–508. [USGS] U.S. Geological Survey. 1998. Landsat 7 Science Data Users Handbook, Revised edition. Earth Resources Observation and Science Center. Sioux Falls, SD. https://landsat.usgs.gov/landsat-7-data-users-handbook. Accessed December 22, 2017. [USGS] U.S. Geological Survey. 2016. Landsat 8 (L8) Data Users Handbook Version 2.0. Earth Resources Observation and Science Center. Sioux Falls, SD. https://landsat.usgs.gov/sites/default/files/documents/Landsat8 DataUsersHandbook.pdf. Accessed December 22, 2017.	b1f28179-c456-42b7-83ca-3fcde4bf76f6	CC-MAIN-2022-21	https://apms.org/wp-content/uploads/japm-57-01-14-full.pdf	2022-05-21T08:54:01+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00286-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet	142,058,090	8,534	eng_Latn	eng_Latn	0.913722	eng_Latn	0.977817	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 4876, 11496, 11954, 17582, 21722, 26172, 28379, 32310, 36140 ]
Agriculture Farm Credit agency says ‘no more loans’ An official of the Farm Credit Administration—the largest farm credit source in the United States—has announced a policy of cutting loans to the farm sector, regardless of impact on agricultural production. George Irwin, chief economist for the agency, told reporters at a farm-credit conference at Mississippi State University during the first week in August: “Farm policy needs to focus on economic forces directly and not compromise the functioning of the credit delivery system... Credit cannot be used to prevent adjustment to forces that alter conditions of American agriculture.” Irwin called for separating farm-credit policy from other farm matters in the upcoming 1985 farm bill process. He said that it was impossible to do anything about “heavily indebted farmers,” and that farm lending should be returned to the private sector. Free Enterprise Economist demands truce with the dope pushers British-born economist Arnold Trebach issued a call in the Wall Street Journal Aug. 2 for legalization of drugs and a “truce” with drug-traffickers. Trebach is director of the National Committee on the Treatment of Intractable Pain and a top propagandist for the legalization of heroin for “medicinal” purposes. “President Reagan’s War on Drugs is a failure,” Trebach wrote. “That is not surprising. Every major effort in the 70-year American crusade against these chemicals has also failed... My hope is that when sensible people look at what further escalation of the drug war would really mean, many of them will join me in declaring we have had enough of drug wars and deciding we can rationally co-exist with a good deal of drug use in our society because we do not have the power to make it go away... “One sensible response to our heroin problems would be close to that now practiced in the United Kingdom, where doctors are allowed to provide heroin and a wide variety of other powerful drugs... “The availability of legal marijuana would destroy demand in our largest illegal market. “Of course, some experts argue that less-strict controls will produce an increase in the use, and, eventually, the abuse of drugs. Perhaps. However, there is strong evidence that there is a natural limit to the number of people who will use any drug, whether or not it is freely available.” Ibero-American Trade Tri-national consortium group formed for trade Latinequip, a tri-national consortium to finance exports of capital goods between Brazil, Argentina, and Mexico, was formed on Aug. 4. Within 90 days, machinery producers in each country will be able to finance their exports to the other two countries. The consortium is made up of three banks managed by the governments of Mexico and Argentina and the State of São Paulo. Though vital for development, capital goods producers in Ibero-America have been badly hit by the depression caused by IMF policies, and have been producing at only 20-50% of their capacity. U.S. “Recovery” Volcker’s manipulations holding up market An actual reading of Paul Volcker’s famous July 25 Senate testimony in which he supposedly created the “Volcker Rally,” reveals that—he didn’t. The Wall Street Journal and the press simply picked several words out of context to prove that the Fed has not and does not plan to tighten credit. But, in fact, Volcker’s testimony repeated demands for budget slashing and threatened more rate rises if there are no slashes. Volcker touted the recovery, then said, “But the hard fact is the deficit remains huge in absolute and relative terms.” The deficit is sucking in foreign funds, and the “sustainability of the process... is in question,” he said. “As the U.S. becomes more and more dependent on foreign capital... interest rate pressures remain strong.” The market, in fact, is only being held up by the most insane of 1929-style stock manipulations. BusinessWeek reports corporate profits rose sharply in the first half of 1984, inflating a consumer and stock-market bubble. The rise in profits is, in part, artificial, totaling tens of billions of dollars attributable to buy-backs of stock by corporations and the fraudulent accounting practices the corporations employ. After selling $29 billion of equities in 1983, companies announced some $60 billion in buybacks in this year’s first quarter, and another $15 billion in the second quarter. Of this total, nearly $10 billion were in leveraged buy-backs. If the buyer borrows the money for the buy-back from the outside, the proceeds of the sale are booked as a gain on the income statement. If the company takes back the debt, interest paid on it flows to earnings. Companies are also using leasing arrangements, whereby they sell an asset to an outside company, and then lease it back. The proceeds of the sale are counted as earnings, swelling profits, and the debt to lease the asset back is counted as operating debt and reduces the corporation’s debt-to-equity ratio. International Trade Soviets continue to stockpile U.S. corn The Soviet Union gobbled up U.S. corn supplies at record rates for the fourth consecutive week, the U.S. Agriculture Department reported on Aug. 6. The Soviets purchased another 100,000 metric tons of U.S. corn, bringing to over 8.5 million tons the total amount of corn and wheat the Russians have purchased since June 29. The Soviets have bought 12.9 million tons of grain since the beginning of the year. The Des Moines Register reported on Aug. 1 that Soviet Trade Representative Albert Melnikov told the National Corngrowers Association meeting in Indianapolis in late July that the Soviets will buy more grain if the United States opens up its domestic markets to Soviet goods. Melnikov said the first step would be to grant most-favored-nation status to the Soviet Union. He said this was important to U.S. farmers because 68% of U.S. exports to the Soviet Union are agricultural products, but the "great disbalance" in this trade "does not encourage the Soviets to stimulate its trade with the United States." Melnikov stopped short of saying the Russians would stop its massive buying spree if most favored nation status were not granted, but reminded the corngrowers that "the U.S. is not the only source of supply now" for farm products. One side effect of the present trade is that the Port of Houston is becoming increasingly dependent on Soviet grain sales for its existence. The Houston Post reported Aug. 4 that the recent increase in Soviet grain sales is the only good news for the Houston port, since much of the grain purchased by the Russians is being shipped from there. According to trade figures, in 1981 2.1 million tons of wheat were shipped from Houston to the Soviets, representing 25.6% of all wheat exports from that city. This year's figures are expected to be significantly higher. --- The Invisible Hand 'Stop U.S. farm parity, build down surpluses' "The parity price system is a notion totally incomprehensible to anyone but a U.S. farmer," a spokesman for the London-based International Wheat Council (IWC) said Aug. 9. The IWC, an inter-governmental organization, manages the International Wheat Agreement which began, in 1971, to impose a supranational, "order" on the grain markets backed by governments, to force individual nations to submit to the grain cartel. "We're working at having the individual nations discuss their individual policies and eventually change them—the first point is that one country should not expand its production when another is building down, and in this way add to the surplus which we're trying to get rid of. A balance must be brought between supply and demand. Countries and national policies must work in the same direction at the same time. Under the previous U.S. administration, we were getting close to getting an agreement, but Reagan's free-market policies stopped it dead in its tracks." "The first step to be taken now is to cut down the surplus production. The worst is that the overpriced U.S. parity prices, which cost a lot of money to the U.S. budget, tend to be trend setters not only for world prices, but also for volumes of output: If people think they can get away with it and sell their production at that price, they will produce more. U.S. target prices on the export price are too high." --- Development Japanese consortium to assist Peru A Japanese consortium will pay for final construction needed at Peru's Cerro Verde II copper project, expected to begin operations within five months, a government spokesman said on Aug. 8. The Mitsui and Marubeni firms of Japan will lend $130 million to Peru to finish the important project, said Sen. Javier Diaz Orihuela, head of the energy and mines commission of the senate. Cerro Verde II, located in the vast copper reserves of southern Peru, will have a processing capacity of 20,000 metric tons of ore a day. Diaz Orihuela said the Japanese loan has a 14-year payback period with three-and-a-half-years grace. The final leg of financing for Cerro Verde had been debated between the Japanese and a British consortium. With the Mitsui-Marubeni loan, the project should be ready to start up operations in January, according to government plans. --- Briefly - BILLY M. DAVIS, running mate of independent-Democratic presidential candidate Lyndon H. LaRouche, as well as LaRouche agricultural advisor Lawrence Freeman of Baltimore, addressed 40 farmers in Dodge City, Kansas, at a meeting of the Kansas state American Agricultural Movement. Davis, a Mississippi-farmer, and Freeman demanded a return to parity pricing. - FRANCISCO Morales Bermudez, former Peruvian President, proposed that Peru set up a free-trade zone in its jungle region bordering Colombia and Brazil, the area where some of the Colombian cocaine mafia has fled to avoid President Betancur's crack-down. Gen. (ret.) Morales Bermudez staged a Kissinger- and Cuban-supported coup against Gen. Juan Velasco in 1975 and then purged nationalists from the government, put the country under an IMF dictatorship, and opened the doors to the cocaine mafia. He has apparently begun fundraising for the 1985 elections. - MARTIN BANGEMANN, West German economics minister, warned on Aug. 8 that his government may prohibit German companies from cooperating with any further tightening of U.S. restrictions on export trade in sensitive technology and equipment. Bangemann had met with U.S. government officials in mid-July in Washington, D.C. Commenting on possible U.S. "extraterritorial" trade restrictions, Bangemann said, "We would not accept that... In the United States, I said I don't share the opinion of the Americans of the problem on technology transfers." - CARL H. LINDNER, chairman of the Penn Central Corporation, Fisher Foods, Inc., and his own company, the American Financial Corporation, has been named chairman of the board of United Brands Company, a company most famous with the public for Chiquita brand bananas. With law-enforcement officials, especially those concerned with narcotics, the company is known for its connections with the import of cocaine and marijuana.	<urn:uuid:92a93b3f-c6f7-443a-a45e-a7a7e51a7a33>	CC-MAIN-2021-49	https://larouchepub.com/eiw/public/1984/eirv11n32-19840821/eirv11n32-19840821_020-business_briefs.pdf	2021-11-29T00:26:43+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00016-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	424,400,509	2,343	eng_Latn	eng_Latn	0.998575	eng_Latn	0.998677	[ "eng_Latn", "eng_Latn" ]	false	docling	[ 5435, 11200 ]
South Central Hispanic District Council of the Assemblies of God Standard Life Insurance Beneficiary Designation Form Section A - General Participant Information (please print) Last Name _______________________________________ First __________________________________ Middle ___________________________________ SS # _________________________________________ Birth date ________________________________ Gender: ❏ Male❏ Female Mailing address __________________________________________________________________________________________________________________________ Street or P O Box City, State, Zip Home phone (____) ___________________________ E-mail _____________________________________________ Credential # ________________________ Section B - Designation of Beneficiaries The following individual(s) shall be my beneficiary(ies). (Please check primary or contingent for each individual beneficiary). If any primary beneficiary predeceases me, the contingent beneficiary(ies) shall acquire the designated share of my account. Name ____________________________________________________________ Phone ________________________________________ ❏ Primary Address _____________________________________________City __________________State ________Zip_____________________ ❏ Contingent Social Security # _______________________ Date of Birth _________________ Relationship _________________________ Share _______% Name ____________________________________________________________ Phone ________________________________________ ❏ Primary Address _____________________________________________City __________________State ________Zip_____________________ ❏ Contingent Social Security # _______________________ Date of Birth _________________ Relationship _________________________ Share _______% Name ____________________________________________________________ Phone ________________________________________ ❏ Primary Address _____________________________________________City __________________State ________Zip_____________________ ❏ Contingent Social Security # _______________________ Date of Birth _________________ Relationship _________________________ Share _______% Name ____________________________________________________________ Phone ________________________________________ ❏ Primary Address _____________________________________________City __________________State ________Zip_____________________ ❏ Contingent Social Security # _______________________ Date of Birth _________________ Relationship _________________________ Share _______% Name ____________________________________________________________ Phone ________________________________________ ❏ Primary Address _____________________________________________City __________________State ________Zip_____________________ ❏ Contingent Social Security # _______________________ Date of Birth _________________ Relationship _________________________ Share _______% Attach additional sheet, if needed, for beneficiary designations. Please check just one: ❏ If a child of mine is listed as a primary beneficiary or contingent beneficiary and fails to survive me, his or her share shall go to my other children in equal shares OR ❏ If a child of mine is listed as a primary beneficiary or contingent beneficiary and fails to survive me, his or her share shall go to his or her issue (my grandchildren) by right of representation. The payor may rely fully on this designation, and I agree to promptly notify the payor if there is any change in the status of any primary or contingent beneficiary. Section C - Signature Participant's Signature____________________________________________________________________________________________________ Date ______________________________ PO Box 7929, Springdale, AR 72766 Phone: 479.756-5858 Email:[email protected] Please keep a copy for your records	<urn:uuid:2a0abab2-71d0-4354-8ed4-0ae17d1d047b>	CC-MAIN-2024-51	https://schdag.org/wp-content/uploads/2024/10/Beneficiary-form-for-South-Central-Hispanic-English-Fillable.pdf	2024-12-13T22:46:39+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00258-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet	457,660,574	609	eng_Latn	eng_Latn	0.77195	eng_Latn	0.77195	[ "eng_Latn" ]	false	rolmOCR	[ 3936 ]
AGENDA PUEBLO AREA COUNCIL OF GOVERNMENTS SEPTEMBER 23, 2021 12:15 P.M. TO 1:30 P.M. PUEBLO COUNTY DEPARTMENT OF EMERGENCY MANAGEMENT 101 WEST 10TH STREET, FIRST FLOOR CONFERENCE ROOM THE PUEBLO AREA COUNCIL OF GOVERNMENTS' (PACOG) MEETING WILL BE HELD IN PERSON AND VIRTUALLY VIA ZOOM (SEE LINK BELOW). Join Zoom Meeting https://zoom.us/j/98163938159 Meeting ID: 981 6393 8159 Dial by your location +1 253 215 8782 US (Tacoma) +1 346 248 7799 US (Houston) +1 669 900 6833 US (San Jose) ROLL CALL PUBLIC COMMENTS (Citizen Comments) CONSENT ITEMS (Carmen Howard, Manager): 1 Minutes of August 26, 2021 Meeting Action Required: Approve/Amend as Mailed 2 Treasurer's Report Action Required: Receive and File August 2021 Financial Report (If you have any questions, please contact Todd Mihelich, MGPM, PC, at 543-0516 prior to the meeting.) REGULAR ITEMS: PACOG TRANSPORTATION HEARING (John Adams, MPO Manager): The Pueblo Area Council of Governments will hold a public hearing regarding the adoption of the Unified Planning Work Program for Federal Fiscal Years 2022 and 2023. The item is set forth in the resolution listed as Regular Item No. 1. A notice of the public hearing for the item was published in the Pueblo Chieftain on September 7, 2021. REGULAR ITEMS (CONT.): 1 A Resolution Adopting the Unified Planning Work Program (UPWP) for Federal Fiscal Years (FFYs) 2022 and 2023 for the Pueblo Area Council of Governments (PACOG) as the Designated Metropolitan Planning Organization (MPO) for the Pueblo Urban Area in Compliance with 23 USC 134, 49 USC 5303, 23 CFR 450 and 500, and 49 CFR 613; and Authorizing and Directing the City of Pueblo in Accordance with the PACOG and City of Pueblo Delegation Agreement dated October 26, 2020 to Administer and Implement this UPWP in Accordance with all Applicable Federal, State, and Local Laws and Regulations Action Required: Approve/Disapprove/Modify 2 Chairperson's Report: (A) Lunch Appreciation Action Required: Thank You to Colorado City Metropolitan District for Providing Lunch 3 Manager's Report (Carmen Howard) 4 Moving Pueblo County Forward - Joe Martinez Boulevard Expansion and Pueblo County Jail (Garrison Ortiz, Pueblo County Board of County Commissioners) Action Required: Presentation 5 Transportation Commissioner or CDOT Region 2 Director's Report (Terry Hart or Richard Zamora) 6 State Transportation Advisory Committee (STAC) Update (Chris Wiseman, PACOG STAC Representative) 7 Status on Southwest Chief Passenger Rail (Chris Wiseman, PACOG Southwest Chief Passenger Rail Representative) 8 MPO Staff Report (John Adams, MPO Manager): (A) A Resolution to Accept the Colorado Department of Transportation (CDOT) Safety Performance Measure Targets for the Pueblo Area Council of Governments (PACOG) Metropolitan Planning Organization (MPO) as per 23 U.S.C. Action Required: Approve/Disapprove/Modify (B) GHG Rule Making Comment Period (Comment Period) Action Required: Informational AGENDA--PACOG Meeting September 23, 2021 REGULAR ITEMS (CONT.): 8 (Cont.) (C) SB260 and MMOF Fund Updates Action Required: Informational (D) 5- and 10-Year Pipeline of Projects Action Required: Informational (E) Other Transportation Matters Action Required: Informational and Discussion, if necessary 9 Other Business 10 Future Agenda Items ADJOURNMENT LRS (The next meeting of the Pueblo Area Council of Governments is to be held on Thursday, October 28, 2021. The meeting will be held in-person and virtually via Zoom.) NOTE: Following the regular PACOG meeting, there will be a joint meeting held between the Pueblo City Council and Board of County Commissioners to appoint three members to the Pueblo Regional Building Electrical Board of Appeals.	<urn:uuid:9bba17ab-ed6f-487e-9ecb-cd8e67d6dc31>	CC-MAIN-2021-49	http://county.pueblo.org/sites/default/files/2021-09/9-23-2021AGN_4.pdf	2021-12-02T01:15:41+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00196-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	14,488,261	952	eng_Latn	eng_Latn	0.764431	eng_Latn	0.79074	[ "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1265, 2973, 3747 ]
132 MAIN STREET STUART VA 24171 https://www.brmre.com This has to be the best commercial location in the Town of Stuart. The brick and block 14,884 sq.ft. building sits on 2.3 level acres of land with one of the few privately owned parking lots. The building is one story with a partial basement. Some interior renovations have been… Commercial Active CALL US NOW Phone: (276) 694-5002 Email: [email protected] Address: 18376 Jeb Stuart Highway P.O. Box 601 Stuart, VA 24171 BASIC FACTS MLS #: 133726 Year built: 1966 Status: Active Listing Office: Blue Ridge Mountain Real Estate, LLC PROPERTY DETAILS Location/Subdivision: County Apx Total Acres: 2.38 Apx Bldg SqFt: 14884 sq ft # Levels: 1 Patrick LOCATION DETAILS County: Patrick County CALL US NOW Phone: (276) 694-5002 Email: [email protected] Address: 18376 Jeb Stuart Highway P.O. Box 601 Stuart, VA 24171	<urn:uuid:0c0c2c33-70b0-4746-b0c1-17fc34881235>	CC-MAIN-2021-10	https://www.brmre.com/property/132-main-street-stuart-va-24171/?es-pdf=11451	2021-03-01T19:23:15+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-10/subset=warc/part-00092-dbb5a216-bcb2-4bff-b117-e812a7981d21.c000.gz.parquet	691,399,372	257	eng_Latn	eng_Latn	0.563666	eng_Latn	0.815819	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 479, 884 ]
Aastrom Announces Collaboration With CPC Clinical Research for the Phase 3 REVIVE Study in Critical Limb Ischemia ANN ARBOR, Mich., May 25, 2011 (GLOBE NEWSWIRE) -- Aastrom Biosciences, Inc. (Nasdaq:ASTM), the leading developer of patient-specific, expanded multicellular therapies for the treatment of severe, chronic cardiovascular diseases, today announced a collaborative agreement with CPC Clinical Research (CPC), a non-profit, academic research organization led by William Hiatt, M.D. CPC will provide services related to the execution of Aastrom's Phase 3 REVIVE clinical studies for ixmyelocel-T, the company's expanded multicellular therapy. "CPC has extensive experience in clinical trials research related to peripheral artery disease and wound healing," said Dr. Hiatt, president of CPC Clinical Research. "We are thrilled to collaborate with Aastrom on what we believe is one of the most welldesigned clinical development programs we've seen for CLI patients. We share their commitment to advancing the REVIVE Phase 3 clinical program for ixmyelocel-T to regulatory approval and to help provide a promising therapy to CLI patients — a population with a significant unmet medical need. Aastrom's clinical development program is a critically important translational step in the development of cellular therapies to treat human disease, a key objective of the University of Colorado Stem Cell Center." CPC will manage and oversee the activities of the Eligibility Review Committee, which will be responsible for identifying and confirming the eligibility of no-option and poor option patients for participation in the REVIVE CLI clinical trials. They will also provide wound core laboratory services. For more than 20 years, CPC has provided services to support clinical trials research programs for many leading pharmaceutical and biotechnology companies. In addition to his role as president of CPC, Dr. Hiatt is the Novartis Foundation endowed professor for cardiovascular research at the University of Colorado School of Medicine, Division of Cardiology, with a clinical focus in vascular medicine. He also serves on the editorial board of the Journal of Vascular Medicine, and has received many awards of excellence including the Julius H. Jacobson II, MD Physician Excellence Award from the Vascular Disease Foundation. About CPC Clinical Research Founded in 1989 by the University of Colorado, CPC Clinical Research is a not-for-profit clinical research and community health organization offering Phase 1 - 4 clinical research services and access to Key Opinion Leaders to sponsors around the world. CPC is affiliated with the University of Colorado Denver School of Medicine, Denver Health and the National Jewish Medical and Research Center. About Aastrom Biosciences Aastrom Biosciences is developing patient-specific, expanded multicellular therapies for use in the treatment of severe, chronic cardiovascular diseases. The company's proprietary cell-processing technology enables the manufacture of ixmyelocel-T, a patient-specific multicellular therapy expanded from a patient's own bone marrow and delivered directly to damaged tissues. Aastrom has advanced ixmyelocel-T into late-stage clinical development, including a planned Phase 3 clinical program to study patients with critical limb ischemia and two ongoing Phase 2 clinical trials in patients with dilated cardiomyopathy. For more information, please visit Aastrom's website at www.aastrom.com. The Aastrom Biosciences, Inc. logo is available at http://www.globenewswire.com/newsroom/prs/?pkgid=3663 This document contains forward-looking statements, including, without limitation, statements concerning clinical trial plans and progress, objectives and expectations, clinical activity timing, intended product development, the performance and contribution of certain individuals and expected timing of collecting and analyzing treatment data, all of which involve certain risks and uncertainties. These statements are often, but are not always, made through the use of words or phrases such as "anticipates," "intends," "estimates," "plans," "expects," "we believe," "we intend," and similar words or phrases, or future or conditional verbs such as "will," "would," "should," "potential," "could," "may," or similar expressions. Actual results may differ significantly from the expectations contained in the forward-looking statements. Among the factors that may result in differences are the inherent uncertainties associated with clinical trial and product development activities, regulatory approval requirements, competitive developments, and the availability of resources and the allocation of resources among different potential uses. These and other significant factors are discussed in greater detail in Aastrom's Annual Report on Form 10-K, Quarterly Reports on Form 10-Q and other filings with the Securities and Exchange Commission. These forward-looking statements reflect management's current views and Aastrom does not undertake to update any of these forward-looking statements to reflect a change in its views or events or circumstances that occur after the date of this release except as required by law. CONTACT: Media contact ``` Agnes Cao Berry & Company [email protected] +1 (212) 253-8881 Investor contact Danielle Spangler The Trout Group [email protected] +1 (646) 378-2924 ```	<urn:uuid:2d10628b-e1f1-4b99-9ee1-4cf5657fac91>	CC-MAIN-2018-47	http://investors.vcel.com/static-files/95881393-62db-4773-899f-3e9b1fb00e24	2018-11-19T15:31:19Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039745800.94/warc/CC-MAIN-20181119150816-20181119172816-00327.warc.gz	171,650,901	1,056	eng_Latn	eng_Latn	0.546606	eng_Latn	0.993692	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 5216, 5404 ]
Springfield College Sequencing Guide English Major (non-teaching) (ENGL) 2020-2021 If you entered in 2020-2021, use this as a guide for sequencing your courses. Requirements are subject to change and may not be offered when listed. Use your online degree audit to verify your progress, and always confirm your plans with your advisor. GenEd Requirements, Electives, and College Requirements In addition to the major requirements listed below, you will need to fill the following General Education (GenEd) categories: * WLPL 100, Exploring Movement & Wellness (1 cr) * Quantitative Reasoning (3 cr) * Aesthetic Expression (3 cr) * Themed Explorations (9 cr) * 200-level Wellness & Physical (1 cr) * Scientific Reasoning (4 cr) * Historical and Social (3 cr) * 300-level Wellness & Physical (1 cr) * Spiritual and Ethical (3 cr) This major typically requires 36 credits to complete. In addition to the GenEd and major requirements listed, you must complete: * 47 elective credits or more (depending on GenEds selected) to total at least 120 credits * The residency requirement—45 credits taken at Springfield College (including 15 of your last 30) * A minimum cumulative GPA of 2.000 or higher ENGL Major Requirements – Typical Second-Year Schedule Fall or Spring: Choose one course (3 credits) from the following: ENGL 251, African American Literature I (3 cr) ENGL 241, American Literature I (3 cr; also fills one WAC requirement) ENGL 261, British Literature I (3 cr; also fills one WAC requirement) Choose one course (3 credits) from the following: ENGL 242, American Literature II (3 cr; also fills one WAC requirement) ENGL 252, African American Literature II (3 cr) ENGL 262, British Literature II (3 cr; also fills one WAC requirement) Plus GenEds, major requirements with flexible timing, or electives (as applicable) to total 30 credits for the year ENGL Major Requirements – Typical Third-Year Schedule Fall or Spring: There are no major requirements specifically recommended for your third year. You should select GenEds, major requirements with flexible timing, or electives (as applicable) to total 30 credits for the year Additional ENGL Major Requirements – Flexible Timing ENGL 377, The History of the English Language (3 cr; typically taken 3rd or 4th year) ENGL 301, Advanced Composition (3 cr; typically taken 3rd or 4th year) Select one course (3 credits) from the following (typically taken 2nd or 3rd year; all choices fulfill a WAC requirement): ENGL 226, Creative Writing (3 cr) ENGL 305, Writing for the Professions (3 cr) ENGL 307, Writing and Reading Fiction (3 cr) ENGL 306, Reading and Writing Poetry (3 cr) ENGL 308, Writing and Reading Creative Non-fiction (3 cr) Select four ENGL courses (12 credits) at the 200- level or above, including at least one (3 credits) at the 300- level or above: ENGL 2___/3___ (3 cr) ENGL 3___/4___ (3 cr) ENGL 2___/3___ (3 cr) ENGL 2___/3___ (3 cr) **EDUC 210, Children's Literature, COMM 234, Newspaper, and ENGL 235, Internship may also be used to fulfill ENGL electives. Note: If offered under different topics, you MAY repeat any of the following courses, and use them to fill selective credits: ENGL 215, ENGL 241, 242, 251, 252, 261, or 262.	<urn:uuid:aa8fb206-93cd-48e7-b2f5-9408bb0c7efb>	CC-MAIN-2022-21	https://pridenet.springfield.edu/ICS/icsfs/ENGL_Sequencing_2020.pdf?target=dc66892b-aa4d-4aba-a1a0-ed3ace1e22ca	2022-05-19T00:00:08+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00294-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet	555,497,057	832	eng_Latn	eng_Latn	0.902316	eng_Latn	0.945935	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2157, 3249 ]
INDIAN INSTITUTE OF INFORMATION TECHNOLOGY SONEPAT भारतीय सूचना प्रौद्योगिकी संस्थान सोनीपत (An Autonomous Institute of National Importance under Act of Parliament) I-Tech, Techno Park, IITD Rajiv Gandhi Education City, Rai, Sonepat-131029 (Haryana) Phone: +91 1302987902, Email: [email protected], website: www.iiitsonepat.ac.in APPLICATION FORM Ph.D Programme for Full Time / Working Professionals- 2024 (Even Semester) Computer Science & Engineering (CSE),Information Technology (IT) , Electronics and Communication Engineering (ECE), Mathematics ACADEMIC SESSION (2024-2025(Even Sem)) The Application Fees shall be as under: Details of Application Fee: (attach proof of payment on the front page of the application) Application Fee can be paid either through – * By UPI/NEFT/RTGS in the following Bank Account as mentioned in the Information broucher. * Demand Draft should be drawn in favor of Indian Inst of Info Tech Society Sonipat" or "IIIT Sonepat" payable at Sonipat or Affix Recent Passport size photograph To, The Ph.D Coordinator IIIT SONEPAT, INDIAN INSTITUTE OF INFORMATION TECHNOLOGY SONEPAT SBIT CAMPUS MEERUT ROAD PALLRI SONEPAT Postal Code:- 131023 PHONE NO:- 0130-2987921 Sir/Madam, I wish to seek admission in IIIT Sonepat and submit the following particulars for consideration: 1. Category of Application (Please tick:✓whichever is applicable) (READ Information broucher for Different category of Admission) 2. Fill All Column of this application Form- * one full time vacant seat under (SF-O)-Visvesvaraya is only for CSE/IT Course to which admission is sought (Please tick:✓whichever is applicable) Ph.D. - (CSE /IT) /Maths/ ECE Personal Details Name Marital Status : (Married / Unmarried Sex: (Male/ Female) Category Admission Category - Full Time and Working Professional Kindly read Information brochure carefully before applying your admission category. Detailed information regarding eligibility criteria and mandatory documents are given there. For filling your choice for admission, you have following admission category. choose carefully. (A) For Full Time Mode there are two Options as 1. (self-financed others) (SF-O) 2. (Project Sponsored) (P-S) 3. Self-financed others (SF-O)- Visvesvaraya **************************************************************************************** (B) For Part Time (working professional Mode) there are two categories Category - (i)- Candidates from Industry 1. (External Industry) (EX-I) 2. (External Industry Sponsored) (EX-IS) Category - (ii)- candidates form Academic Institutions 1. (Self-financed Academics) (SF-A) 2. (Sponsored Academics) (S-A) **************************************************************************************** 5 Fellowship/scholarship/Funding from Private trusts/Private industry/ Government or semi government (If yes, specify details): Details of GATE exam , if any Year of passing : _______________ GATE Score : _______________ Rank : _______________ Details of NET/Equivalent Exam, if any Year of passing : _______________ NET Score : _______________ Rank : _______________ NET or JRF _______________ Details of any other Exam/Score, if any Year of passing : _______________ Exam Name : _______________ Rank : _______________ Mention the area of research (if, any) Specify three to Four keywords for your research area Details of Publications or Patents if any (attach separate sheet if needed.) Educational Qualifications Any other Summary of Experience ( if any) Any Other Information relevant to your application ( Mention briefly) 1. List of Documents (Self Attested copy to be sent with application form): [x] The hard copy of the Prescribed Application Form duly signed on all the pages. [x] 10th Standard Certificate for date of Birth verification. [x] Graduation Mark-Sheets for all years. [x] Graduation Degree Certificate. [x] Post graduation Degree & Mark-Sheets for all semesters. [x] Letter of Consent (Annexure 2) /experience/ Service Certificate from the Employer [x] EWS and OBC Certificate (wherever applicable) issued in the current Financial Year only [x] SC/ST/PwD Certificates (wherever applicable) in prescribed performa [x] Actual DD or original NEFT receipt [x] Annexure 1,2 DECLARATION BY THE CANDIDATE: I, Mr./Ms._________________hereby declare that the information submitted above is correct. If selected, I promise to abide by rules and regulations of the institute in force and amended from time to time. I have read the rules/ordinances of the programme or which I am applying and promise to abide by that. Date: (Signature of the Candidate) Application should be sent by post/hand delivery at the following address The Ph.D Coordinator, INDIAN INSTITUTE OF INFORMATION TECHNOLOGY SONEPAT SBIT CAMPUS MEERUT ROAD PALLRI SONEPAT Postal Code:- 131023 PHONE NO:- 0130-2987921 Note:- 1. The envelope containing the Application Form shall mention on the top in bold "Application for Ph.D. in the "<CSE> & <IT> OR <ECE> OR < Mathematics>" with Modes as- "<Working Professional> OR <Full Time>"candidate name, address and phone number written on it. 2. It is Mandatory to Fill the Google Form as mentioned below along filling this application Link to fill Google Form is https://forms.gle/18UN8LZjt4cK25967 3. The last date for submission of application is 18-11-2024 till 5:00 PM GENERAL APPLICATION GUIDELINES [x] Application Form should be filled neatly and legibly in English only by the applicant in BLOCK LETTERS. [x] The applicant should write his/ her name, father's name, mother's name as given in the School Certificate of Board / University. [x] No column should be left blank in the Application Form. Incomplete Application Forms will be summarily rejected. [x] Latest passport size color photograph should be affixed in the box provided. [x] Application Forms not accompanied with required/requested documents/fee will not be considered further. If admitted, the student will be required to produce original certificates/ documents. [x] After submitting the Application form, no students are allowed to take back their Application form. [x] Submission of the Application Form does not guarantee admission. [x] The applicant has read and understood information Broucher for this call before applying for the Ph.D programe. Annexure-1 STATEMENT OF PURPOSE (SOP) Statement of Purpose (SOP) is an opportunity to share with the admission committee your thoughts and feelings about Ph.D. studies at IIIT Sonepat including your preparation for the same. Briefly describe past project/ research work done by you. Restrict yourself to 500--600 words. The personal SOP will aid the admission committee in evaluating your application. 1) If you are applying for more than one academic discipline, you may include a separate SoP for each discipline. 2) The proposal should contain a) Problem identification / research area, b) A brief review of literature, and c) Methodology. Applicant Name: _______________________________________________ Ph.D. Programme in CSE,IT / ECE / Mathematics / Engish________________________________ Ph.D. Programme mode Full Time / Working professional_______________ Ph.D. Programme mode Category Full Time / Working professional- (EX-I) / (EX-IS)/ (SF-A)/ (S-A)/ (SF-O)/ (P-S)/ (SF-O)- Visvesvaraya ___________________________________ ( Mention your Choice) Annexure-2 LETTER OF CONSENT LETTER OF CONSENT FROM THE EMPLOYER Dear Sir, This is to certify that Shri./Smt./Kum.____________________is an employee of our Company/Organization/College/University since________________and is currently serving as______________________________ (designation) and he/she can pursue his/her doctoral studies in Full Time/working professional mode at IIIT Sonepat in relevant stream/field. Signature & Seal of the Head of the Company / Organization / College / University Dated-	<urn:uuid:56c1cb0b-66ce-46b3-a284-0103e9d86f0a>	CC-MAIN-2024-51	https://iiitsonepat.ac.in/storage/app/public/notices/1-20241028113052.aapplication-form--phd--2024-even-semester-.pdf	2024-12-11T04:04:21+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00284-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet	285,716,031	1,812	eng_Latn	eng_Latn	0.855332	eng_Latn	0.958915	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1036, 1781, 2764, 3466, 3572, 3616, 4976, 6437, 7511, 8025 ]
1525 11th Avenue Construction Update March 2019 Construction Activity In February, the team accomplished the following: * Exterior glazing. * Ongoing building envelope work. Upcoming activities include: * Continued street improvement work along 11th Avenue. * Sidewalk plantings. * Green roof vegetation installation. * Equipment testing, inspections and commissioning. Street and pedestrian interruptions are as follows: 11th Avenue: The west sidewalk on 11th Avenue will be closed for the duration of street work activities. STREET IMPROVEMENT WORK 3/14 - 4/1 Street work will be occurring throughout March along 11th Avenue from Pike Street to Pine Street. The street will be reduced to one northbound lane from 7 a.m. to 3:30 p.m., Monday through Friday. Periodic noise and vibration is to be expected throughout the duration of these activities. Although all parking on 11th is anticipated to be closed for the duration of street work activities, our team is working diligently to mitigate these impacts and potentially reopen parking adjacent to the project after 3:30 p.m. Safety Please be aware that traffic to and from the site will be increased due to green roof vegetation, planting and sidewalk work. The west sidewalk on 11th Avenue is closed during working hours. Flaggers will be present to facilitate vehicles entering and exiting the site. About the Project Sellen is partnering with Legacy Commercial and Ankrom Moisan Architects to deliver Legacy Capitol Hill at 1525 11th Avenue. We are committed to being a good neighbor from start to finish. Please do not hesitate to contact us if you have questions or concerns. SUBSCRIBE Visit our website to subscribe to future project updates and communications: www.sellen.com/1525_11th SCHEDULE October 2017 to Spring 2019 CONTACT US Scott Mackie, Senior Superintendent 206.391.9140 \| [email protected] Project Email Inbox [email protected] 1525 11th Avenue Street Improvement Work Mar. 14 - Apr. 1	<urn:uuid:f68edf21-5c24-4e1a-91d0-9848c7564014>	CC-MAIN-2019-22	https://www.sellen.com/wp-content/uploads/1525-March-2019.pdf	2019-05-25T23:20:08Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232258453.85/warc/CC-MAIN-20190525224929-20190526010929-00285.warc.gz	912,947,155	439	eng_Latn	eng_Latn	0.997548	eng_Latn	0.997074	[ "eng_Latn", "unknown" ]	false	rolmOCR	[ 1927, 1988 ]
November 25, 2023 To, Department of Corporate Services BSE Limited 25th Floor, P. J. Tower, Dalal Street, Fort, Mumbai- 400 001 Security ID: LESHAIND Security Code: 533602 Dear Sir/Madam, Sub: Disclosure of material events required under regulation 30 read with SEBI Circular CIR/CFD/CMD/4/2015 dated 9th September, 2015 – Resignation of Mrs. Leena Ashok Shah as an Additional Executive Director of the company. Pursuant to Regulation 30 of SEBI (Listing Obligations and Disclosure Requirements) Regulations, 2015 read with SEBI Circular No. CIR/CFD/CMD/4/2015 dated September 9, 2015, we wish to inform that Mrs. Leena Ashok Shah, Additional Executive Director of the Company has resigned from the post of an Additional Executive Director of the Company with effect from November 19, 2023 due to health issue. The Company has received her resignation letter dated November 19, 2023. Please take the same on your records. Thanking you, Yours faithfully, For, Lesha Industries Limited Shalin A. Shah Director DIN: 00297447 SHALIN ASHOK SHAH 7th Floor, Ashoka Chambers, Mithakhali Six Roads, Ahmedabad - 380 006. Phone : +91 - 79 - 26463227 Web: www.lesha.in E-mail : [email protected] CIN: L27100GJ1992PLCO18607 November 19, 2023 To, The Board of Directors Lesha Industries Limited 7th Floor, Ashoka Chambers, Opp.HCG Hospital, Mithakhali Six Roads, Ahmedabad – 380 006, Gujarat. Sub: Resignation from the office of Executive Director of the Company. Dear Sir, I, Leena Ashok Shah (DIN: 02629934), hereby tender my resignation from the office of Additional Executive Director of the Company, due to Health issue, with immediate effect i.e. November 19, 2023. I request you to kindly take the resignation on record. I would like to thank all my esteemed Board members for extending their support and cooperation during my association with the company. Further, I request you to complete all the formalities with regard to my resignation including filling of required forms with the Ministry of Corporate Affairs and intimating to other relevant authorities as may be required. Thanking You. Yours faithfully, Leena Ashok Shah Additional Director DIN: 02629934	<urn:uuid:9ea8cb12-43d5-49a7-943c-832222b90fc6>	CC-MAIN-2024-46	http://lesha.in/wp-content/uploads/2024/02/Reg_30_Resignation_of_Director.pdf	2024-11-09T12:18:54+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-46/subset=warc/part-00046-65a16d46-7179-4f3c-849a-3216b203b23b.c000.gz.parquet	14,966,329	569	eng_Latn	eng_Latn	0.90558	eng_Latn	0.93591	[ "eng_Latn", "eng_Latn" ]	false	docling	[ 1219, 2176 ]
2013 PCISA Silver PCCs A-div Series Standing - 7 races scored Regatta results saved: Sunday, April 21, 2013 10:18:12 PM PDT Division: FJ (24 boats) (top) Total Principal Race Officer: Jeff Zarwell Jury Chair: Forrest Gay Version 5.6: Regatta scoring by JavaScore, an Open Source project available at http://www.gromurph.org/javascore 2013 PCISA SIlver PCCs B-div Series Standing - 7 races scored Regatta results saved: Monday, April 22, 2013 12:03:23 PM PDT Division: FJ (24 boats) (top) Pos 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Poly Total Pos 15 16 17 18 19 20 21 22 23 24 Principal Race Officer: Jeff Zarwell Jury Chair: Forrest Gay Version 5.6: Regatta scoring by JavaScore, an Open Source project available at http://www.gromurph.org/javascore	<urn:uuid:6d1380fd-ce04-48cc-abb5-6ba899726e4d>	CC-MAIN-2019-04	https://pcisa.hssailing.org/documents/2012-2013-results/2013_Silver_PCCs_FINAL_RESULTS.pdf	2019-01-24T10:16:32Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547584520525.90/warc/CC-MAIN-20190124100934-20190124122934-00100.warc.gz	599,862,222	259	eng_Latn	eng_Latn	0.707294	eng_Latn	0.698122	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 159, 343, 559, 788 ]
Victorian Residential Efficiency Scorecard The Victorian Residential Efficiency Scorecard (the Scorecard) is: * A house energy rating program - released in 2017 across Victoria. * Aimed at existing houses, but can be used on new builds, including plans. * Delivered by accredited assessors only. * Designed to provide the householders or property manager with tailored advice on energy performance and options for improvement. The Scorecard process * The assessor visits the home and enters data into the Scorecard tool. * A certificate is produced once the information input is complete. * The assessor explains the results and discusses options to improve the rating and/or comfort. * The assessor can offer or refer the customer for upgrades or other services. * Over 2,000 Scorecard assessments completed to February 2019 * 39 Scorecard assessors accredited * Comprehensive quality assurance program * Evidence requirements * Telephone surveys * Audits Scorecard fast facts Scorecard: * Assists with adapting homes to climate change * Improve occupant health in extreme weather conditions * Helps alleviate the stress associated with difficulties paying bills Scorecard and Smart Urban Futures Energy Savvy Upgrades Purpose Assess and upgrade 700 homes of vulnerable or disadvantaged households across Victoria Objectives * Reduce the energy costs of participating households * Reduce energy consumption and greenhouse gas emissions * Improve comfort levels * Improve energy literacy Energy Savvy Upgrades Opportunities to participate \| Area \| Timing \| Request for Tender Out \| \|---\|---\|---\| \| City of Greater Dandenong and surrounds \| November 2018 to May 2019 \| Closed \| \| City of Greater Bendigo \| April 2019 to August 2019 \| Closed \| \| Victoria wide \| July 2019 to November 2020 \| Early March 2019 \| \| City of Ballarat and Shires of Golden Plains, Hepburn, Moorabool and Pyrenees \| July 2019 to February 2021 \| Early March 2019 \| \| Cities of Brimbank and Hume \| June 2020 to February 2021 \| February 2020 \| * General Scorecard information – www.energy.vic.gov.au/energy-efficiency/residentialefficiency-scorecard * Energy Savvy Upgrades program manager – Romney Bishop at [email protected] or 9637 8232	<urn:uuid:a6f75937-44d5-4942-9ef5-8174b36b954c>	CC-MAIN-2021-49	https://www.mav.asn.au/__data/assets/pdf_file/0015/22470/SUF-2019-2.4d-PECHAKUCHA-Romney-Bishop-DELWP.pdf	2021-12-02T07:13:43+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00244-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	887,740,157	508	eng_Latn	eng_Latn	0.88128	eng_Latn	0.978614	[ "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn" ]	false	rolmOCR	[ 42, 428, 767, 983, 1206, 1501, 2031, 2237 ]
OFFICE OF THE GOVERNOR Certificate of Recognition Presented To; Cody Whipple In Appreciation For Your Hard Work And Dedication During The Transition Of This Administration Public Safety February 01, 2007 Date Jim Gibbons, Nevada Governor	<urn:uuid:9f34d92a-4ea8-4c1e-b8f8-d5c4b9857abd>	CC-MAIN-2018-43	http://rebelcomm.com/forms/Transition_Team.pdf	2018-10-22T19:21:53Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583515375.86/warc/CC-MAIN-20181022180558-20181022202058-00464.warc.gz	293,448,146	59	eng_Latn	eng_Latn	0.758192	eng_Latn	0.758192	[ "eng_Latn" ]	false	docling	[ 243 ]
Hong Kong Exchanges and Clearing Limited and The Stock Exchange of Hong Kong Limited take no responsibility for the contents of this announcement, make no representation as to its accuracy or completeness and expressly disclaim any liability whatsoever for any loss howsoever arising from or in reliance upon the whole or any part of the contents of this announcement. Sino Vision Worldwide Holdings Limited 新維國際控股有限公司 (Incorporated in the Cayman Islands and continued in Bermuda with limited liability) (Stock Code: 8086) COMPLETION OF THE ISSUANCE OF CONVERTIBLE BONDS UNDER GENERAL MANDATE Reference is made to the announcements of Sino Vision Worldwide Holdings Limited dated 1 September 2021 (the "Announcement") in relation to the proposed issuance of convertible bonds under general mandate. Unless other stated, capitalised terms used herein have the same meanings as those defined in the Announcement. The Board is pleased to announce that all Conditions under the Subscription Agreement were fulfilled and the Completion took place on 10 September 2021. The Bonds with the principal amount of HK$8,000,000 were issued to EAI Management Consultant Limited in accordance with the terms of the Subscription Agreement. By order of the Board Sino Vision Worldwide Holdings Limited Lo Pak Ho Chairman Hong Kong, 10 September 2021 As at the date of this announcement, the executive Directors are Mr. Lo Pak Ho, Mr. Bai Long and Mr. Huang Qing and the independent non-executive Directors are Ms. Liu Pui Shan, Mr. Chiam Tat Yiu and Ms. Xu Yilei. – 1 – This announcement, for which the Directors collectively and individually accept full responsibility, includes particulars given in compliance with the GEM Listing Rules for the purpose of giving information with regard to the Company. The Directors, having made all reasonable enquiries, confirm that to the best of their knowledge and belief the information contained in this announcement is accurate and complete in all material respects and not misleading or deceptive, and there are no other matters the omission of which would make any statement herein or this announcement misleading. This announcement will remain on the "Latest Company Announcements" page of the GEM website at http://www.hkgem.com for at least 7 days from the date of its publication and on the website of the Company at http://www.sinovisionworldwide.com. – 2 –	<urn:uuid:d9b2b351-109e-4703-96d2-789ac9383368>	CC-MAIN-2021-39	http://sinovisionworldwide.com/admin/file/pdf/investor_relations/announcements/20210911124014-1.pdf	2021-09-19T01:32:14+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-39/subset=warc/part-00257-f465d820-0362-4c4c-a396-c69f5fd24cc4.c000.gz.parquet	56,844,179	490	eng_Latn	eng_Latn	0.991101	eng_Latn	0.99145	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1567, 2409 ]
ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS JSP 403 Volume 3 Edition 1 Change 3 Chapter 4 ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS GENERAL 0401. Aim. The aim of this chapter is to detail the policy and principles for the safety of Rotary Wing Crew Served Weapons (RWCSW) engagements on Defence Land Ranges worldwide 0402. Definition. Crews served weapons are pintle mounted and fired from helicopter doors and/or ramps; they are aimed and operated by a crew member other than the flying pilots/observer/Weapons Systems Operator (navigator) in the front crew positions. Handheld weapon systems can be fired from helicopter doors and/or ramps by Special Forces (SF) personnel, SASC qualified snipers or Fleet Protection Group Royal Marine personnel (Maritime Sniper Teams) but are not classed as RWCSW. 0403. Lead. The Rotary Wing Air to Surface Working Group is the lead for coordinating the MOD procedures for RWCSW engagements. As the Defence Competent Authority, Joint Helicopter Command Headquarters (JHCHQ) provides the Chairman and Secretary for the Rotary Wing Air to Surface Working Group (RWASWG) which reports through the Air to Surface/Surface to Air Working Party (ASSAWP) to the Defence Land Ranges Safety Committee (DLRSC). 0404. Competent Authority. RWCSW are classified as Personal, Individual or Support weapons. Director Infantry (DInf) is the Defence Competent Authority for RWCSW and is the awarding body for skill at arms and range qualifications required for their use. 0405. Range Use. RWCSW live firing is only to take place on ranges authorized and operated in accordance with JSP 403. SAFETY 0406. The safety of personnel, property and livestock is paramount and the ultimate responsibility for the airborne safe practice rests with the RCO who may also be the aircraft commander. The following practices are to be adhered to at all times: a. Clear Range Procedure. Steps are to be taken, in so far as is reasonably practicable, to ensure that the Range Impact Area/Zone is clear of unauthorised personnel, livestock and traffic before firing or hazardous training commences; and that it remains clear for the duration that the hazard exists. Sentries, vedettes, radar, closed circuit television surveillance, or a combination thereof, may be used to satisfy clear range procedures. These measures are to be laid down in Range Standing Orders. Clear Range Procedure is defined in Volume IV. b. Ballistic Safety Traces. Only Weapon Danger Areas (WDA)/Hazard Impact Area Traces (HIAT) recommended by the Defence Ordnance Safety Group (DOSG), approved by the Service/Agency chain of command and authorized by the relevant Integrated Project Team (IPT) in the DE&S may be used for RWCSW engagements on ranges. JSP 403 Volume 3 Edition 1 Change 3 ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS c. Laser Safety. Laser Safety Clearances are to be obtained by the relevant Service/Agency chain of command. Lasers are not to be employed unless a clearance is held by the range. RANGE CONTROL 0407. Air to surface gunnery is only to be carried out on a range with the approval of the Range Safety Officer (RSO) or the Range Safety Officer (Air Traffic Control) (RSO(ATC)). The conduct of live firing practices is the responsibility of the user unit which provides the Range Conducting Officer (RCO). a. RSO. The RSO, a member of the Range Staff, is the person who has the overall responsibility for the safe operation of a particular range and is responsible for the clear range procedure. b. RSO(ATC). The RSO(ATC) on dedicated Air Weapons Ranges (AWR) is an officer or senior NCO of the Air Traffic Control Branch who holds a minimum endorsement of TC(AWR)L. The RSO(ATC) has overall responsibility for the safe execution of a particular range detail and for the co-ordination of the practice should more than one user be on the range. c. RCO. The RCO is the qualified, current and competent person who is appointed by the Exercise Director/Commanding Officer/Head of unit or organisation to be responsible for the safe conduct of firing in accordance with the relevant Service/Agency range instructions. d. DE&S/TEST. Range control at DE&S/TEST ranges will be in accordance with the relevant Range Standing Orders and with the Trial Specification where applicable. e. Sea Ranges. Air-to-surface firing entirely over the sea, in other than designated ranges, is to be conducted in accordance with single service regulations. 0408. Qualification. For air-to-surface firing to take place, Gunners must be either qualified and current, or firing under the supervision of the relevant Service air to surface gunnery instructor. The following personnel are qualified to act as air-to-surface gunnery instructors on the ranges specified: a. RN: Helicopter Warfare Instructors(HWI) on RN ranges and on dedicated AWR. b. Army 1 : Air Door Gunner Instructor(ADGI) on all ranges. c. RAF: Air Gunnery Instructor(AGI) on dedicated AWR. 0409. Currency. Gunners are not to fire unless they are deemed current in accordance with individual Service regulations, are undergoing initial training or are regaining currency under supervision of a suitably qualified Air to Surface gunnery instructor. T&E operations are to be in accordance with the Trial Specification. PREPARATION AND SUPERVISION 1 This includes members of the RM who have completed an appropriate course of training with the Army. ROTARY WING (CREW SERVED WEAPON) JSP 403 Volume 3 ENGAGEMENTS Edition 1 Change 3 0410. The RCO wil be responsible for the planning, preparation, briefing, safe conduct and supervision of air to surface live firing practices. 0411. The RCO will ensure that: a. A suitable range is identified, booked and liaison established. b. The RSO/RSO(ATC) has access to the relevant WDA/HIAT. c. The WDA/HIAT has been applied to the satisfaction of the Range Staff for that range. d. The firer has completed all appropriate training and is under the supervision of a Safety Supervisor. e. A full safety brief is given to all those who will be on the range during the firing period. f. A detailed range brief and air gunnery exercise safety brief is conducted. As a minimum, these briefs should include the following points: Weapon Safety Laser Safety Communications Voice Procedures Range clearance Maximum height & speed of aircraft. Circuit Patterns/Profile Movement box and firing line identification Dry/Live/Hot Runs Arcs & Arc markers Refuelling location Loading Arming Firing Targets Stop actions Actions on - Weapons Misfires/Stoppages Limitations Emergencies Debrief and Reports Accident/Incident Procedures g. An armourer and/or AT is to be either present or available in accordance with JSP 403 Volume 3 Edition 1 Change 3 ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS regulations applicable to the weapon type. 0412. The following conditions apply to all air to surface RWCSW live firing on to ranges: a. Weapon safety catches are to be kept in the SAFE position until the aircraft is in such a position that any deliberate or accidental firing would result in all rounds impacting in the RDA. b. The weapon is not to be selected to LIVE until a clearance has been given by the RCO or RSO(ATC). c. Weapons may not be fired until the correct target has been positively identified and confirmed by the firer and Safety Supervisor. d. Safety catches are to be applied after each weapon event. e. It is the responsibility of the aircraft Commander to ensure that the maximum height and speed stipulated for the WDA are not exceeded. 0413. Laser. Non-eye safe lasers are to be treated as live weapons since direct, diffuse, wet target and specular laser reflections can be dangerous. Further details are in Chapter 2 and in Volume I, Chapter 9 of this JSP. COMMUNICATIONS AND CONTROL 0414. Radio. Radio calls are to be in accordance with Reference S. Definitions of standard terminology used on ranges are given in Annex A to Chapter 7. Calls may be classified as mandatory or advisory. a. Mandatory Radio Calls. The following occurrences are to be requested or reported: (1) Joining the range – requested by aircraft Commander. (2) Clearance to join – given by RCO or RSO(ATC). (3) Clearance to use the laser – given by RCO or RSO(ATC). (4) Clearance to live fire – given by RCO or RSO(ATC). (5) Stopping of live firing – given by RCO or RSO(ATC). (6) Confirmation that the weapons are unloaded and cleared by inspection – given by Safety Supervisor. (7) Passing of essential traffic information and precautionary warnings – given by RCO or RSO(ATC). b. Advisory Radio Calls. It is only advisory that the following information is transmitted: (1) Aircraft position on the range – given by aircraft Commander. (2) Weapon scores – given by RCO or RSO(ATC). ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS JSP 403 Volume 3 Edition 1 Change 3 LOSS OF COMMUNICATION 0415. Loss of Communication. In the event of loss of communications the following actions are to take place: a. The gunner is to cease firing. b. The Safety Supervisor is to ensure that all weapons are unloaded and cleared by inspection, with the weapon pointed in a safe direction at all times. c. The practice is to be terminated and the RCO informed at the earliest opportunity. ARMAMENT ANOMALOUS OCCURRENCES 0417. In the event of an armament or laser anomalous occurrence, including a negligent discharge, the following actions are to be implemented: a. Ascertain the status of the weapon and if unsafe, place the weapon in a safe condition. If this is not possible or doubt exists about status, ensure the weapon remains pointed in a safe direction. b. Report nature of malfunction and weapon status to the RCO and RSO/RSO(ATC). c. Land at pre-nominated landing point and shut down. d. Brief armourer/AT and verbally handover weapon. e. Submit Initial Report in accordance with Range SO, if required. JSP 403 Volume 3 Edition 1 Change 3 ROTARY WING (CREW SERVED WEAPON) ENGAGEMENTS Intentional blank page	<urn:uuid:bd5040d8-6644-4075-b737-cf7ed944cf80>	CC-MAIN-2021-17	https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/33896/JSP403_Vol3_Pt1_Chap4v1_3.pdf	2021-04-11T04:13:19+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-17/subset=warc/part-00055-74237c22-0523-49c6-9e5a-6b4aa471a042.c000.gz.parquet	235,080,582	2,305	eng_Latn	eng_Latn	0.845202	eng_Latn	0.989906	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2750, 5431, 6748, 8824, 9944, 10052 ]
ACTION! Series Concept "ACTION!" chronicles the life of wanna-be director BLAKE JOHNSON, 13, who loves movies – especially movies with lots of explosions, monsters, mayhem and/or ACTION! However, Blake doesn't just watch movies – he makes them, usually with the help of his trusty best friend, EUBIE WINKERTON, and his lackey – er, little brother – ADAM, 8. Blake has a huge crush on the girl next door – GLORIA, 15 – but she refuses to associate with him, let alone be in one of his lame movies. Eubie is head-over-heels for Gloria's best friend WREN – who, naturally, thinks he's an idiot. The main plot of each show revolves around the usual trials and tribulations of being a dorky kid – such as chasing girls and dodging bullies -- but with the added comedy hook of trying to get a movie made – almost always incompetently. In the vein of i-Carly, "ACTION!" fits perfectly into today's interactive, wired fan base, with plenty of on-line tie-ins (including movie-making "how-to"s). CONTACT: Neal Havener, 614.264.6669, [email protected] Unlike i-Carly, "ACTION!" is aimed at a target audience of young boys (8 to 13) first, THEN young girls (8 to 13). It also has mainstream breakout possibility because of the adult characters who regularly appear on the show with their own issues and stories. Like i-Carly, the show has a huge potential in music marketing and other commercial tie-ins. Life lessons are rarely learned, Blake's movies don't get any better over time, and yet – hope springs eternal. After all, there's always another contest to enter or some crazy way to fix that teensy little problem in the script.	<urn:uuid:0cde8dc2-09bf-4510-a39f-04861faadf06>	CC-MAIN-2018-30	http://prettyegg.org/files/ACTION_concept_sheet_102111.pdf	2018-07-21T03:25:00Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-30/segments/1531676592309.94/warc/CC-MAIN-20180721032019-20180721052019-00527.warc.gz	305,615,325	402	eng_Latn	eng_Latn	0.999027	eng_Latn	0.999043	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1058, 1649 ]
Europe Solidaire Sans Frontières > English > Movements > Common Goods & Environment (Movements) > Climate (Movements) > Does Extinction Rebellion have a race problem? Does Extinction Rebellion have a race problem? Sunday 1 December 2019, by GAYLE Damien (Date first published: 4 October 2019). Critics say group is not doing enough to involve people of colour, or expose links between climate crisis and inequality It was just a tweet, and whoever sent it probably didn't think much about it. It was a sunny day in July and environmental activists had blocked the Strand with a big blue boat. "Live from the royal courts of justice," Extinction Rebellion London wrote. "It has been announced that all protesters arrested during the April rebellion will be prosecuted. We are asking the police and legal system to concentrate on issues such as knife crime, and not non-violent protesters who are trying to save our planet." For those with ears tuned to hear it, the dogwhistle sounded clear. Stop bothering us non-violent protesters; focus instead on those frightening inner-city neighbourhoods, where black children carry knives. "It was feeding into a racist narrative," says Guppi Bola, an activist with the Wretched of the Earth, an environmental group that focuses on black, brown and indigenous voices. "When those kinds of things come up, then of course you are not going to feel welcome." In less than a year, Extinction Rebellion (XR) has established itself as one of the UK's highest-profile environmental campaign groups. Its mass civil disobedience protests have helped raise concern over green issues to a record high. Its representatives have met government ministers and spoken to MPs. On Monday, it promises to start shutting down Westminster "for as long as it takes" to achieve its three main goals: for the government to tell the truth about the climate emergency; for the UK to cut its greenhouse gas emissions to net zero by 2025; and for citizens' assemblies to devise policy to tackle the crisis. But from the start XR has faced questions over its ability to reach out to diverse communities. Some critics go further, suggesting its tactics, its framing of key issues and a series of communications missteps show a carelessness around issues of race – or even institutional racism. As climate anxiety increases, XR says it has listened to the criticisms and is prepared to make changes in order to reach as many people as possible. But why is the movement so white? Why is that a problem? And what can be done to change it? XR's lack of diversity is not unique to the wider environmental movement – a "white middle-class ghetto", in the words of one NGO chief, with research in 2017 finding the "environment profession" – including workers at green NGOs – was the second least diverse of all sectors in the UK, after farming. So when a small group of activists got together in a Stroud living room last year to found a radical environmental movement, it was no surprise that they were white, or that they have gone on to create a movement in their own image. With many of its key activists from rural or semi-rural areas, Extinction Rebellion rolls into town like the left wing of the Countryside Alliance. The protest culture of its core supporters is rooted in a new age hippy aesthetic of paisley robes, circus skills, camping, roll-ups and psytrance music. "Outside of environmental thinktanks and environmental organisations, grassroots organising is often very isolating for people of colour, particularly in the kinds of cultures or activities that are decided on," Bola said. "They lack inclusive cultures." Protest groups often meet in pubs, which can be alienating for Muslims, she points out. Actions often involve "conditions people are not very comfortable with", such as hiking or camping. Britons from an ethnic minority background are less likely to visit the natural world, research suggests "they might not have the kit". So while people from black and minority ethnic groups have been spokespeople for XR, and have taken part in actions, Metropolitan police statistics show that nine in 10 of the 1,100 activists arrested in the group's April protests in London were white –a city in which four in 10 residents are not. "Instead of using your privilege to get arrested, how about using it to stop other people getting arrested" A central plank of XR's campaign strategy is to sacrifice as many activists to arrest as possible. Its supporters use a range of non-violent tactics to cause disruption and gain attention, then – in contrast to protest movements of the past – they allow themselves to be arrested without resistance. They believe it is because of that sacrifice – the willingness to be arrested and go to prison – that people will take their message seriously. But it is a strategy that many black activists say they cannot adopt. "The way they conceptualise the police and the state, and being arrested, alienates a lot of people of colour, a lot of migrant people," said Susuana Amoah, an environmental activist from Brighton who has run workshops on the green movement's approach to race. "They have so much faith in the system to be on their side and not send them to prison, or not send them to prison for long. And the bravery around that. People of colour can't do that. It won't happen for us. In an open letter published in May, XR was challenged by the Wretched of the Earth to rethink its message and strategy to take into account "an ongoing analysis of privilege, as well as the reality of police and state violence". Bola helped to draft that letter. "I do remember the response from XR's Twitter … which was 'people of colour are more harshly impacted by a police society and the judicial system and so it is the role of white people to stand up for them and take the lead'," she said. "I was like, 'Um, I mean, I guess so'. And I guess in a strategic, well-organised aligned action that would involve people of colour at the start of the decision-making process." Or, as another activist put it to the Guardian: "Instead of using your privilege to get arrested, how about using it to stop other people getting arrested?" Initial messaging from the group eschewed issues of race or the idea of intersectionality – where environmental issues are considered in connection with those of race, poverty, class and misogyny – as divisive and likely to alienate more potential supporters than they would attract. There was an effort to present the environment issue as "beyond politics" and to use language that could attract those on the right as much as the left. As a result, no one apparently thought to raise the alarm when the committee drafting the group's founding document – a "declaration of rebellion" read out in Parliament Square last November – decided it should raise fears of "mass migration". "There is a real threat of far-right xenophobia being fuelled through the narrative of climate change," Bola said. The fear is that such rhetoric could prefigure a populist turn to eco-fascism – an end that Gail Bradbrook, XR's co-founder, has said is among her greatest fears for the future. At the core of XR's message is the idea that humanity is running out of time. "If we do not act now, we face extinction," one early press release asserted. "At the very least we will witness the breakdown of society as we know it." But as critics have pointed out, the very real effects of climate change and environmental destruction are already being felt by billions of people. "Extraction of the Alberta tar sands has been happening for 50 years," said Suzanne Dhaliwal, whose No Tar Sands campaign was the first in the UK to highlight the struggles of indigenous people in Canada. "So when you talk about it as some future situation it means that the responsiveness to climate catastrophes and events isn't even thought of as part of consciousness work. It's all about white middle-class people protesting about something that might happen." Priyamvada Gopal, a University of Cambridge don and antiracism campaigner, said: "There has certainly been a perception among people of colour that [XR] is white-led and sometimes inadequately cognisant of concerns around race, migration, empire and so on. "However, my sense is also that because it is a growing movement that is bringing different kinds of people onboard, particularly younger people, important discussions around race and geopolitics are starting to happen and that is welcome." One of those younger people is Daze Aghaji. She says XR has suffered from its lack of diversity and has made mistakes, particularly in its early stages, but she points out they were more the result of ignorance than malice. In particular, she says, critics have misunderstood XR's mass-arrest strategy. "The idea of being arrestable and non-arrestable, people think [these] are problematic terms, but they're not," said Aghaji. "For example, I'm personally non-arrestable, and this is a decision that should be made by every individual. I understand that, being a black woman, the police are not going to [treat me the] same as a 40-year-old white woman. So I'm not going to put myself in that position. And within XR you're not forced to." "As a black woman, the police are not going to treat me the same as a 40-year-old white woman – Daze Aghaji" According to Aghaji, more diversity can be found within XR's youth wing. "XR Youth is really based on talking about indigenous communities, and the global south is our centring of what we talk about and how we express ourselves. And the way we connect to the climate emergency is very much in the line of more climate justice than the main XR." On Thursday, at a press briefing for XR's planned mass demonstrations that start on Monday, activists from ethnic minorities were much more prominent. The event was opened by the Asian environmentalist Zion Lights, who spoke of the struggles of indigenous communities. Next week's demonstrations will also include a "climate justice" bloc, where activists explicitly draw the connections between ecological destruction, racism and inequality. Others are also trying to force change from within. When the movement expanded to the US, activists there decided to include a further demand to the three that were laid out at the group's inception in the UK: for a "just transition that prioritises the most vulnerable and indigenous sovereignty [and] establishes reparations and remediation led by and for black people, indigenous people, people of colour and poor communities for years of environmental injustice." Now activists are agitating to have that demand included in XR UK's agenda. Around the world it is the poorest and the blackest who are suffering the worst effects of the destruction of the natural world. More than 90% of pollution deaths occur in low- and middle-income countries, mainly in Asia and Africa. In England, it is the most ethnically diverse neighbourhoods that are the most polluted. Yet people of colour in Britain remain less environmentally conscious than their white counterparts. Research last year by the NUS showed that students who identified as other than white were less likely to engage with environmental issues, and less likely to have changed their behaviour – such as using reusable cups – out of environmental concerns. It is a tendency that Benjamin Zephaniah, the radical poet, musician and activist, has encountered through his work in universities. "Most of the black students and the Asian students are saying my priority is just to stay safe and get on, and get this grade, and kind of better my family, and move on," he told the Guardian. "It frustrates me because I want to tell them that it's all connected. What good is your grade if you've got no planet?" Zephaniah does not lay blame at the feet of climate activists for failing to reach out. "OK, it's a lot of mainly young white people getting together and they're protesting in a way that's culturally relevant to them," he said. "You can't blame them for that. If they started growing dreadlocks and saying, 'Yeah people, come join us' you would claim cultural appropriation. They are doing it how it's culturally relevant to them, that's why I'm saying we should take our steel bands down, we should take our sound systems down." Zephaniah points out that change is not going to come without people of colour joining the demonstrations. "What would Malcolm X think of this? We're sitting around, waiting for white people to invite us in the struggle." This article was amended on 9 October 2019 because an earlier version incorrectly referred to Priyamvada Gopal as an Oxford University don. She is at the University of Cambridge. Damien Gayle Click here to subscribe to our weekly newsletters in English and or French. You will receive one email every Monday containing links to all articles published in the last 7 days. P.S. The Guardian https://www.theguardian.com/environment/2019/oct/04/extinction-rebellion-race-climate-crisis-inequ ality	<urn:uuid:4d9a26b4-243d-4f36-84fc-7673edf37a18>	CC-MAIN-2024-33	https://europe-solidaire.org/spip.php?page=spipdf&spipdf=spipdf_article&id_article=51326&nom_fichier=ESSF_article-51326	2024-08-08T20:27:31+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-33/subset=warc/part-00295-4f628544-3cdf-4526-86aa-bdfa0b33cdc9.c000.gz.parquet	189,894,017	2,697	eng_Latn	eng_Latn	0.998633	eng_Latn	0.999585	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2860, 6215, 9742, 12790, 13110 ]
Computer Architecture Lecture 8: Computation in Memory III Prof. Onur Mutlu ETH Zürich Fall 2019 11 October 2019 Sub-Agenda: In-Memory Computation - Major Trends Affecting Main Memory - The Need for Intelligent Memory Controllers - Bottom Up: Push from Circuits and Devices - Top Down: Pull from Systems and Applications - Processing in Memory: Two Directions - Minimally Changing Memory Chips - Exploiting 3D-Stacked Memory - How to Enable Adoption of Processing in Memory - Conclusion Several Questions in 3D-Stacked PIM - What are the performance and energy benefits of using 3D-stacked memory as a coarse-grained accelerator? - By changing the entire system - By performing simple function offloading - What is the minimal processing-in-memory support we can provide? - With minimal changes to system and programming Recall: Tesseract Junwhan Ahn, Sungpack Hong, Sungjoo Yoo, Onur Mutlu, and Kiyoung Choi, "A Scalable Processing-in-Memory Accelerator for Parallel Graph Processing" Proceedings of the 42nd International Symposium on Computer Architecture (ISCA), Portland, OR, June 2015. [Slides (pdf)] [Lightning Session Slides (pdf)] A Scalable Processing-in-Memory Accelerator for Parallel Graph Processing Junwhan Ahn Sungpack Hong§ Sungjoo Yoo Onur Mutlu† Kiyoung Choi [email protected], [email protected], [email protected], [email protected], [email protected] Seoul National University §Oracle Labs †Carnegie Mellon University Several Questions in 3D-Stacked PIM - What are the performance and energy benefits of using 3D-stacked memory as a coarse-grained accelerator? - By changing the entire system - By performing simple function offloading - What is the minimal processing-in-memory support we can provide? - With minimal changes to system and programming 3D-Stacked PIM on Mobile Devices Amirali Boroumand, Saugata Ghose, Youngsok Kim, Rachata Ausavarungnirun, Eric Shiu, Rahul Thakur, Daehyun Kim, Aki Kuusela, Allan Knies, Parthasarathy Ranganathan, and Onur Mutlu, "Google Workloads for Consumer Devices: Mitigating Data Movement Bottlenecks" Proceedings of the 23rd International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Williamsburg, VA, USA, March 2018. Google Workloads for Consumer Devices: Mitigating Data Movement Bottlenecks Amirali Boroumand$^1$ Saugata Ghose$^1$ Youngsok Kim$^2$ Rachata Ausavarungnirun$^1$ Eric Shiu$^3$ Rahul Thakur$^3$ Daehyun Kim$^{4,3}$ Aki Kuusela$^3$ Allan Knies$^3$ Parthasarathy Ranganathan$^3$ Onur Mutlu$^{5,1}$ Consumer Devices Consumer devices are everywhere! Energy consumption is a first-class concern in consumer devices Four Important Workloads - Chrome - Google’s web browser - TensorFlow Mobile - Google’s machine learning framework - Video Playback - Google’s video codec - Video Capture - Google’s video codec Energy Cost of Data Movement 1st key observation: 62.7% of the total system energy is spent on data movement. Potential solution: move computation close to data. Challenge: limited area and energy budget. Using PIM to Reduce Data Movement 2nd key observation: a significant fraction of the data movement often comes from simple functions. We can design lightweight logic to implement these simple functions in memory. Small embedded low-power core PIM Core Small fixed-function accelerators PIM Accelerator Offloading to PIM logic reduces energy and improves performance, on average, by 55.4% and 54.2%. Workload Analysis Chrome Google’s web browser TensorFlow Mobile Google’s machine learning framework Video Playback Google’s video codec Video Capture Google’s video codec 57.3% of the inference energy is spent on data movement 54.4% of the data movement energy comes from packing/unpacking and quantization Packing Matrix → Packing → Packed Matrix Reorders elements of matrices to minimize cache misses during matrix multiplication. Up to 40% of the inference energy and 31% of inference execution time. Packing’s data movement accounts for up to 35.3% of the inference energy. A simple data reorganization process that requires simple arithmetic. Quantization Converts 32-bit floating point to 8-bit integers to improve inference execution time and energy consumption. Up to 16.8% of the inference energy and 16.1% of inference execution time. Majority of quantization energy comes from data movement. A simple data conversion operation that requires shift, addition, and multiplication operations. PIM core and PIM accelerator reduce energy consumption on average by 49.1% and 55.4%. Normalized Runtime Offloading these kernels to PIM core and PIM accelerator improves performance on average by 44.6% and 54.2%. Workload Analysis Chrome Google’s web browser TensorFlow Google’s machine learning framework VP9 Video Playback Google’s video codec VP9 Video Capture Google’s video codec How Chrome Renders a Web Page HTML → HTML Parser → Render Tree → Layout → Rasterization → Compositing CSS → CSS Parser → Render Tree → Layout → Rasterization → Compositing How Chrome Renders a Web Page Loading and Parsing - HTML → HTML Parser - CSS → CSS Parser Layouting - Render Tree - Layout Painting - Rasterization - Compositing assembles all layers into a final screen image calculates the visual elements and position of each object paints those objects and generates the bitmaps Browser Analysis • To satisfy user experience, the browser must provide: – Fast loading of webpages – Smooth scrolling of webpages – Quick switching between browser tabs • We focus on two important user interactions: 1) Page Scrolling 2) Tab Switching – Both include page loading Tab Switching What Happens During Tab Switching? • Chrome employs a multi-process architecture – Each tab is a separate process • Main operations during tab switching: – Context switch – Load the new page Memory Consumption • Primary concerns during tab switching: – How fast a new tab loads and becomes interactive – Memory consumption Chrome uses compression to reduce each tab’s memory footprint. CPU → Compressed Tab → DRAM/ZRAM Decompression Compressed Tab Compression Data Movement Study • To study data movement during tab switching, we emulate a user switching through 50 tabs. We make two key observations: 1. Compression and decompression contribute to 18.1% of the total system energy. 2. 19.6 GB of data moves between CPU and ZRAM. Can We Use PIM to Mitigate the Cost? CPU-Only - Swap out N pages - Read N Pages - Compress - Write back - Other tasks Memory Uncompressed Pages ZRAM high data movement CPU + PIM - Swap out N pages - Other tasks PIM Uncompressed Pages Compress ZRAM No off-chip data movement PIM core and PIM accelerator are feasible to implement in-memory compression/decompression Tab Switching Wrap Up A large amount of data movement happens during tab switching as Chrome attempts to compress and decompress tabs. Both functions can benefit from PIM execution and can be implemented as PIM logic. More on PIM for Mobile Devices - Amirali Boroumand, Saugata Ghose, Youngsok Kim, Rachata Ausavarungnirun, Eric Shiu, Rahul Thakur, Daehyun Kim, Aki Kuusela, Allan Knies, Parthasarathy Ranganathan, and Onur Mutlu, "Google Workloads for Consumer Devices: Mitigating Data Movement Bottlenecks" Proceedings of the 23rd International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Williamsburg, VA, USA, March 2018. 62.7% of the total system energy is spent on data movement Google Workloads for Consumer Devices: Mitigating Data Movement Bottlenecks Amirali Boroumand¹ Saugata Ghose¹ Youngsok Kim² Rachata Ausavarungnirun¹ Eric Shiu³ Rahul Thakur³ Daehyun Kim⁴,³ Aki Kuusela³ Allan Knies³ Parthasarathy Ranganathan³ Onur Mutlu⁵,¹ SAFARI Truly Distributed GPU Processing with PIM? 3D-stacked memory (memory stack) SM (Streaming Multiprocessor) Logic layer Main GPU Vault Ctrl Crossbar switch Vault Ctrl __global__ void applyScaleFactorsKernel( uint8_T * const out, uint8_T const * const in, const double factor, size_t const numRows, size_t const numCols ) { // Work out which pixel we are working on. const int rowIdx = blockIdx.x blockDim.x + threadIdx.x; const int colIdx = blockIdx.y; const int sliceIdx = threadIdx.z; // Check this thread isn't off the image if( rowIdx >= numRows ) return; // Compute the index of my element size_t linearIdx = rowIdx + colIdxnumRows + sliceIdxnumRowsnumCols; Accelerating GPU Execution with PIM (I) Kevin Hsieh, Eiman Ebrahimi, Gwangsun Kim, Niladrish Chatterjee, Mike O'Connor, Nandita Vijaykumar, Onur Mutlu, and Stephen W. Keckler, "Transparent Offloading and Mapping (TOM): Enabling Programmer-Transparent Near-Data Processing in GPU Systems" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] Accelerating GPU Execution with PIM (II) Ashutosh Pattnaik, Xulong Tang, Adwait Jog, Onur Kayiran, Asit K. Mishra, Mahmut T. Kandemir, Onur Mutlu, and Chita R. Das, "Scheduling Techniques for GPU Architectures with Processing-In-Memory Capabilities" Proceedings of the 25th International Conference on Parallel Architectures and Compilation Techniques (PACT), Haifa, Israel, September 2016. Scheduling Techniques for GPU Architectures with Processing-In-Memory Capabilities Ashutosh Pattnaik¹ Xulong Tang¹ Adwait Jog² Onur Kayıran³ Asit K. Mishra⁴ Mahmut T. Kandemir¹ Onur Mutlu⁵,⁶ Chita R. Das¹ ¹Pennsylvania State University ²College of William and Mary ³Advanced Micro Devices, Inc. ⁴Intel Labs ⁵ETH Zürich ⁶Carnegie Mellon University Accelerating Linked Data Structures Kevin Hsieh, Samira Khan, Nandita Vijaykumar, Kevin K. Chang, Amirali Boroumand, Saugata Ghose, and Onur Mutlu, "Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation" Proceedings of the 34th IEEE International Conference on Computer Design (ICCD), Phoenix, AZ, USA, October 2016. Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation Kevin Hsieh† Samira Khan‡ Nandita Vijaykumar† Kevin K. Chang† Amirali Boroumand† Saugata Ghose† Onur Mutlu§† †Carnegie Mellon University ‡University of Virginia §ETH Zürich Accelerating Dependent Cache Misses Milad Hashemi, Khubaib, Eiman Ebrahimi, Onur Mutlu, and Yale N. Patt, "Accelerating Dependent Cache Misses with an Enhanced Memory Controller" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] Accelerating Dependent Cache Misses with an Enhanced Memory Controller Milad Hashemi, Khubaib†, Eiman Ebrahimi‡, Onur Mutlu§, Yale N. Patt* The University of Texas at Austin †Apple ‡NVIDIA §ETH Zürich & Carnegie Mellon University Accelerating Runahead Execution Milad Hashemi, Onur Mutlu, and Yale N. Patt, "Continuous Runahead: Transparent Hardware Acceleration for Memory Intensive Workloads" Proceedings of the 49th International Symposium on Microarchitecture (MICRO), Taipei, Taiwan, October 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pdf)] [Poster (pptx) (pdf)] Continuous Runahead: Transparent Hardware Acceleration for Memory Intensive Workloads Milad Hashemi, Onur Mutlu§, Yale N. Patt* The University of Texas at Austin §ETH Zürich Several Questions in 3D-Stacked PIM - What are the performance and energy benefits of using 3D-stacked memory as a coarse-grained accelerator? - By changing the entire system - By performing simple function offloading - What is the minimal processing-in-memory support we can provide? - With minimal changes to system and programming PIM-Enabled Instructions Junwhan Ahn, Sungjoo Yoo, Onur Mutlu, and Kiyoung Choi, "PIM-Enabled Instructions: A Low-Overhead, Locality-Aware Processing-in-Memory Architecture" Proceedings of the 42nd International Symposium on Computer Architecture (ISCA), Portland, OR, June 2015. [Slides (pdf)] [Lightning Session Slides (pdf)] PIM-Enabled Instructions: A Low-Overhead, Locality-Aware Processing-in-Memory Architecture Junwhan Ahn Sungjoo Yoo Onur Mutlu† Kiyoung Choi [email protected], [email protected], [email protected], [email protected] Seoul National University †Carnegie Mellon University PEI: PIM-Enabled Instructions (Ideas) - Goal:* Develop mechanisms to get the most out of near-data processing with minimal cost, minimal changes to the system, no changes to the programming model. - Key Idea 1: Expose each PIM operation as a cache-coherent, virtually-addressed host processor instruction (called PEI) that operates on only a single cache block. - e.g., `__pim_add(&w.next_rank, value)` → `pim.add r1, (r2)` - No changes sequential execution/programming model - No changes to virtual memory - Minimal changes to cache coherence - No need for data mapping: Each PEI restricted to a single memory module - Key Idea 2: Dynamically decide where to execute a PEI (i.e., the host processor or PIM accelerator) based on simple locality characteristics and simple hardware predictors. - Execute each operation at the location that provides the best performance. Simple PIM Operations as ISA Extensions (II) ```c for (v: graph.vertices) { value = weight * v.rank; for (w: v.successors) { w.next_rank += value; } } ``` Conventional Architecture Host Processor Main Memory 64 bytes in 64 bytes out for (v: graph.vertices) { value = weight * v.rank; for (w: v.successors) { __pim_add(&w.next_rank, value); } } Host Processor value 8 bytes in 0 bytes out Main Memory w.next_rank In-Memory Addition Always Executing in Memory? Not A Good Idea Increased Memory Bandwidth Consumption Caching very effective Reduced Memory Bandwidth Consumption due to In-Memory Computation More Vertices PEI: PIM-Enabled Instructions (Example) ```c for (v: graph.vertices) { value = weight * v.rank; for (w: v.successors) { __pim_add(&w.next_rank, value); } } pfence(); ``` Table 1: Summary of Supported PIM Operations \| Operation \| R \| W \| Input \| Output \| Applications \| \|----------------------------\|---\|---\|-------\|--------\|--------------\| \| 8-byte integer increment \| O \| O \| 0 bytes \| 0 bytes \| AT \| \| 8-byte integer min \| O \| O \| 8 bytes \| 0 bytes \| BFS, SP, WCC \| \| Floating-point add \| O \| O \| 8 bytes \| 0 bytes \| PR \| \| Hash table probing \| O \| X \| 8 bytes \| 9 bytes \| HJ \| \| Histogram bin index \| O \| X \| 1 byte \| 16 bytes \| HG, RP \| \| Euclidean distance \| O \| X \| 64 bytes \| 4 bytes \| SC \| \| Dot product \| O \| X \| 32 bytes \| 8 bytes \| SVM \| - Executed either in memory or in the processor: dynamic decision - Low-cost locality monitoring for a single instruction - Cache-coherent, virtually-addressed, single cache block only - Atomic between different PEIs - Not atomic with normal instructions (use `pfence` for ordering) PIM-Enabled Instructions - Key to practicality: single-cache-block restriction - Each PEI can access at most one last-level cache block - Similar restrictions exist in atomic instructions - Benefits - Localization: each PEI is bounded to one memory module - Interoperability: easier support for cache coherence and virtual memory - Simplified locality monitoring: data locality of PEIs can be identified simply by the cache control logic PEI: Initial Evaluation Results - Initial evaluations with 10 emerging data-intensive workloads - Large-scale graph processing - In-memory data analytics - Machine learning and data mining - Three input sets (small, medium, large) for each workload to analyze the impact of data locality - Pin-based cycle-level x86-64 simulation - Performance Improvement and Energy Reduction: - 47% average speedup with large input data sets - 32% speedup with small input data sets - 25% avg. energy reduction in a single node with large input data sets Table 2: Baseline Simulation Configuration \| Component \| Configuration \| \|--------------------\|-------------------------------------------------------------------------------\| \| Core \| 16 out-of-order cores, 4 GHz, 4-issue \| \| L1 I/D-Cache \| Private, 32 KB, 4/8-way, 64 B blocks, 16 MSHRs \| \| L2 Cache \| Private, 256 KB, 8-way, 64 B blocks, 16 MSHRs \| \| L3 Cache \| Shared, 16 MB, 16-way, 64 B blocks, 64 MSHRs \| \| On-Chip Network \| Crossbar, 2 GHz, 144-bit links \| \| Main Memory \| 32 GB, 8 HMCs, daisy-chain (80 GB/s full-duplex) \| \| HMC \| 4 GB, 16 vaults, 256 DRAM banks [20] \| \| – DRAM \| FR-FCFS, tCL = tRCD = tRP = 13.75 ns [27] \| \| – Vertical Links \| 64 TSVs per vault with 2 Gb/s signaling rate [23] \| Evaluated Data-Intensive Applications - Ten emerging data-intensive workloads - Large-scale graph processing - Average teenage follower, BFS, PageRank, single-source shortest path, weakly connected components - In-memory data analytics - Hash join, histogram, radix partitioning - Machine learning and data mining - Streamcluster, SVM-RFE - Three input sets (small, medium, large) for each workload to show the impact of data locality PEI Performance Delta: Large Data Sets (Large Inputs, Baseline: Host-Only) - ATF - BFS - PR - SP - WCC - HJ - HG - RP - SC - SVM - GM PIM-Only vs Locality-Aware PEI Performance: Large Data Sets Normalized Amount of Off-chip Transfer - ATF - BFS - PR - SP - WCC - HJ - HG - RP - SC - SVM Host-Only PIM-Only Locality-Aware PEI Performance Delta: Small Data Sets (Small Inputs, Baseline: Host-Only) -60% -40% -20% 0% 20% 40% 60% ATF BFS PR SP WCC HJ HG RP SC SVM GM PIM-Only Locality-Aware PEI Performance: Small Data Sets Normalized Amount of Off-chip Transfer -60 -40 -20 0 20 40 60 80 ATF BFS PR SP WCC HJ HG RP SC SVM Host-Only PIM-Only Locality-Aware PIM-Only Locality-Aware PEI Performance Delta: Medium Data Sets (Medium Inputs, Baseline: Host-Only) -10% 0% 10% 20% 30% 40% 50% 60% 70% ATF BFS PR SP WCC HJ HG RP SC SVM GM PIM-Only Locality-Aware PEI Energy Consumption - Host-Only - PIM-Only - Locality-Aware \| Size \| Cache \| HMC Link \| DRAM \| Host-side PCU \| Memory-side PCU \| PMU \| \|-------\|-------\|----------\|------\|---------------\|-----------------\|-----\| \| Small \| \| \| \| \| \| \| \| Medium\| \| \| \| \| \| \| \| Large \| \| \| \| \| \| \| Legend: - Cache - HMC Link - DRAM - Host-side PCU - Memory-side PCU - PMU PEI: Advantages & Disadvantages Advantages + Simple and low cost approach to PIM + No changes to programming model, virtual memory + Dynamically decides where to execute an instruction Disadvantages - Does not take full advantage of PIM potential - Single cache block restriction is limiting Simpler PIM: PIM-Enabled Instructions Junwhan Ahn, Sungjoo Yoo, Onur Mutlu, and Kiyoung Choi, "PIM-Enabled Instructions: A Low-Overhead, Locality-Aware Processing-in-Memory Architecture" Proceedings of the 42nd International Symposium on Computer Architecture (ISCA), Portland, OR, June 2015. [Slides (pdf)] [Lightning Session Slides (pdf)] PIM-Enabled Instructions: A Low-Overhead, Locality-Aware Processing-in-Memory Architecture Junwhan Ahn Sungjoo Yoo Onur Mutlu† Kiyoung Choi [email protected], [email protected], [email protected], [email protected] Seoul National University †Carnegie Mellon University Kevin Hsieh, Eiman Ebrahimi, Gwangsun Kim, Niladrish Chatterjee, Mike O'Connor, Nandita Vijaykumar, Onur Mutlu, and Stephen W. Keckler, "Transparent Offloading and Mapping (TOM): Enabling Programmer-Transparent Near-Data Processing in GPU Systems" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] Automatic Offloading of Critical Code Milad Hashemi, Khubaib, Eiman Ebrahimi, Onur Mutlu, and Yale N. Patt, "Accelerating Dependent Cache Misses with an Enhanced Memory Controller" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] Accelerating Dependent Cache Misses with an Enhanced Memory Controller Milad Hashemi, Khubaib†, Eiman Ebrahimi‡, Onur Mutlu§, Yale N. Patt The University of Texas at Austin †Apple ‡NVIDIA §ETH Zürich & Carnegie Mellon University Continuous Runahead: Transparent Hardware Acceleration for Memory Intensive Workloads Milad Hashemi, Onur Mutlu§, Yale N. Patt* The University of Texas at Austin §ETH Zürich Efficient Automatic Data Coherence Support Amirali Boroumand, Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Kevin Hsieh, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu, "LazyPIM: An Efficient Cache Coherence Mechanism for Processing-in-Memory" IEEE Computer Architecture Letters (CAL), June 2016. LazyPIM: An Efficient Cache Coherence Mechanism for Processing-in-Memory Amirali Boroumand†, Saugata Ghose†, Minesh Patel†, Hasan Hassan†§, Brandon Lucia†, Kevin Hsieh†, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu‡† †Carnegie Mellon University Samsung Semiconductor, Inc. §TOBB ETÜ ‡ETH Zürich Efficient Automatic Data Coherence Support Amirali Boroumand, Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Kevin Hsieh, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu, "CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators" Proceedings of the 46th International Symposium on Computer Architecture (ISCA), Phoenix, AZ, USA, June 2019. CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators Amirali Boroumand† Saugata Ghose† Minesh Patel* Hasan Hassan* Brandon Lucia† Rachata Ausavarungnirun†‡ Kevin Hsieh† Nastaran Hajinazar◊† Krishna T. Malladi§ Hongzhong Zheng§ Onur Mutlu∗† †Carnegie Mellon University ETH Zürich ‡KMUTNB ◊Simon Fraser University §Samsung Semiconductor, Inc. Challenge and Opportunity for Future Fundamentally Energy-Efficient (Data-Centric) Computing Architectures Challenge and Opportunity for Future Fundamentally High-Performance (Data-Centric) Computing Architectures Challenge and Opportunity for Future Computing Architectures with Minimal Data Movement Sub-Agenda: In-Memory Computation - Major Trends Affecting Main Memory - The Need for Intelligent Memory Controllers - Bottom Up: Push from Circuits and Devices - Top Down: Pull from Systems and Applications - Processing in Memory: Two Directions - Minimally Changing Memory Chips - Exploiting 3D-Stacked Memory - How to Enable Adoption of Processing in Memory - Conclusion How to Enable Adoption of Processing in Memory Barriers to Adoption of PIM 1. Functionality of and applications & software for PIM 2. Ease of programming (interfaces and compiler/HW support) 3. System support: coherence & virtual memory 4. Runtime and compilation systems for adaptive scheduling, data mapping, access/sharing control 5. Infrastructures to assess benefits and feasibility All can be solved with change of mindset We Need to Revisit the Entire Stack Problem Algorithm Program/Language System Software SW/HW Interface Micro-architecture Logic Devices Electrons We can get there step by step Processing Data Where It Makes Sense: Enabling In-Memory Computation Onur Mutlu\textsuperscript{a,b}, Saugata Ghose\textsuperscript{b}, Juan Gómez-Luna\textsuperscript{a}, Rachata Ausavarungnirun\textsuperscript{b,c} \textsuperscript{a}ETH Zürich \textsuperscript{b}Carnegie Mellon University \textsuperscript{c}King Mongkut’s University of Technology North Bangkok Onur Mutlu, Saugata Ghose, Juan Gomez-Luna, and Rachata Ausavarungnirun, “Processing Data Where It Makes Sense: Enabling In-Memory Computation” Invited paper in \textit{Microprocessors and Microsystems (MICPRO)}, June 2019. [arXiv version] https://arxiv.org/pdf/1903.03988.pdf A Workload and Programming Ease Driven Perspective of Processing-in-Memory Saugata Ghose† Amirali Boroumand† Jeremie S. Kim†§ Juan Gómez-Luna§ Onur Mutlu§† †Carnegie Mellon University §ETH Zürich Saugata Ghose, Amirali Boroumand, Jeremie S. Kim, Juan Gomez-Luna, and Onur Mutlu, "Processing-in-Memory: A Workload-Driven Perspective" Invited Article in IBM Journal of Research & Development, Special Issue on Hardware for Artificial Intelligence, to appear in November 2019. [Preliminary arXiv version] https://arxiv.org/pdf/1907.12947.pdf Key Challenge 1: Code Mapping • Challenge 1: Which operations should be executed in memory vs. in CPU? 3D-stacked memory (memory stack) SM (Streaming Multiprocessor) Logic layer Main GPU Vault Ctrl Crossbar switch Vault Ctrl Global void applyScaleFactorsKernel( uint8_T const out, uint8_T const * const in, const double factor, size_t const numRows, size_t const numCols ) // Work out which pixel we are working on. const int rowIdx = blockIdx.x blockDim.x + threadIdx.x; const int colIdx = blockIdx.y; const int sliceIdx = threadIdx.z; // Check this thread isn't off the image if( rowIdx >= numRows ) return; // Compute the index of my element size_t linearIdx = rowIdx + colIdxnumRows + sliceIdxnumRowsnumCols; Key Challenge 2: Data Mapping • Challenge 2: How should data be mapped to different 3D memory stacks? How to Do the Code and Data Mapping? Kevin Hsieh, Eiman Ebrahimi, Gwangsun Kim, Niladrish Chatterjee, Mike O'Connor, Nandita Vijaykumar, Onur Mutlu, and Stephen W. Keckler, "Transparent Offloading and Mapping (TOM): Enabling Programmer-Transparent Near-Data Processing in GPU Systems" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] How to Schedule Code? (I) Ashutosh Pattnaik, Xulong Tang, Adwait Jog, Onur Kayiran, Asit K. Mishra, Mahmut T. Kandemir, Onur Mutlu, and Chita R. Das, "Scheduling Techniques for GPU Architectures with Processing-In-Memory Capabilities" Proceedings of the 25th International Conference on Parallel Architectures and Compilation Techniques (PACT), Haifa, Israel, September 2016. Scheduling Techniques for GPU Architectures with Processing-In-Memory Capabilities Ashutosh Pattnaik¹ Xulong Tang¹ Adwait Jog² Onur Kayıran³ Asit K. Mishra⁴ Mahmut T. Kandemir¹ Onur Mutlu⁵,⁶ Chita R. Das¹ ¹Pennsylvania State University ²College of William and Mary ³Advanced Micro Devices, Inc. ⁴Intel Labs ⁵ETH Zürich ⁶Carnegie Mellon University How to Schedule Code? (II) Milad Hashemi, Khubaib, Eiman Ebrahimi, Onur Mutlu, and Yale N. Patt, "Accelerating Dependent Cache Misses with an Enhanced Memory Controller" Proceedings of the 43rd International Symposium on Computer Architecture (ISCA), Seoul, South Korea, June 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pptx) (pdf)] Accelerating Dependent Cache Misses with an Enhanced Memory Controller Milad Hashemi, Khubaib†, Eiman Ebrahimi‡, Onur Mutlu§, Yale N. Patt* The University of Texas at Austin †Apple ‡NVIDIA §ETH Zürich & Carnegie Mellon University How to Schedule Code? (III) Milad Hashemi, Onur Mutlu, and Yale N. Patt, "Continuous Runahead: Transparent Hardware Acceleration for Memory Intensive Workloads" Proceedings of the 49th International Symposium on Microarchitecture (MICRO), Taipei, Taiwan, October 2016. [Slides (pptx) (pdf)] [Lightning Session Slides (pdf)] [Poster (pptx) (pdf)] Continuous Runahead: Transparent Hardware Acceleration for Memory Intensive Workloads Milad Hashemi, Onur Mutlu§, Yale N. Patt* The University of Texas at Austin §ETH Zürich Challenge: Coherence for Hybrid CPU-PIM Apps \| \| Components \| Radii \| PageRank \| Components \| Radii \| PageRank \| Components \| Radii \| PageRank \| HTAP-256 \| HTAP-128 \| GMean \| \|----------\|------------\|-------\|----------\|------------\|-------\|----------\|------------\|-------\|----------\|----------\|----------\|-------\| \| arXiV \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| \| Gnutella \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| \| Enron \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| \| IMDB \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| 1.0 \| Traditional coherence CPU-only FG CG NC LazyPIM Ideal-PIM No coherence overhead How to Maintain Coherence? (I) Amirali Boroumand, Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Kevin Hsieh, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu, "LazyPIM: An Efficient Cache Coherence Mechanism for Processing-in-Memory" IEEE Computer Architecture Letters (CAL), June 2016. LazyPIM: An Efficient Cache Coherence Mechanism for Processing-in-Memory Amirali Boroumand†, Saugata Ghose†, Minesh Patel†, Hasan Hassan†§, Brandon Lucia†, Kevin Hsieh†, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu‡† †Carnegie Mellon University Samsung Semiconductor, Inc. §TOBB ETÜ ‡ETH Zürich How to Maintain Coherence? (II) Amirali Boroumand, Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Kevin Hsieh, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu, "CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators" Proceedings of the 46th International Symposium on Computer Architecture (ISCA), Phoenix, AZ, USA, June 2019. CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators Amirali Boroumand† Saugata Ghose† Minesh Patel* Hasan Hassan* Brandon Lucia† Rachata Ausavarungnirun†‡ Kevin Hsieh† Nastaran Hajinazar◊† Krishna T. Malladi§ Hongzhong Zheng§ Onur Mutlu* †Carnegie Mellon University ETH Zürich ‡KMUTNB ◊Simon Fraser University §Samsung Semiconductor, Inc. CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators Amirali Boroumand Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Rachata Ausavarungnirun, Kevin Hsieh, Nastaran Hajinazar, Krishna Malladi, Hongzhong Zheng, Onur Mutlu Specialized Accelerators Specialized accelerators are now everywhere! GPU, FPGA, ASIC Recent advancement in 3D-stacked technology enabled Near-Data Accelerators (NDA) Challenge: Coherence between NDAs and CPUs (1) Large cost of off-chip communication (2) NDA applications generate a large amount of off-chip data movement It is impractical to use traditional coherence protocols. We extensively study existing NDA coherence mechanisms and make three key observations: 1. These mechanisms eliminate a significant portion of NDA’s benefits. 2. The majority of off-chip coherence traffic generated by these mechanisms is unnecessary. 3. Much of the off-chip traffic can be eliminated if the coherence mechanism has insight into the memory accesses. An Optimistic Approach We find that an optimistic approach to coherence can address the challenges related to NDA coherence. 1. Gain insights before any coherence checks happen. 2. Perform only the necessary coherence requests. We propose CoNDA, a mechanism that uses optimistic NDA execution to avoid unnecessary coherence traffic. We propose CoNDA, a mechanism that uses optimistic NDA execution to avoid unnecessary coherence traffic. CoNDA comes within 10.4% and 4.4% of performance and energy of an ideal NDA coherence mechanism. CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators Amirali Boroumand Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Rachata Ausavarungnirun, Kevin Hsieh, Nastaran Hajinazar, Krishna Malladi, Hongzhong Zheng, Onur Mutlu How to Maintain Coherence? (II) Amirali Boroumand, Saugata Ghose, Minesh Patel, Hasan Hassan, Brandon Lucia, Kevin Hsieh, Krishna T. Malladi, Hongzhong Zheng, and Onur Mutlu, "CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators" Proceedings of the 46th International Symposium on Computer Architecture (ISCA), Phoenix, AZ, USA, June 2019. CoNDA: Efficient Cache Coherence Support for Near-Data Accelerators Amirali Boroumand† Saugata Ghose† Minesh Patel Hasan Hassan* Brandon Lucia† Rachata Ausavarungnirun†‡ Kevin Hsieh† Nastaran Hajinazar◊† Krishna T. Malladi§ Hongzhong Zheng§ Onur Mutlu* †Carnegie Mellon University ETH Zürich ‡KMUTNB ◊Simon Fraser University §Samsung Semiconductor, Inc. How to Support Virtual Memory? Kevin Hsieh, Samira Khan, Nandita Vijaykumar, Kevin K. Chang, Amirali Boroumand, Saugata Ghose, and Onur Mutlu, "Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation" Proceedings of the 34th IEEE International Conference on Computer Design (ICCD), Phoenix, AZ, USA, October 2016. Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation Kevin Hsieh† Samira Khan‡ Nandita Vijaykumar† Kevin K. Chang† Amirali Boroumand† Saugata Ghose† Onur Mutlu§† †Carnegie Mellon University ‡University of Virginia §ETH Zürich How to Design Data Structures for PIM? Zhiyu Liu, Irina Calciu, Maurice Herlihy, and Onur Mutlu, "Concurrent Data Structures for Near-Memory Computing" Proceedings of the 29th ACM Symposium on Parallelism in Algorithms and Architectures (SPAA), Washington, DC, USA, July 2017. [Slides (pptx) (pdf)] Concurrent Data Structures for Near-Memory Computing Zhiyu Liu Computer Science Department Brown University [email protected] Irina Calciu VMware Research Group [email protected] Maurice Herlihy Computer Science Department Brown University [email protected] Onur Mutlu Computer Science Department ETH Zürich [email protected] Simulation Infrastructures for PIM - Ramulator* extended for PIM - Flexible and extensible DRAM simulator - Can model many different memory standards and proposals - Kim+, “Ramulator: A Flexible and Extensible DRAM Simulator”, IEEE CAL 2015. - [Source Code for Ramulator-PIM] --- Ramulator: A Fast and Extensible DRAM Simulator Yoongu Kim$^1$, Weikun Yang$^{1,2}$, Onur Mutlu$^1$ $^1$Carnegie Mellon University $^2$Peking University Gagandeep Singh, Juan Gomez-Luna, Giovanni Mariani, Geraldo F. Oliveira, Stefano Corda, Sander Stuijk, Onur Mutlu, and Henk Corporaal, "NAPEL: Near-Memory Computing Application Performance Prediction via Ensemble Learning," Proceedings of the 56th Design Automation Conference (DAC), Las Vegas, NV, USA, June 2019. [Slides (pptx) (pdf)] [Poster (pptx) (pdf)] [Source Code for Ramulator-PIM] NAPEL: Near-Memory Computing Application Performance Prediction via Ensemble Learning Gagandeep Singh\textsuperscript{a,c} \quad Juan Gómez-Luna\textsuperscript{b} \quad Giovanni Mariani\textsuperscript{c} \quad Geraldo F. Oliveira\textsuperscript{b} Stefano Corda\textsuperscript{a,c} \quad Sander Stuijk\textsuperscript{a} \quad Onur Mutlu\textsuperscript{b} \quad Henk Corporaal\textsuperscript{a} \textsuperscript{a}Eindhoven University of Technology \quad \textsuperscript{b}ETH Zürich \quad \textsuperscript{c}IBM Research - Zurich An FPGA-based Test-bed for PIM? - Hasan Hassan et al., SoftMC: A Flexible and Practical Open-Source Infrastructure for Enabling Experimental DRAM Studies HPCA 2017. - Flexible - Easy to Use (C++ API) - Open-source github.com/CMU-SAFARI/SoftMC MQSim: A Framework for Enabling Realistic Studies of Modern Multi-Queue SSD Devices Arash Tavakkol†, Juan Gómez-Luna†, Mohammad Sadrosadati†, Saugata Ghose‡, Onur Mutlu‡‡ †ETH Zürich ‡Carnegie Mellon University GRIM-Filter: Fast seed location filtering in DNA read mapping using processing-in-memory technologies Jeremie S. Kim¹,⁶, Damla Senol Cali¹, Hongyi Xin², Donghyuk Lee³, Saugata Ghose¹, Mohammed Alser⁴, Hasan Hassan⁶, Oguz Ergin⁵, Can Alkan⁴ and Onur Mutlu⁶,¹* From The Sixteenth Asia Pacific Bioinformatics Conference 2018 Yokohama, Japan. 15-17 January 2018 Genome Read In-Memory (GRIM) Filter: Fast Seed Location Filtering in DNA Read Mapping using Processing-in-Memory Technologies Jeremie Kim, Damla Senol, Hongyi Xin, Donghyuk Lee, Saugata Ghose, Mohammed Alser, Hasan Hassan, Oguz Ergin, Can Alkan, and Onur Mutlu Genome Read Mapping is a very important problem and is the first step in many types of genomic analysis. - Could lead to improved health care, medicine, quality of life Read mapping is an approximate string matching problem. - Find the best fit of 100 character strings into a 3 billion character dictionary. - Alignment is currently the best method for determining the similarity between two strings, but is very expensive. We propose an in-memory processing algorithm GRIM-Filter for accelerating read mapping, by reducing the number of required alignments. We implement GRIM-Filter using in-memory processing within 3D-stacked memory and show up to 3.7x speedup. Google Workloads for Consumer Devices: Mitigating Data Movement Bottlenecks Amirali Boroumand Saugata Ghose, Youngsok Kim, Rachata Ausavarungnirun, Eric Shiu, Rahul Thakur, Daehyun Kim, Aki Kuusela, Allan Knies, Parthasarathy Ranganathan, Onur Mutlu Processing Data Where It Makes Sense: Enabling In-Memory Computation Onur Mutlu\textsuperscript{a,b}, Saugata Ghose\textsuperscript{b}, Juan Gómez-Luna\textsuperscript{a}, Rachata Ausavarungnirun\textsuperscript{b,c} \textsuperscript{a}ETH Zürich \textsuperscript{b}Carnegie Mellon University \textsuperscript{c}King Mongkut’s University of Technology North Bangkok Onur Mutlu, Saugata Ghose, Juan Gomez-Luna, and Rachata Ausavarungnirun, “Processing Data Where It Makes Sense: Enabling In-Memory Computation” Invited paper in \textit{Microprocessors and Microsystems (MICPRO)}, June 2019. [arXiv version] https://arxiv.org/pdf/1903.03988.pdf A Workload and Programming Ease Driven Perspective of Processing-in-Memory Saugata Ghose† Amirali Boroumand† Jeremie S. Kim†§ Juan Gómez-Luna§ Onur Mutlu§† †Carnegie Mellon University §ETH Zürich Saugata Ghose, Amirali Boroumand, Jeremie S. Kim, Juan Gomez-Luna, and Onur Mutlu, "Processing-in-Memory: A Workload-Driven Perspective" Invited Article in IBM Journal of Research & Development, Special Issue on Hardware for Artificial Intelligence, to appear in November 2019. [Preliminary arXiv version] https://arxiv.org/pdf/1907.12947.pdf Challenge and Opportunity for Future Fundamentally Energy-Efficient (Data-Centric) Computing Architectures Challenge and Opportunity for Future Fundamentally High-Performance (Data-Centric) Computing Architectures Challenge and Opportunity for Future Computing Architectures with Minimal Data Movement One Important Takeaway Main Memory Needs Intelligent Controllers Enabling the Paradigm Shift Recall: Computer Architecture Today - You can revolutionize the way computers are built, if you understand both the hardware and the software (and change each accordingly). - You can invent new paradigms for computation, communication, and storage. - Recommended book: Thomas Kuhn, “The Structure of Scientific Revolutions” (1962) - Pre-paradigm science: no clear consensus in the field. - Normal science: dominant theory used to explain/improve things (business as usual); exceptions considered anomalies. - Revolutionary science: underlying assumptions re-examined. Recall: Computer Architecture Today - You can revolutionize the way computers are built, if you understand both the hardware and the software (and change each accordingly). - You can improve the systems that communicate with computers. - Recommended book: Thomas Kuhn’s The Structure of Scientific Revolutions. - Pre-paradigm: new ideas in a field - Normal science: refine theories to improve things (but ignore anomalies) - Revolution: anomalies not examined UPMEM Processing-in-DRAM Engine (2019) - Processing in DRAM Engine - Includes standard DIMM modules, with a large number of DPU processors combined with DRAM chips. - Replaces standard DIMMs - DDR4 R-DIMM modules - 8GB+128 DPUs (16 PIM chips) - Standard 2x-nm DRAM process - Large amounts of compute & memory bandwidth https://www.anandtech.com/show/14750/hot-chips-31-analysis-inmemory-processing-by-upmem https://www.upmem.com/video-upmem-presenting-its-true-processing-in-memory-solution-hot-chips-2019/ Sub-Agenda: In-Memory Computation - Major Trends Affecting Main Memory - The Need for Intelligent Memory Controllers - Bottom Up: Push from Circuits and Devices - Top Down: Pull from Systems and Applications - Processing in Memory: Two Directions - Minimally Changing Memory Chips - Exploiting 3D-Stacked Memory - How to Enable Adoption of Processing in Memory - Conclusion Maslow, “A Theory of Human Motivation,” Psychological Review, 1943. Maslow, “Motivation and Personality,” Book, 1954-1970. Source: https://www.simplypsychology.org/maslow.html Challenge and Opportunity for Future Fundamentally High-Performance (Data-Centric) Computing Architectures Challenge and Opportunity for Future Fundamentally Energy-Efficient (Data-Centric) Computing Architectures Challenge and Opportunity for Future Fundamentally Low-Latency (Data-Centric) Computing Architectures Challenge and Opportunity for Future Computing Architectures with Minimal Data Movement PIM: Concluding Remarks A Quote from A Famous Architect “architecture [...] based upon principle, and not upon precedent” Precedent-Based Design? “architecture […] based upon principle, and not upon precedent” Principled Design “architecture […] based upon principle, and not upon precedent” www.GreatBuildings.com Organic architecture is a philosophy of architecture which promotes harmony between human habitation and the natural world through design approaches so sympathetic and well integrated with its site, that buildings, furnishings, and surroundings become part of a unified, interrelated composition. A well-known example of organic architecture is Fallingwater, the residence Frank Lloyd Wright designed for the Kaufmann family in rural Pennsylvania. Wright had many choices to locate a home on this large site, but chose to place the home directly over the waterfall and creek creating a close, yet noisy dialog with the rushing water and the steep site. The horizontal striations of stone masonry with daring cantilevers of colored beige concrete blend with native rock outcroppings and the wooded environment. Another Example: Precedent-Based Design Source: http://cookiemagik.deviantart.com/art/Train-station-207266944 Principled Design Source: By Toni_V, CC BY-SA 2.0, https://commons.wikimedia.org/w/index.php?curid=4087256 Another Principled Design Source: By Martín Gómez Tagle - Lisbon, Portugal, CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=13764903 Source: http://www.arcspace.com/exhibitions/unsorted/santiago-calatrava/ Another Principled Design Source: CC BY-SA 3.0, https://commons.wikimedia.org/w/index.php?curid=172107 Principle Applied to Another Structure Source: By 深建築人手札網站 Forgemind ArchiMedia – Flickr: IMG_2489.JPG, CC BY 2.0 Source: https://www.dezeen.com/2016/08/29/santiago-calatrava-world-trade-center-transportation-hub-new-york-photographs-hulton-crow/ Zoomorphic architecture is the practice of using animal forms as the inspirational basis and blueprint for architectural design. "While animal forms have always played a role adding some of the deepest layers of meaning in architecture, it is now becoming evident that a new strand of biomorphism is emerging where the meaning derives not from any specific representation but from a more general allusion to biological processes." [1] Some well-known examples of Zoomorphic architecture can be found in the TWA Flight Center building in New York City, by Eero Saarinen, or the Milwaukee Art Museum by Santiago Calatrava, both inspired by the form of a bird’s wings. [3] Overarching Principle for Computing? Concluding Remarks - It is time to design principled system architectures to solve the memory problem. - Design complete systems to be balanced, high-performance, and energy-efficient, i.e., data-centric (or memory-centric). - Enable computation capability inside and close to memory. - This can - Lead to orders-of-magnitude improvements. - Enable new applications & computing platforms. - Enable better understanding of nature. - ... The Future of Processing in Memory is Bright - Regardless of challenges - in underlying technology and overlying problems/requirements Can enable: - Orders of magnitude improvements - New applications and computing systems Yet, we have to - Think across the stack - Design enabling systems We Need to Revisit the Entire Stack Problem Algorithm Program/Language System Software SW/HW Interface Micro-architecture Logic Devices Electrons We can get there step by step If In Doubt, See Other Doubtful Technologies - A very “doubtful” emerging technology - for at least two decades Proceedings of the IEEE, Sept. 2017 Error Characterization, Mitigation, and Recovery in Flash-Memory-Based Solid-State Drives This paper reviews the most recent advances in solid-state drive (SSD) error characterization, mitigation, and data recovery techniques to improve both SSD’s reliability and lifetime. By Yu Cai, Saugata Ghose, Erich F. Haratsch, Yixin Luo, and Onur Mutlu https://arxiv.org/pdf/1706.08642 Flash Memory Timeline 1967 Dawon Kahng and Simon M. Sze invent the Floating Gate (FG) Floating Gate at Bell Labs. This is published as “A Floating-Gate Memory Application to Memory Devices” (Bell System Technical Journal). Simon M. Sze went on to receive the 2014 FMS Lifetime Achievement Award. 1970 Dov Frohman-Bentchkowsky publishes “Electrically Erasable Programmable Read-Only Memory (EPROM)” in IEEE Spectrum. This is cited as “Memory Behavior in a Floating-Gate MOS-FAMOS Structure” in April 1974 (Applied Physics Letters), which was written by Simon M. Sze Bell Labs Floating Gate publication. 1976 Hughes Microelectronics files Eli Harari patent for first practical floating gate EEPROM using thin SiO₂ tunneling layer, cited as “Memory Behavior in a Floating-Gate MOS-FAMOS Structure” in April 1974 (Applied Physics Letters), which was written by Simon M. Sze Bell Labs Floating Gate publication. 1977 Eli Harari of Hughes Microelectronics publishes “Creation and Trapping of Electrons in Highly Dressed Silicon Films of Thickness 50 Å” (Applied Physics Letters). 1978 IEEE Solid State Circuits publishes paper “An Electrically Alterable Non-Volatile Memory Cell Using Floating Gate Structure” by Guterman, Holvorsen, and McElroy of Texas Instruments. 1979 Hughes Microelectronics introduces the STOR first CMOS EEPROM 6kb chip employing Fowler-Nordheim tunneling. 1980 Intel introduces the 2816, 16Kb HMOS EEPROM employing Fowler Nordheim tunneling. 1981 British scientist and inventor Alan Kramer designs first digital audio player (MP3) based on magnetic bubble memory chips. 1982 STEC Technology introduces the 5011 first EEPROM with on-chip charge pump to program, read, and erase; an invention used in all flash memory devices. 1983 Intel introduces 2817A 16Kb EEPROM. 1984 First paper describing flash EEPROM presented by Fajio Nakamura of Toshiba at IEEE International Electron Devices Meeting (IEDM) in San Francisco. Fajio Masuoka went on to receive the 2013 FMS Lifetime Achievement Award. Intel begins flash process development. ATML (Advanced Technology Memory and Logic) is founded by George Perlegos, who went on to receive the 2017 Lifetime Achievement Award. Processing Data Where It Makes Sense: Enabling In-Memory Computation Onur Mutlu\textsuperscript{a,b}, Saugata Ghose\textsuperscript{b}, Juan Gómez-Luna\textsuperscript{a}, Rachata Ausavarungnirun\textsuperscript{b,c} \textsuperscript{a}ETH Zürich \textsuperscript{b}Carnegie Mellon University \textsuperscript{c}King Mongkut’s University of Technology North Bangkok Onur Mutlu, Saugata Ghose, Juan Gomez-Luna, and Rachata Ausavarungnirun, “Processing Data Where It Makes Sense: Enabling In-Memory Computation” Invited paper in \textit{Microprocessors and Microsystems (MICPRO)}, June 2019. [arXiv version] https://arxiv.org/pdf/1903.03988.pdf A Workload and Programming Ease Driven Perspective of Processing-in-Memory Saugata Ghose† Amirali Boroumand† Jeremie S. Kim†§ Juan Gómez-Luna§ Onur Mutlu§† †Carnegie Mellon University §ETH Zürich Saugata Ghose, Amirali Boroumand, Jeremie S. Kim, Juan Gomez-Luna, and Onur Mutlu, "Processing-in-Memory: A Workload-Driven Perspective" Invited Article in IBM Journal of Research & Development, Special Issue on Hardware for Artificial Intelligence, to appear in November 2019. [Preliminary arXiv version] https://arxiv.org/pdf/1907.12947.pdf Computer Architecture Lecture 8: Computation in Memory III Prof. Onur Mutlu ETH Zürich Fall 2019 11 October 2019 Accelerating Linked Data Structures Kevin Hsieh, Samira Khan, Nandita Vijaykumar, Kevin K. Chang, Amirali Boroumand, Saugata Ghose, and Onur Mutlu, "Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation" Proceedings of the 34th IEEE International Conference on Computer Design (ICCD), Phoenix, AZ, USA, October 2016. Accelerating Pointer Chasing in 3D-Stacked Memory: Challenges, Mechanisms, Evaluation Kevin Hsieh† Samira Khan‡ Nandita Vijaykumar† Kevin K. Chang† Amirali Boroumand† Saugata Ghose† Onur Mutlu§† †Carnegie Mellon University ‡University of Virginia §ETH Zürich Executive Summary • Our Goal: Accelerating pointer chasing inside main memory • Challenges: Parallelism challenge and Address translation challenge • Our Solution: In-Memory Pointer Chasing Accelerator (IMPICA) • Address-access decoupling: enabling parallelism in the accelerator with low cost • IMPICA page table: low cost page table in logic layer • Key Results: • 1.2X – 1.9X speedup for pointer chasing operations, +16% database throughput • 6% - 41% reduction in energy consumption Linked Data Structures • Linked data structures are widely used in many important applications. Linked data structures are connected by pointers. B-Tree Hash Table The Problem: Pointer Chasing • Traversing linked data structures requires chasing pointers Find(A) H E Q A E M Serialized and irregular access pattern 6X cycles per instruction in real workloads Our Goal Accelerating pointer chasing inside main memory Parallelism Challenge CPU core - Comp - Memory access - Comp CPU core - Comp - Memory access - Comp In-Memory Accelerator - Comp - Memory access - Comp - Comp - Memory access - Comp Slower for two operations Parallelism Challenge and Opportunity • A simple in-memory accelerator can still be slower than multiple CPU cores • Opportunity: a pointer-chasing accelerator spends a long time waiting for memory Our Solution: Address-Access Decoupling Address-access decoupling enables parallelism in both engines with low cost. IMPICA Core Architecture DRAM Layers Logic Layer DRAM Memory Controller Access Queue IMPICA Cache Address Engine Request Queue Traversal 1 Traversal 2 CPU Access Engine Response Queue Address Translation Challenge The page table walk requires multiple memory accesses. No TLB/MMU on the memory side. Duplicating it is costly and creates compatibility issues. Our Solution: IMPICA Page Table - Completely decouple the page table of IMPICA from the page table of the CPUs. Map linked data structure into IMPICA regions. IMPICA page table is a partial-to-any mapping. IMPICA Page Table: Mechanism Virtual Address Bit [47:4] Flat page table saves one memory access Region Table Tiny region table is almost always in the cache Large Page Table (2MB) Small Page Table (4KB) Physical Address Evaluation Methodology - Simulator: gem5 - System Configuration - CPU - 4 OoO cores, 2GHz - Cache: 32KB L1, 1MB L2 - IMPICA - 1 core, 500MHz, 32KB Cache - Memory Bandwidth - 12.8 GB/s for CPU, 51.2 GB/s for IMPICA - Our simulator code is open source - https://github.com/CMU-SAFARI/IMPICA Result – Microbenchmark Performance - Baseline + extra 128KB L2 - IMPICA \| Benchmark \| Speedup \| \|---------------\|---------\| \| Linked List \| 1.9X \| \| Hash Table \| 1.3X \| \| B-Tree \| 1.2X \| Result – Database Performance Database Throughput - Baseline + extra 128KB L2: +2% - Baseline + extra 1MB L2: +5% - IMPICA: +16% Database Latency - Baseline + extra 128KB L2: -0% - Baseline + extra 1MB L2: -4% - IMPICA: -13% System Energy Consumption -41% -24% -10% -6% Linked List Hash Table B-Tree DBx1000 Normalized Energy ## Area and Power Overhead \| Component \| Area (mm²) \| \|----------------------------------\|---------------------\| \| CPU (Cortex-A57) \| 5.85 per core \| \| L2 Cache \| 5 mm² per MB \| \| Memory Controller \| 10 mm² \| \| IMPICA (+32KB cache) \| 0.45 mm² \| - Power overhead: average power increases by 5.6%	b3d4e671-17c7-4b89-8b38-5f83baf0c5e6	CC-MAIN-2020-05	https://safari.ethz.ch/architecture/fall2019/lib/exe/fetch.php?media=onur-comparch-fall2019-lecture8-in-memory-computation-iii-afterlecture.pdf	2020-01-19T18:47:04+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-05/subset=warc/part-00016-2224c996-15d6-400a-8ae4-2d0740e74c18.c000.gz.parquet	651,675,250	14,234	eng_Latn	eng_Latn	0.627145	eng_Latn	0.773508	[ "dag_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "srd_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "pol_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "kiu_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "kiu_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "ind_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "dag_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "ita_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "kiu_Latn", "nld_Latn", "nld_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 113, 497, 840, 1472, 1815, 2594, 2711, 2934, 3143, 3550, 3726, 3864, 4211, 4568, 4655, 4785, 4962, 5137, 5464, 5759, 5774, 5974, 6253, 6528, 6908, 7129, 7923, 8649, 9113, 9866, 10485, 11074, 11608, 11951, 12553, 13456, 13715, 13940, 14130, 15319, 15770, 17503, 17959, 18124, 18290, 18482, 18702, 18881, 19402, 19699, 20314, 20737, 21328, 21508, 22130, 22869, 22978, 23087, 23177, 23561, 23609, 23994, 24173, 24821, 25371, 26105, 26209, 26670, 27408, 27988, 28519, 29483, 30095, 30822, 31072, 31243, 31460, 31830, 32062, 32168, 32372, 32622, 33349, 33963, 34602, 35056, 35990, 36239, 36454, 36817, 37080, 37752, 38005, 38653, 39203, 39312, 39421, 39511, 39578, 39607, 40185, 40658, 41183, 41567, 41746, 41855, 41964, 42068, 42158, 42183, 42283, 42373, 42457, 42481, 43293, 43405, 43514, 43736, 43841, 44090, 44762, 44800, 45249, 45545, 45724, 46259, 48459, 49107, 49657, 49772, 50391, 50907, 51076, 51276, 51335, 51551, 51752, 51871, 52069, 52247, 52456, 52685, 53000, 53216, 53446, 53557, 53995 ]
2017 Middle School Summer School Programs Location: Pflugerville Middle School 1600 W. Settlers Valley Drive, Pflugerville, TX 78660 Middle School Course Recovery June 7 – June 27, 2017 (15 days) Monday – Friday, 8:30 a.m. – 12:30 p.m. Principal: Melissa Brydson Students may only register for one course. Students may regain a maximum of one (1) course during summer school, if they attend at least 90% of the days assigned, and pass the course. Recovery courses are for students who have previously taken a course on campus, but failed it. Students may enroll in these courses ONLY with counselor approval. Please direct all questions to the student's school counselor. \| Sixth Grade \| Seventh Grade \| Eighth Grade \| \|---\|---\|---\| \| English/Language Arts 6 \| English/Language Arts 7 \| English/Language Arts 8 \| \| World Cultures \| Texas History \| US History \| \| Math 6 \| Math 7 \| Math 8 \| \| Science 6 \| Science 7 \| Science 8 \| Program Coordinator: Koby Todd This program is for Identified AVID students. - Breakfast and Lunch are provided. - Transportation will be provided at Campus/Neighborhood Hub locations Transportation for 2017 Summer School: Campus and Neighborhood Hub Locations In an effort to ensure greater consistency, reliability, and communication regarding summer school transportation, PfISD will be utilizing campus and neighborhood hub locations for student pick-up and drop-off for summer school transportation. The hub location method allows PfISD to communicate all summer transportation information early, providing students, parents, and summer program administrators with the time they need to prepare for summer program participation. All summer routes and corresponding maps of pick-up and drop-off locations will be posted later this spring. Thank you for your patience and understanding as we continue to improve services offer to our students in PfISD! 2017 Middle School Summer School Programs Location: Pflugerville Middle School 1600 W. Settlers Valley Drive, Pflugerville, TX 78660 8 th Grade Student Success Initiative Academy June 6 – June 19, 2017 (10 days) Monday – Friday 8:30 a.m. – 12:30 p.m. or 8:30 a.m. – 4:00 p.m. depending on STAAR results June 20, 2017 – STAAR Exam – Math June 21, 2017 – STAAR Exam – Reading June 22, 2017 – STAAR Exam – Make up Principal: Angela Matysek This academy is for identified 8th grade students, to prepare them for the third administration of the STAAR Reading and/or Math test. Parents will be contacted by the school counselor if their student needs to attend summer school. - Tuition: No cost to students. - Breakfast and Lunch are provided. - *Transportation will be provided at Campus/Neighborhood Hub locations AVID Bridge and Pre-AP Academy June 7 – June 27, 2017 (15 days) Monday – Friday 8:30 a.m. – 12:30 p.m. New location: Pflugerville High School	<urn:uuid:12f0e0ef-501a-445c-89c4-899801e6e710>	CC-MAIN-2017-30	http://pfisd.net/cms/lib/TX01001527/Centricity/Domain/301/Middle%20School%20SS%20Information%202017.pdf	2017-07-26T22:35:02Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-30/segments/1500549426639.7/warc/CC-MAIN-20170726222036-20170727002036-00620.warc.gz	246,842,321	709	eng_Latn	eng_Latn	0.99414	eng_Latn	0.993462	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 937, 2876 ]
Comparison of implant cast accuracy of multiple implant impression technique with different splinting materials: An in vitro study Sunantha Selvaraj, Jayachandran Dorairaj¹, Jayashree Mohan, Paul Simon Departments of Prosthodontics and ¹Periodontics, Vinayaka Mission’s Sankarachariya Dental College and Hospital, Salem, Tamil Nadu, India Abstract Introduction: An accurate and passive fit of implant framework prosthesis, as well as the successful surgical operation is suggested as one of the critical requirements for long-term implant success. Objective: The purpose of this in vitro study was to evaluate the accuracy of the master cast using open tray impression technique with conventional and novel splinting materials. Methodology: A mandibular reference model with four ADIN implants was done. Ten custom trays were fabricated using the light curable resin sheets. Medium body polyether impression material was used. These trays were randomly divided into two groups namely: Group A: Direct impression technique with open tray impression copings splinted with autopolymerizing acrylic resin (GC pattern resin). Group B: Direct impression technique with open tray impression copings splinted with Pro-temp TM 4 (bis-GMA) syringable temporization material. Thus, final impressions were made. Total of 10 master casts were fabricated. Evaluation of casts using Dynascope-Vision Engineering, TESA microhite two- dimension and coordinate measuring machine were used. Results: Statistical comparisons were made using ANOVA test and post-hoc test. Same amount of deviation values obtained with resin splinted and bis-GMA splinted impression copings. Conclusion: The master cast obtained by both the splinting material exhibits no difference from the reference model. So bis-GMA can be used, which is easy to handle, less time consuming, less technique sensitive, rigid, and readily available material in clinics. Key Words: Accuracy, direct implant impression, master cast, splinting materials Address for correspondence: Dr. Sunantha Selvaraj, Department of Prosthodontics, Vinayaka Mission’s Sankarachariya Dental College and Hospital, Salem, Tamil Nadu, India. E-mail: [email protected] Received: 29th June, 2015, Accepted: 5th September, 2015 INTRODUCTION Osseointegrated implants have provided alternative treatments option to conventional prosthesis for patients who were partially and completely edentulous and achieved predictable... and favorable long-term results.\textsuperscript{[1,2]} An accurate and passive fit of an implant framework prosthesis, as well as the successful surgical operation is suggested as one of the critical requirements for long-term implant success.\textsuperscript{[3-8]} Presence of uneven distribution of occlusal loads and torquing stresses on the various portion of implant elements causes problems related to poor fit of frameworks connected to implant and may also lead to marginal bone loss and failure of implants, as well as in relation to mechanical problems as loosening of screws and fatigue fractures of implant components.\textsuperscript{[4-10]} It may not be probably possible to connect a multi-unit implant prosthesis with a completely passive fit in clinical situation because there are many potential inaccuracies with current materials and techniques, which include dimensional changes in impression materials, expansion of gypsum die product, dimensional changes in wax and acrylic pattern, dimensional changes in investment materials and volumetric shrinkage of metal casting on solidification and the clinicians skill.\textsuperscript{[11]} Among these variables, the precise transfer of the spatial relationships of implants from the mouth to the master cast with an impression is the first and crucial step to ensure passive fit of implant framework. Therefore, clinicians should strive for improving and precise transfer of the impression copings.\textsuperscript{[12-14]} Various implant techniques have been suggested in the literature to achieve an accurate master cast. In regard to splint the impression copings, there are many controversies exist since Branemark \textit{et al.} emphasized the importance of splinting impression copings together before registration of multiple implant impression.\textsuperscript{[15]} The common practice of joining the direct transfer copings with acrylic resin is an attempt to stabilize the copings against rotation during fixture or abutment analog fastening, control the relationship between implants in a rigid fashion. However, varies literature studies showed no significant differences between the values obtained with acrylic-splinted versus unsplinted groups in impression technique.\textsuperscript{[12,16-18]} Studies involved multiple variables of techniques and materials, the consistent findings was one of distortion resulting from the transfer manipulations.\textsuperscript{[19]} The same objective could be partially accomplished with a rigid impression material or an elastic material with a low flexibility, both of which do not introduce the polymerization shrinkage variables inherent in the use of acrylic resin. Vigolo \textit{et al.}\textsuperscript{[20]} suggested that the impression technique involved square impression copings joined together with autopolymerizing acrylic resin or square impression copings, previously airborne particle-abraded and adhesive-coated could improve accuracy of the master cast than non-modified squared transfer coping without splinting. Cabral and Guedes\textsuperscript{[21]} compared four impression techniques and direct impression technique with square impression coping with acrylic resin splints sectioned 17 min after setting and welded with the same resin before impression making showed better results than other techniques studied. Among the direct impression techniques, both splinting and nonsplinting have been advocated for accurate impressions. Although splinting with resin, impression plaster or bite registration material has been recommended for maintaining a more accurate inter implant relationship, the accuracy of these techniques in yielding accurate casts is controversial.\textsuperscript{[20,22,23]} In order to have rigid and dimensional stable material a newer material bis-GMA has been used to splint the impression copings. The purpose of this \textit{in vitro} study was to evaluate the effect of dimensional stability of conventionally used and newer splinting materials on the accuracy of master casts. MATERIALS AND METHODS A reference wax model with four implants (ADIN Dental Implant System Ltd, Afula Israel.) in the mandibular anterior region in overdenture position A, B, D, and E was positioned using surveyor for the proper orientation [Figure 1]. The reference model mimics a mandibular implant-supported overdenture situation. Three stoppers, one in the anterior and two in the posterior region were made in the land area of the mandibular reference model, this ensures the proper orientation of the impression trays. Fabricated in clear heat cure acrylic resin (Triplex, Ivocolor, Vivadent) [Figure 2]. A preliminary cast was fabricated using indirect impression technique. In-order to obtain uniform spacer, 3 mm even spacer was adapted onto the primary cast and the impression made and spaced primary cast was obtained [Figure 3]. Ten custom trays (five per group) with windows in the anterior region were made using light cure acrylic resin sheets Sheet (Plaque Photo, W + P Dental, Hamburg, Germany) ![Figure 1: Reference wax model with four implants](image-url) of 2 mm in thickness [Figure 4]. All the custom trays are uniformly spaced. To ensure dimensional stability of custom tray, the trays are left undisturbed for 24 h prior to impression making. The tray samples were divided randomly into two groups based on impression technique. - In Group A, the open tray impression copings were screwed to the implant body at 15 Ncm torque. The open tray copings where splinted with dental floss (Oral B waxed dental floss, India). Autopolymerizing resin (GC pattern resin, Osaka, Japan) was mixed in the ratio of 2 g–1 ml. When the resin reached the dough stage, it was packed around the impression posts and the dental floss thus they were splinted together. The splint was allowed to polymerize for 4 min. The splint was then sectioned in-between the impression posts using a thin separating disc to relieve the stresses caused due to polymerization shrinkage. The cut sections were joined using the same resin by applying it using brush bead method [Figure 5]. This was again allowed to polymerize for 4 min. The impression copings, custom tray, and the splint were coated with polyether adhesive and allowed to dry for 15 min. - In Group B the procedure of impression making was similar to Group A except that instead of pattern resin, bis-GMA (Pro-temp 4 3M ESPE, India) was used. The shrinkage of the material is lesser than autopolymerizing resin, so the splints were not sectioned in-between the impression posts. The bis—GMA (Pro-temp 4 3M ESPE, India) was just syringed using an automix gun (3M ESPE, India) into floss matrix formed between the impression post [Figure 6]. It is allowed to set for about 7 min as per the manufacturer’s instructions. Once the splinting was rigid then the impression copings, custom tray and the splint were all coated with polyether adhesive [Figure 7]. The medium body polyether was machine mixed (3M ESPE pentamix 2 Germany) and dispensed into a penta elastomer syringe (3M ESPE, Germany). It was syringed around the impression copings to avoid impression defects around the copings and loaded in the custom tray. The tray was then carried onto the reference model immediately and the impression... made. It was made sure that the tray seated completely in the three stops that were made in the reference model to ensure complete seating and proper positioning of the custom tray. The impression was allowed to set for 6 min as per the manufacturer’s recommendation. The screws of the impression posts were unscrewed and the impression removed from the reference model [Figure 8]. A total of five impressions were made in each group in a similar manner. The implant replica was fastened on to the impression copings and impressions were poured using Type IV dental stone (Ultrarock, Kalabhai). A total of 10 master cast were obtained [Figure 9] and only one model was obtained from each impression. Measurement protocol The reliability of measuring system is vital to evaluate the accuracy of the impression. Because distortion of an impression can occur in X, Y, and Z axis, so its of paramount importance to analyze the distortion in three dimensions. Dynoscope-Vision engineering (TESPA Calibration centre) was used to measure the X and Y axis. The magnified image of each implant in reference model and implant replica in the master casts were visualized in the computer and the external margin of each implant and implant replica was taken as reference point. The co-ordinates of the center of replica one was measured and zeroed and kept as $(X_0, Y_0)$. Keeping this as the reference position the centers of the other three replicas were determined and the linear distance between the centers of implant/replica were all measured in the X and Y planes. Thus, the linear distance between the centers of replica/implant are I and 2 $(D1\ x/y)$, I and 3 $(D2\ x/y)$ and I, and 4 $(D3\ x/y)$ were all measured digitally [Figures 10 and 11]. TESA microhite two- dimension (TESPA Calibration centre) was used to find the planes formed by the platform of implant and replica. The probe was used to measure the plane formed by the platform of Implant/replica 1 and it was zeroed. The distance between the plane formed by the implant/replica platform, I and 2 $(D1z)$, I and 3 $(D2z)$, and I and 3 $(D3z)$ were measured to get the inter implant distance in the Z-axis [Figures 12 and 13]. Figure 6: Syringable bis-GMA material Figure 7: Application of polyether adhesive Figure 8: Completed impression Figure 9: Magnified image of each implant in Dynascope-Vision Engineering The angular difference between the implant and replica to the base of cast were evaluated using a co-ordinate measuring machine (CMM – TESA Microhite 3D, TESA Technology). The angle formed between the axis of implant and replica to the base of the model and cast, respectively, to the horizontal plane were recorded as angles I, 2, 3, and 4 for the implants and replica [Figure 14]. The models were measured 5 times for each reading and the mean value was considered. All the measurements were made by a single operator to avoid inter operator error. Statistic analysis The measurements were tabulated and they were statistically analyzed and inference was obtained. A factorial analysis of variance using ANOVA was used for statistical analysis and $P < 0.05$ was considered as a significant. Post-hoc TESTS-homogeneous subset gives the difference between the groups based on which subset the group falls. RESULTS X-axis The difference in inter implant distance in x-axis ranged from 116 $\mu$m to 16 $\mu$m for impressions with resin splinted copings, 33–4 $\mu$m for impressions with bis-GMA splinted copings. The differences in D1x (distance between implant replica 1 and 2), D2x (distance between implant replica 1 and 3), and D3x (distance between implant replica 1 and 4) for both the test groups were not statistically significant when compared with the reference model values [Tables 1 and 2 and Graph 1]. Y-axis The difference in inter implant distance in Y-axis ranged from 216 $\mu$m to 180 $\mu$m for impressions with resin ![Figure 10: Inter implant distances in X and Y axis D1x and D1y – distance between implant/replica 1 and 2 in X and Y axis, respectively, D2x and D2y – distance between implant/replica 1 and 3 in X and Y axis, respectively, D3x and D3y – distance between implant/replica 1 and 4 in X and Y axis, respectively](image) ![Figure 11: TESA microhite two dimension](image) ![Figure 12: Inter implant distances In Z-axis D1z – distance between implant/replica 1 and 2 D2z – distance between implant/replica 1 and 3 D3z – distance between implant/replica 1 and 4](image) ![Figure 13: Co-ordinate measuring machine (CMM – TESA Microhite 3D, TESA)](image) splinted copings, 398–926 μm for impressions with bis-GMA splinted copings. Maximum differences were seen in D3y (distance between implant replica 1 and 4) values in Group B. A similar trend in dimensional distortion was evident in all the groups except that the amount of distortion varied within the groups [Tables 3 and 4 and Graph 2]. Z-axis The difference in inter implant distance in Z-axis ranged from 1.1 mm to 42 μm for impressions with resin splinted copings, 1.008 mm to −330 μm for impressions with bis-GMA splinted copings. The analysis shows that the P value for the D1z, D2z is <0.05, and for D3z is >0.05. Post-hoc range tests shows that reference group significantly differs with Group A and Group B as they fall in different subsets. Both the Group A and B showed differences in similar range [Tables 5 and 6 and Graph 3]. Implant angulation in the Z-axis to the horizontal plane It plane ranged from −6.78° to −7.21° for the resin splinted group and −3.78° to −5.07° for the bis-GMA splinted group. There was significant difference between the angles (I, --- Table 1: Comparison of inter implant distance in X-axis (values in mm) \| Group \| D1x \| \| D2x \| \| D3x \| \| \|---------\|---------\|-------\|---------\|-------\|---------\|-------\| \| \| Mean \| SD \| Mean \| SD \| Mean \| SD \| \| Reference \| 9.15 \| 0.00 \| 26.04 \| 0.00 \| 35.84 \| 0.00 \| \| Group A \| 9.26 \| 0.34 \| 26.13 \| 0.36 \| 35.85 \| 0.13 \| \| Group B \| 9.48 \| 0.07 \| 26.34 \| 0.06 \| 35.84 \| 0.13 \| \| F statistics \| 3.52 \| 2.65 \| 0.03 \| \| \| \| \| P \| 0.063 \| 0.111 \| 0.970 \| \| \| \| SD: Standard deviation --- Table 2: Difference in inter implant distance in X-axis (values in mm) \| Group \| ΔD1x \| \| ΔD2x \| \| ΔD3x \| \| \|-------\|------\|-------\|------\|-------\|------\|-------\| \| \| Mean \| SD \| Mean \| SD \| Mean \| SD \| \| A \| 0.116\| 0.338 \| 0.084\| 0.364 \| 0.016\| 0.131 \| \| B \| 0.330\| 0.072 \| 0.298\| 0.054 \| 0.004\| 0.129 \| ΔD1x: D1x of the test group - D1x of the reference model; ΔD2x: D2x of the test group - D2x of the reference model, ΔD3x: D3x of the test group - D3x of the reference model. SD: Standard deviation --- Table 3: Comparison of Inter implant distance in Y-axis (values in mm) \| Group \| D1y \| \| D2y \| \| D3y \| \| \|---------\|---------\|-------\|---------\|-------\|---------\|-------\| \| \| Mean \| SD \| Mean \| SD \| Mean \| SD \| \| Reference \| 9.95 \| 0.00 \| 9.02 \| 0.00 \| 1.56 \| 0.00 \| \| Group A \| 9.74 \| 0.32 \| 8.81 \| 0.47 \| 1.38 \| 0.58 \| \| Group B \| 9.55 \| 0.12 \| 8.27 \| 0.24 \| 2.49 \| 0.21 \| \| F statistics \| 5.04 \| 7.91 \| 13.97 \| \| \| \| \| P \| 0.026* \| 0.006 \| 0.001 \| \| \| \| Significant at 5%, Significant at 1%. SD: Standard deviation --- Table 4: Difference in inter implant distance in Y-axis (values in mm)* \| Group \| ΔD1y \| \| ΔD2y \| \| ΔD3y \| \| \|-------\|------\|-------\|------\|-------\|------\|-------\| \| \| Mean \| SD \| Mean \| SD \| Mean \| SD \| \| A \| −0.210\| 0.323 \| −0.216\| 0.475 \| −0.180\| 0.578 \| \| B \| −0.398\| 0.121 \| −0.752\| 0.246 \| 0.926 \| 0.208 \| ΔD1y; D1y of the test group - D1yof the reference model, ΔD2y; D2y of the test group - D2y of the reference model, ΔD3y; D3y of the test group - D3y of the reference model. SD: Standard deviation Graph 3: Comparison of inter implant distance in Z-axis (values in mm) Table 5: Comparison of Inter implant distance in Z-axis (values in mm) \| Group \| D1z Mean \| D1z SD \| D2z Mean \| D2z SD \| D3z Mean \| D3z SD \| \|---------\|----------\|--------\|----------\|--------\|----------\|--------\| \| Reference \| 0.32 \| 0.00 \| 0.62 \| 0.00 \| −0.30 \| 0.00 \| \| Group A \| 1.43 \| 0.46 \| 1.68 \| 0.65 \| −0.26 \| 0.51 \| \| Group B \| 1.33 \| 0.13 \| 1.41 \| 0.23 \| −0.63 \| 0.43 \| \| F statistics \| 24.53 \| 9.61 \| 1.38 \| \| \| \| \| P \| <0.001 \| 0.003\| 0.290 \| \| \| \| Significant at 5%, Significant at 1%. SD: Standard deviation Table 6: Difference in inter implant distance in Z-axis (values in mm) \| Group \| ΔD1z Mean \| ΔD1z SD \| ΔD2z Mean \| ΔD2z SD \| ΔD3z Mean \| ΔD3z SD \| \|-------\|-----------\|---------\|-----------\|---------\|-----------\|---------\| \| A \| 1.108 \| 0.463 \| 1.060 \| 0.648 \| 0.042 \| 0.505 \| \| B \| 1.008 \| 0.131 \| 0.786 \| 0.228 \| −0.330 \| 0.433 \| ΔD1z: D1z of the test group - D1z of the reference model, ΔD2z: D2z of the test group - D2z of the reference model, ΔD3z: D3z of the test group - D3z of the reference model. SD: Standard deviation Table 7: Comparison of implant angulation to horizontal plane in Z-axis (in degrees) \| Group \| Angle 1 Mean \| Angle 1 SD \| Angle 2 Mean \| Angle 2 SD \| Angle 3 Mean \| Angle 3 SD \| Angle 4 Mean \| Angle 4 SD \| \|---------\|--------------\|------------\|--------------\|------------\|--------------\|------------\|--------------\|------------\| \| Reference \| 86.44 \| 0.00 \| 81.46 \| 0.00 \| 81.24 \| 0.00 \| 83.40 \| 0.00 \| \| Group A \| 79.66 \| 2.41 \| 74.25 \| 2.28 \| 73.54 \| 2.67 \| 76.60 \| 2.45 \| \| Group B \| 82.65 \| 2.77 \| 77.68 \| 3.71 \| 76.17 \| 2.34 \| 79.00 \| 2.74 \| \| F statistics \| 12.86 \| 10.30 \| \| \| \| \| \| \| \| P \| 0.001* \| 0.002 \| <0.001 \| \| \| \| 0.001** \| \| Significant at 5%, * Significant at 1%. SD: Standard deviation Table 8: Difference in implant angulation to horizontal plane in Z-axis (values in degrees) \| Group \| ΔAngle 1 Mean \| ΔAngle 1 SD \| ΔAngle 2 Mean \| ΔAngle 2 SD \| ΔAngle 3 Mean \| ΔAngle 3 SD \| ΔAngle 4 Mean \| ΔAngle 4 SD \| \|-------\|---------------\|-------------\|---------------\|-------------\|---------------\|-------------\|---------------\|-------------\| \| A \| −6.78 \| 2.41 \| −7.21 \| 2.28 \| −7.70 \| 2.67 \| −6.80 \| 2.45 \| \| B \| −3.79 \| 2.77 \| −3.78 \| 3.71 \| −5.07 \| 2.34 \| −4.40 \| 2.74 \| ΔAngle 1: Angle 1 of the test group - Angle 1 of the reference model, ΔAngle 2: Angle 2 of the test group - Angle 2 of the reference model, ΔAngle 3: Angle 3 of the test group - Angle 3 of the reference model, ΔAngle 4: Angle 4 of the test group - Angle 4 of the reference model. SD: Standard deviation DISCUSSION The impression which allows replication must be accurate so that the resulting master cast precisely duplicates the clinical situation. Most research indicates that direct techniques produce less distortion than indirect techniques.\[16,17,19,24,25\] Because splinting with acrylic resin has yielded conflicting results,\[22,24,26-29\] This is an attempt made to evaluate the reliability of bis-GMA (Pro-temp 4) as splinting material. Polyether has been advocated as an impression material for multiple implant-supported prosthesis for edentulous patients.\[16,17,24,28\] Medium-body polyether was used as the impression material. The overall accuracy of the impression depends on all the four parameters in the X, Y, Z axis, and angulation of implant/replicas axis to its horizontal plane. Rotation of impression copings in the impression during fastening of the implant analog is one of the drawbacks of the direct impression technique. In an absolute distortion analysis, an external reference point is used, while in relative distortion analysis one implant/replica is used as reference for measuring distortion. Because the prosthesis connects all the implant together, the amount of strain on the implant is related to the relative positions of the implants to one another.\[30\] Therefore, relative distortion analysis was done in this study by measuring the inter implant distances and angulations in reference to replica no. I.\[30\] The errors in the resin splinting group could be attributed to the minimal shrinkage of the pattern resin used and the technique of splinting. Since the splint was sectioned in between the copings and then reunited, it could have minimized the polymerization shrinkage. Therefore, the amount of resin used for initial splinting could have not influenced the inaccuracy, whereas the dimension of the section made could have influenced the accuracy as it was joined again with resin before making impression. Further research on the dimensions of the splint and the dimensions of... the section would shed light on the influence of resin shrinkage on the accuracy of impression. Also, the technique of resin splinting has differed among various studies done so far.\[18-24\] Since bis-GMA (Pro-temp 4) has not been tested for accuracy as a splinting material, data regarding the accuracy of this material for splinting purpose is lacking. Thus, the values obtained for these materials in this study have to be compared with the values obtained with the resin splinting group only (since enormous studies had been conducted for the resin splinted copings). The range of differences obtained in bis-GMA splinted group in all the axis was almost in the similar range when compared to the resin splinted group. In X and Y axis both the Groups A and B exhibits no differences with the reference model. However, in Z-axis and the implant angulation to the horizontal plane, both the Groups A and B exhibited significant differences with the reference model in the similar range of difference. These differences could be attributed to the rigidity of the splinting material that was used to prevent the movement of copings in the vertical dimension during connection of the implant replica to the impression coping.\[17,24\] This in vitro study gives the amount of rotational distortion of impression copings in the Z-axis, which can occur when multiple implant impressions were made with polyether showed little discrepancies. From these data obtained, the inference of the study might probably application of polyether adhesive, rigidity of polyether impression material, rigidity of the splinting materials, tolerance between implant components and torque employed during fastening of the implant replica could determine, either individually or collectively the extent of distortion.\[26-28,30\] Although splinting might rigidly hold the impression copings together, the time consumed for impression making is considerably greater when compared to the nonsplinting impression technique. This preliminary effort to study is the accuracy of master cast obtained using direct impression technique with different splinting materials has yielded positive results especially in relation to the use of bis-GMA (Pro-temp 4 – syringable temporary crown material), so this material can be used as the splinting material in lesser time in a more comfortable syringable mode. Thus, further research on the use of this material for splinting purpose might be of use to enhance the accuracy of impression techniques. The results obtained in this study are in vitro and so future clinical studies are required to evaluate the effect of intra oral conditions on the materials used for splinting. CONCLUSION The following conclusions were arrived within the limitations of this in vitro study, which evaluated the accuracy of master cast using direct implant impression techniques with conventional and newer splinting material for multiple implant impression. - On comparison of the accuracy of implant impressions made by direct technique using resin splinted impression copings and bis-GMA splinted impression copings yielded master casts which had their readings very close to the reference model and within the clinical limits - Both the splinting material showed the same amount of variation from the reference model and these splinting materials were statistically similar to each other and falls in same homogenous subsets in all the three dimensional X, Y, and Z axis - Thus, both the splinting material exhibit similar accuracy in impression, so bis-GMA (Pro-temp 4 3M ESPE) as a splinting material is easy for handling, less time consuming, less technique sensitive, readily available material in clinics, and more rigid material can be used. However, selection of impression technique can be based only on the clinical situation and the personal clinician’s choice. Financial support and sponsorship Nil. Conflicts of interest There are no conflicts of interest. REFERENCES 1. Adell R, Lekholm U, Rockler B, Brånemark PI. A 15-year study of osseointegrated implants in the treatment of the edentulous jaw. Int J Oral Surg 1981;10:387-416. 2. Zarb GA, Schmitt A. The longitudinal clinical effectiveness of osseointegrated dental implants in anterior partially edentulous patients. Int J Prosthodont 1993;6:180-8. 3. Goll GE. Production of accurately fitting full-arch implant frameworks: Part I – Clinical procedures. J Prosthet Dent 1991;66:377-84. 4. Rangert B, Jemt T, Jörneus L. Forces and moments on Branemark implants. Int J Oral Maxillofac Implants 1989;4:241-7. 5. Zarb GA, Schmitt A. The longitudinal clinical effectiveness of osseointegrated dental implants: The Toronto Study. Part II: The prosthetic results. J Prosthet Dent 1990;64:53-61. 6. Jemt T. Failures and complications in 391 consecutively inserted fixed prostheses supported by Branemark implants in edentulous jaws: A study of treatment from the time of prosthesis placement to the first annual checkup. Int J Oral Maxillofac Implants 1991;6:270-6. 7. Jemt T. In vivo measurements of precision of fit involving implant-supported prostheses in the edentulous jaw. Int J Oral Maxillofac Implants 1996;11:151-8. 8. Kallus T, Bessing C. Loose gold screws frequently occur in full-arch prostheses supported by osseointegrated implants after 5 years. Int J Oral Maxillofac Implants 1994;9:169-78. 9. Johansson G, Palmqvist S. Complications, supplementary treatment, and maintenance in edentulous arches with implant-supported fixed prostheses. Int J Prosthodont 1990;3:89-92. 10. Tan KB, Rubenstein JE, Nicholls JL, Yuodelis RA. Three-dimensional analysis of the casting accuracy of one-piece, osseointegrated implant-retained prostheses. Int J Prosthodont 1993;6:346-63. 11. Stumpel LJ 3rd, Quon SJ. Adhesive abutment cylinder luting. J Prosthet Dent 1993;69:398-400. 12. Humphries RM, Yaman P, Bloem TJ. The accuracy of implant master casts constructed from transfer impressions. Int J Oral Maxillofac Implants 1990;5:331-6. 13. Tautin FS. Impression making for osseointegrated dentures. J Prosthet Dent 1985;54:250-1. 14. Henry PJ. An alternative method for the production of accurate casts and occlusal records in osseointegrated implant rehabilitation. J Prosthet Dent 1987;58:694-7. 15. Branemark PI, Zarb GA, Albrektsson T. Tissue-integrated Prostheses. Osseointegration in Clinical Dentistry. Chicago: Quintessence; 1985. p. 11-2, 253-7. 16. Hsu CC, Millstein PL, Stein RS. A comparative analysis of the accuracy of implant transfer techniques. J Prosthet Dent 1993;69:588-93. 17. Phillips KM, Nicholls JI, Ma T, Rubenstein J. The accuracy of three implant impression techniques: A three-dimensional analysis. Int J Oral Maxillofac Implants 1994;9:533-40. 18. Herbst D, Nel JC, Driessen CH, Becker PJ. Evaluation of impression accuracy for osseointegrated implant supported superstructures. J Prosthet Dent 2000;83:555-61. 19. Spector MR, Donovan TE, Nicholls JI. An evaluation of impression techniques for osseointegrated implants. J Prosthet Dent 1990;63:444-7. 20. Vigolo P, Majzoub Z, Cordioli G. Evaluation of the accuracy of three techniques used for multiple implant abutment impressions. J Prosthet Dent 2003;89:186-92. 21. Cabral LM, Guedes CG. Comparative analysis of 4 impression techniques for implants. Implant Dent 2007;16:187-94. 22. Burawi G, Houston F, Byrne D, Claffey N. A comparison of the dimensional accuracy of the splinted and unsplinted impression techniques for the Bone-Lock implant system. J Prosthet Dent 1997;77:68-75. 23. Walker MP, Ries D, Borello B. Implant cast accuracy as a function of impression techniques and impression material viscosity. Int J Oral Maxillofac Implants 2008;23:669-74. 24. Carr AB. Comparison of impression techniques for a two-implant 15-degree divergent model. Int J Oral Maxillofac Implants 1992;7:468-75. 25. Akça K, Cehreli MC. Accuracy of 2 impression techniques for ITI implants. Int J Oral Maxillofac Implants 2004;19:517-23. 26. Vigolo P, Majzoub Z, Cordioli G. In vitro comparison of master cast accuracy for single-tooth implant replacement. J Prosthet Dent 2000;83:562-6. 27. Hariharan R, Shankar C, Rajan M, Baig MR, Azhagaranan NS. Evaluation of accuracy of multiple dental implant impressions using various splinting materials. Int J Oral Maxillofac Implants 2010;25:38-44. 28. Inturregui JA, Aguilino SA, Ryther JS, Lund PS. Evaluation of three impression techniques for osseointegrated oral implants. J Prosthet Dent 1993;69:503-9. 29. Assif D, Marshak B, Schmidt A. Accuracy of implant impression techniques. Int J Oral Maxillofac Implants 1996;11:216-22. 30. Wee AG. Comparison of impression materials for direct multi-implant impressions. J Prosthet Dent 2000;83:323-31.	e46663d8-1764-4d52-be0f-1fe6f784e5f4	CC-MAIN-2023-14	https://ipsonline.in/Files/AprilJune2016/11.pdf	2023-03-23T02:03:19+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-14/subset=warc/part-00286-39c03058-7d78-443d-9984-102329513e3d.c000.gz.parquet	378,616,170	8,085	eng_Latn	eng_Latn	0.948684	eng_Latn	0.9882	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 2460, 7612, 9796, 12214, 14429, 17964, 23248, 29030, 32034 ]
Developing sustainable shellfish and algal production systems to increase food security in Latin America and Asia. Ford Evans, Stephanie Ichien, and Hillary Egna. Aquaculture & Fisheries Collaborative Research Support Program, Oregon State University, Corvallis, OR 97331 aquafishcrsp.oregonstate.edu \| [email protected] Introduction According to the FAO, total world aquaculture production in 2009 reached 73.0 million tonnes. Although most of this production was achieved through the culture of freshwater finfish species such as carp, tilapia, and catfish (30.6 million tonnes), a large fraction was attributable to the culture of molluscan shellfish (13.5 million tonnes) and algae (17.3 million tonnes). With over 90% of the total world aquaculture production occurring in least-developed and developing countries, shellfish and algae play an important role in food security and income generation for the neediest smallholder farmers in impoverished coastal communities. With funding from the Aquaculture & Fisheries Collaborative Research Support Program (AquaFish CRSP), investigators from the United States and partnering host countries are working together in Latin America and Asia to develop and improve shellfish and algal production systems and to develop best management practices. This poster showcases these efforts and highlights the global role of AquaFish CRSP research in developing sustainable end-user level aquaculture systems to alleviate poverty and increase food security in coastal communities of least-developed and developing countries. Species Under Investigation Bivalve and algal species studied through AquaFish CRSP include: - Black Cockle (Anadara spp.) - Pacific Oyster (Crassostrea gigas) - Mangrove Oyster (Crassostrea corteziensis) - Sea Cucumber* (Holothuria scabra) - Red Algae (Gracilaria heteroclada) - Red Algae (Kappaphycus alvarezii) - Red Algae (Eucheuma spp.) Although not a bivalve, H. scabra* is included here because it is being paired with algae in AquaFish CRSP-sponsored research. Benefits to Smallholder Farmers/Fishers - Food security and employment in coastal communities - Nutritional source of protein, omega-3 fatty acids, and micronutrients - Minimal input requirements given that these species are either low trophic level species (shellfish) or primary producers (algae) - Simple and low-tech culture systems Ecosystem Services of Shellfish and Algae - Turbidity reduction by filtration - Biodeposition of organics and denitrification - Sequestration of carbon - Provision of structural habitat ("ecosystem engineers") - Habitat and shoreline stabilization - Nutrient uptake (e.g. N and P) Acknowledgements: The authors would like to acknowledge our partnering US and host country investigators, including: Dr. R. Bolivar, Dr. R. Borski, Dr. K. Fitzsimmons, Dr. E. Gaxiola, Dr. P. Gonzalez-Alanis, H. Hasanuddin, Dr. M. Haws, N. Hernandez, Dr. E. Jesus-Ayson, G. Rodriguez-Dominguez, and Dr. J. Supan. Related AquaFish CRSP Investigations RESEARCH INVESTIGATIONS - "Ration Reduction, Integrated Multitrophic Aquaculture (milkfish-seaweed-sea cucumber) and Value-Added Products to Improve Income and Reduce the Ecological Footprints of Shellfish Culture in the Philippines. North Carolina State University (USA), Southeast Asian Aquaculture Development Center (Philippines)" - "Demonstration of Sustainable Seaweed Culture and Processing in Aceh, Indonesia and the Philippines - Opportunities for Women to Improve Household Welfare. North Carolina State University (USA), Ujung Batu Aquaculture Center (Indonesia)" - "Oyster Collection, Growth Rates and Survival of the Native Oyster Species, Crassostrea corteziensis at Santa Maria Bay, Sinaloa, Mexico. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico)" - "Oyster-relaying and Depuration in Open-water Locations. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico)" - "Determination of Carrying Capacity of the Boca Camachos Estuary in Reference to Oyster Culture. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico)" - "Optimal hatchery methods for the mangrove oyster, Crassostrea corteziensis for the Pacific Coast of Mexico. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico)" - "Microbiological Quality of Shellfish Growing Waters and Tissues. University of Hawaii-Hilo (USA), Universidad Centroamericana (Nicaragua)" - "Co-management and bivalve sanitation for black cockles (Anadara spp.) in Nicaragua. University of Hawaii-Hilo (USA), Universidad Centroamericana (Nicaragua)" WORKSHOPS & TRAININGS - "Training in Sustainable Coastal Aquaculture Technologies in Indonesia and the Philippines. North Carolina State University (USA), Central Luzon State University (Philippines) [Total number of trainees: 255]" - "Training in Best Management Practices for the Production of Molluscs in the States of Nayarit and Sinaloa. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico) [Total number of trainees: 28]" - "Co-sponsorship of "Second International Workshop on the Cultivation and Biotechnology of Marine Algae: An Alternative for Sustainable Development in Latin America and the Caribbean". University of Arizona (USA), Universidad Autonoma de Tamaulipas (Mexico) [Total number of trainees: 75]" - "International Workshop for Sanitaire Sanitaire. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico) [Total number of trainees: 136]" - "Regional Workshop on Shellfish Culture and Sanitation. University of Hawaii-Hilo (USA), Universidad Autonoma de Sinaloa (Mexico) [Total number of trainees: 43]" - "Intensive Training and Internship in Bivalve Culture and Shellfish Sanitation. University of Hawaii-Hilo (USA), Universidad Centroamericana (Nicaragua) [Total number of trainees: 8]"	<urn:uuid:5837f287-72f6-474e-8bf1-e9af6c7669bb>	CC-MAIN-2022-21	https://aquafishcrsp.oregonstate.edu/sites/aquafishcrsp.oregonstate.edu/files/shellfish_algae_poster_reduced.pdf	2022-05-20T05:02:45+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00138-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet	163,863,607	1,390	eng_Latn	eng_Latn	0.737766	eng_Latn	0.737766	[ "eng_Latn" ]	false	docling	[ 5911 ]
The Board of Directors of The University of Texas Investment Management Company (the "Corporation") convened in special meeting on the 15th day of September, 1997, at the offices of Hicks, Muse, Tate & Furst Incorporated, 200 Crescent Court, Suite 1600, Dallas, Texas, said meeting having been called by the Chairman, with notice provided to each Director in accordance with the Bylaws. Participating in the meeting were the following members of the Board of Directors: Thomas O. Hicks, Chairman Robert H. Allen Susan M. Byrne William H. Cunningham Richard W. Fisher J. Luther King, Jr. Tom Loeffler A.W. Riter, Jr. thus, constituting a majority and quorum of the Board of Directors. Also participating in the meeting were Thomas G. Ricks, President of the Corporation; Jerry E. Turner, Secretary of the Corporation; and Austin Long and David Russ of Corporation Management. Director Homer L. Luther, Jr. was absent from the meeting. Mr. Hicks called the meeting to order at 1:00 p.m. Approval of Minutes The first matter to come before the Board of Directors was approval of the minutes of the meeting of the Board of Directors held on August 6, 1997, copies of which had previously been furnished to each Director. Upon motion duly made and seconded, the following resolution was unanimously adopted: RESOLVED, that the minutes of the Meeting of the Board of Directors held on August 6, 1997, be and are hereby approved in substantially the form presented to the Board. Restructuring Plan — Public Markets Portfolios Next, Mr. Ricks and Mr. Russ reviewed a report, copies of which had previously been furnished to each Director, recommending a plan to restructure the public markets portfolios of the Permanent University Fund and the Long Term Fund. Mr. Ricks and Mr. Russ also responded to questions from the Directors. (Mr. King left the meeting during the course of the presentation by Mr. Ricks and Mr. Russ.) Following discussion by the Directors and upon motion duly made and seconded, the following resolutions were unanimously adopted. RESOLVED, that the plan to restructure the Permanent University Fund public markets portfolios, substantially in the form presented to the Board of Directors, be and is hereby approved, with the following modifications: (i) Apodaca Johnston Capital Management, Inc. shall be terminated as a small capitalization growth equity investment advisor and the funds previously managed by it shall be allocated pro rata among the remaining emerging managers of the small capitalization portfolios; and (ii) in rebalancing the large/mid capitalization portfolios, the proposed adjustments to the S&P 500 Indexed Fund and the S&P Mid Capitalization Indexed Fund shall be reversed such that the amount allocated to the S&P 500 Indexed Fund shall be reduced by approximately $229.6 million and the amount allocated to the S&P Mid Capitalization Indexed Fund shall be increased by approximately $190 million; and be it further RESOLVED, that the plan to restructure the Long Term Fund public markets portfolios, substantially in the form presented to the Board of Directors, be and is hereby approved. Alternative Equities - Marketable Mr. Ricks then introduced Matthew D. Lincoln and Lindsay I. Van Voorhis of Cambridge Associates, Inc., who had entered the meeting room. They distributed to each Director a booklet on "Absolute Return Investing", which they reviewed with the Directors. Mr. Ricks indicated that, if the Corporation decided to pursue absolute return investment strategies, he believes such strategies should be applied first with respect to the Long Term Fund, in order to test the impact upon income flow, before being applied to the Permanent University Fund. Mr. Lincoln, Mr. Van Voorhis and Mr. Ricks then responded to questions from Directors. (At this point, Mr. Lincoln and Mr. Van Voorhis left the meeting room.) Report of the Private Markets Group Next, Mr. Long distributed to each Director a Report of the Private Markets Group, dated September 15, 1997. Mr. Long reviewed the report with the Directors and answered their questions. Approval of Commitment to Doughty Hanson & Co. Funds III, L.P. The next matter to come before the Board of Directors was consideration of a proposed limited partnership investment in Doughty Hanson & Co. Funds III, L.P. Mr. Long reviewed a Short Form Due Diligence Memorandum & Recommendation describing the proposed limited partnership investment, copies of which had previously been furnished to each Director. Following discussion, upon motion duly made and seconded, the following resolution was unanimously adopted: WHEREAS, the Board has reviewed a Short Form Due Diligence Memorandum & Recommendation prepared by the Corporation's management recommending that the Corporation enter into a Limited Partnership Agreement (the "Agreement") with Doughty Hanson & Co. Limited to invest Permanent University Fund ("PUF") and Long Term Fund ("LTF") assets in Doughty Hanson & Co. Funds III, L.P. (the "Fund"), in an amount equal to $40 million; and WHEREAS, the Board desires to enter into the Agreement with Doughty Hanson & Co. Limited to invest PUF and LTF assets in the Fund in an amount equal to $40 million; and WHEREAS, the Corporation has determined that the Agreement does not constitute an agreement or transaction entered into in violation of Subsection 66.08(i) of the Texas Education Code; NOW, THEREFORE, BE IT RESOLVED, that the terms and provisions of the proposed investment as described in Doughty Hanson & Co. Funds III, L.P. Short Form Due Diligence Review & Recommendation dated September 15, 1997 be approved; and be it further RESOLVED, that the President and any Vice President of this Corporation be, and each of them hereby is, authorized to make such further revisions to the terms and provisions as may be necessary or in the best interests of this Corporation, excluding an increase in the amount of the capital commitment to the Fund; and be it further RESOLVED, that the President and any Vice President of this Corporation be, and each of them hereby is, authorized and empowered (any one of them acting alone) to do or cause to be done all such acts or things and to sign and deliver, or cause to be signed and delivered, all such documents, instruments and certificates (including, without limitation, all notices and certificates required or permitted to be given or made under the terms of the Agreement), in the name and on behalf of the Corporation, or otherwise, as such officer of this Corporation may deem necessary, advisable or appropriate to effectuate or carry out the purposes and intent of the foregoing resolutions and to perform the obligations of this Corporation under the Agreement and the instruments referred to therein. Approval of Restatement of UTIMCO 403(b) Plan Next, Mr. Ricks reviewed with the Directors an Amended and Restated UTIMCO 403(b) Tax Sheltered Annuity Plan, copies of which had previously been furnished to each Director. After discussion, upon motion duly made and seconded, the following resolutions were unanimously adopted: RESOLVED, that the Restatement of the UTIMCO 403(b) Tax Sheltered Annuity Plan (the “Plan”), a copy of which is attached and which is hereby directed to be marked for identification and filed with the records of the Corporation, be and hereby is approved and adopted on behalf of the Corporation; and be it further RESOLVED, that Thomas G. Ricks, Cathy A. Iberg and Christy W. Wallace are hereby designated as the Administrative Committee of the Plan to serve until their successors are chosen and qualify or until their earlier resignation or removal, and be it further RESOLVED, that any actions taken by the appropriate officers of the Corporation are hereby approved in the execution of the restatement of the Plan on behalf of the Corporation and any and all other acts and things necessary, in their opinion, to effectuate and accomplish the purposes of the foregoing resolution and to acquire and maintain a qualified status for the Plan under section 403(b) and other applicable provisions of the Internal Revenue Code of 1986, as amended, and the Employee Retirement Income Security Act of 1974, as amended. Annual Meeting Mr. Hicks then reminded the Directors that the Corporation’s Bylaws permit the Board of Directors to designate by resolution the time and place of the Annual Meeting of the Board of Directors. Upon motion duly made and seconded, the following resolution was unanimously adopted: RESOLVED, that the Annual Meeting of the Board of Directors of the Corporation shall be held on Thursday, October 30, 1997, beginning at 12:30 p.m., at the offices of Hicks, Muse, Tate & Furst Incorporated, 200 Crescent Court, Suite 1600, Dallas, Texas. Long Term Fund Distribution Rate Mr. Ricks recommended to the Board of Directors that the Long Term Fund distribution rate for the current fiscal year be increased to $0.180 per unit. Upon motion duly made and seconded, the following resolution was unanimously adopted: RESOLVED, that the Board of Directors of the Corporation recommend to the Board of Regents of The University of Texas System that the Long Term Fund distribution rate for the fiscal year beginning September 1, 1997 be increased from $0.175 per unit to $0.180 per unit. There being no further business to come before the Board of Directors, the meeting was adjourned at approximately 6:00 p.m. APPROVED: [Signature] Chairman [Signature] Secretary	<urn:uuid:92bede99-fff1-4802-96fa-173f39ad8ff8>	CC-MAIN-2025-08	https://fas.utimco.org/media/2869/minutes-bod-1997-09-15.pdf	2025-02-16T22:12:53+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-08/subset=warc/part-00261-b184e832-acd1-425a-bab7-895830f2748a.c000.gz.parquet	218,037,381	1,998	eng_Latn	eng_Latn	0.98977	eng_Latn	0.991033	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 1938, 4142, 6825, 9264, 9550 ]
MEMORANDUM To: Darlene Walter (Seaworld San Diego) From: Mark Storm, INCE Bd. Cert. (Dudek) Subject: Outdoor Noise Propagation Prediction for Proposed Nighttime "Drone" Display Date: April 1, 2019 cc: Asha Bleier (Dudek) Attachment(s): A – Glossary of Acoustical Terms At the request of Ms. Darlene Walter, this technical memorandum details the results of four studied scenarios for the predictive modeling of outdoor noise propagation of a planned aerial display of unmanned aerial systems (UAS, or "drones") proximate to the SeaWorld site in San Diego, CA. In summary, predicted aggregate noise level from anticipated flight of the drones would, depending on the studied operation scenario, range from 31 to 38 decibels A-weighted (dBA) equivalent sound level (Leq) at the southeastern edge of the Stony Point least tern nesting area in Mission Bay just north of the SeaWorld San Diego attractions. 1 Background 1.1 Project Description As summarized in an email from Ms. Walter to Alexander Llerandi of the California Coastal Commission on March 4, 2019, Dudek understands that SeaWorld San Diego is proposing to commence a new 5-minute duration summer night show that utilizes approximately five hundred (500) drones. Figure 1 depicts the first of two locations considered for the proposed drone activity, shown by the blue trapezoidal-shaped area just north of the SeaWorld attractions on the shore of Mission Bay and located approximately 1,500 feet from the Stony Point least tern nesting area. Additional information in Ms. Walter's email regarding the planned aerial drone display included the following: drones would be flying 400 feet above grade, and "anticipated dB level at the source will be approximately 6065dB." Subsequent email correspondence informed Dudek of an alternate drone display location, shown in Figure 2. Additionally, Ms. Walter requested that Dudek consider two operation scenarios for each proposed location: one involving the original proposed quantity of 500 drones, and an alternate featuring only 300 drones. 1 Source: Seaworld 2019 Source: Seaworld 2019 Figure 2. Alternate proposed location (red-encircled "Revised Site") of planned drone aerial display Subject: 1.2 Acoustical Fundamentals Sound is a process that consists of three components: the sound source, sound path, and sound receiver. All three components must be present for sound to exist. Without a source to produce sound, there is no sound. Similarly, without a medium to transmit sound pressure waves, there is no sound. Finally, sound must be received; a hearing organ, sensor, or object must be present to perceive, register, or be affected by sound or noise. Noise is defined as sound that is loud, unpleasant, unexpected, or undesired. Attachment A contains a glossary of common acoustical terms, metrics, and descriptors, among which several are used in this memorandum to frame the presentation and discussion of noise propagation prediction for the proposed drone display. Sound propagation (i.e., the passage of sound from a noise source to a receiver) is influenced by geometric divergence, acoustical ground absorption, atmospheric effects, and shielding by natural and/or man-made features. Sound levels attenuate (or diminish) at a rate of approximately 6 dB per doubling of travel distance from an outdoor point source due to spherical spreading of the sound wave energy. Atmospheric conditions such as humidity, temperature, and wind gradients can also affect sound levels; and in general, the greater the distance the receiver is from the source, the greater the potential for variation in sound levels due to atmospheric effects. Porous ground surfaces, such as loose soils or dense vegetative cover (grasses) absorb a portion of the propagating sound energy as it travels in proximity to grade, while smooth or hard ground surfaces (e.g., pavement, bodies of water) offer little or no acoustical absorption and instead provide a means of acoustical reflection. Additional sound attenuation can result due to linear occlusion of the direct source-to-receptor sound path, made possible by geographically intervening man-made structures or natural topography such as hills or ridgelines. 2 Methodology A Microsoft Excel 2016 workbook was used to predictively model noise propagation from the proposed drone display for each of four studied scenarios as follows: A. 500 drones in an area over the Mission Bay water just north of SeaWorld; B. 300 drones at this same location as scenario A; C. 500 drones in an alternate location, hovering over the eastern SeaWorld parking area; and D. 300 drones at the alternate location of scenario C. The Excel-based noise prediction model includes sound propagation algorithms consistent with relevant portions of International Organization of Standardization (ISO) 9613-2 1 that consider geometric divergence, atmospheric acoustical absorption at 1 kilohertz (kHz) to approximate A-weighted influence on overall sound pressure level 3 [SPL]), and ground effects. In summary, the predictive noise model was setup and "run" with input parameters that included the following: - The quantity of drones are modeled as a collective point source 400 feet in the air above grade, at the geographic center of the proposed bounded flight area. This means that 65 dBA (assumed per-source SPL at a distance of one meter) for each drone is logarithmically combined into a total per the following expression: ``` SPLtotal = SPLsingle + 10LOG(quantity of drones) ``` For example, 500 drones yields a source SPL of 65+10LOG(500) = 65 + 27 = 92 dBA at one meter. - The Mission Bay water surface or the SeaWorld San Diego parking lot is acoustically reflective, adding 3 dB to the point-source sound power level. - Noise levels are predicted over a horizontal plane 5' above grade (akin to a standing listener). - Meteorological conditions presume an air temperature of 10 degrees Celsius and seventy percent (70%) relative humidity. - Consistent with ISO 9613-2, the sound propagation algorithm conservatively presumes a "downwind" condition regardless of actual wind direction. - Structures and terrain are conservatively ignored (i.e., the model space is flat and featureless). 3 Predicted Results Figures 3, 4, 5, and 6 display the predicted results for each of the afore-listed scenarios A, B, C, and D, respectively. As shown, expected noise levels during the drone show are not expected to exceed 40 dBA Leq in the vicinity of Stony Point. At a distance of approximately 1,400 feet from roadway traffic on Ingraham Street, Stony Point is already exposed to existing outdoor ambient noise levels that are likely to be at least 40 dBA Leq based on guidance from the Federal Transit Administration (FTA). 2 2 FTA. 2006. Transit Noise and Vibration Impact Assessment. Available at: Figure 3. Predicted noise propagation of proposed drone aerial display (Scenario A – 500 drones) across Mission Bay in vicinity of Stony Point and SeaWorld San Diego Sources: Dudek 2019, Google Earth 2019 Sources: Dudek 2019, Google Earth 2019 Attachment A Glossary of Acoustical Terms Ambient Noise Level A-Weighted Sound Level (dBA) Community Equivalent Noise Level (CNEL) Decibel (dB) Equivalent Sound Level (Leq ) Maximum Sound Level (Lmax) Minimum Sound Level (Lmin) Statistical Sound Level (Lxx ) The composite of noise from all sources near and far. The normal or existing level of environmental noise at a given location. The sound pressure level (SPL) in decibels as measured on a sound level meter (SLM) using the A-weighted filter network. The A-weighting filter de-emphasizes the very low and very high frequency components of the measured sound in a manner similar to the frequency response of the average healthy human ear, and thus correlates well with assessment of environmental noise in a community setting where noise-sensitive receptors may be present. The A-weighted equivalent continuous sound level over a 24-hour period with a 10 dB adjustment added to sound levels occurring during the nighttime hours (10 p.m. to 7 a.m.), and 5 dB added to the sound during the evening hours (7 p.m. to 10 p.m.). The unit for expressing SPL and is equal to 10 times the logarithm (to the base 10) of the ratio of the measured sound pressure squared to a reference pressure, which is 20 micropascals. The value corresponding to a steady-state sound level containing the same total energy as a time-varying signal over a given sample period. The highest value measured by an SLM over a given sample period, based on a time-weighted sound level in dB using a "fast" or "slow" time constant. The lowest value measured by an SLM over a given sample period, based on a time-weighted sound level in dB using a "fast" or "slow" time constant. The sound level, in dB, that is exceeded "xx" percent of the time during a given measurement period. For instance, L50 is often called the "median" value as it is not the average or mean sound level. The L90 is often referred to as a "background" sound level, as it is exceeded 90% of the time and would therefore characterize the acoustical contribution of continuous or steadystate sources from a measurement period. The L10 level, in contrast, indicates infrequent high levels.	<urn:uuid:60db8a21-9f7f-49f7-b089-d1a6da049f76>	CC-MAIN-2024-18	https://files.ceqanet.opr.ca.gov/232434-7/attachment/ufKTiC1_agw9be-A_s5Fjh5cNQTeXlm_rp7O1wQ49XrRdAEyDmJt77frloBIyD8wRvl2Xio7-VqY1NqO0	2024-04-20T06:25:01+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-18/subset=warc/part-00209-29538f81-5664-4df2-acb6-7d8ba3d2a1aa.c000.gz.parquet	217,764,710	2,035	eng_Latn	eng_Latn	0.984772	eng_Latn	0.993085	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "unknown", "eng_Latn" ]	false	rolmOCR	[ 2066, 2215, 5025, 6868, 7076, 7116, 7160, 9317 ]
VOLUME 63 AUGUST 2018 NUMBER 8 $12.00 __________________________________________________________________________________________ Club Calendar August 1 UNS Board Meeting Sportsmen's Retreat 6:00 PM Pot Luck 7:00 PM Board Meeting August 4 Summer Picnic 12 pm Eat All Ranges Closed August 6-7 9-12 Rifle Range Closed Jason Garner/US Border Patrol August 8 UNS Membership Meeting Sportsmen's Retreat 6:00 PM Pot Luck 7:00 PM Meeting August 11 Youth Outdoor Field Day All Ranges Closed August 27-28 9-12 Rifle Range Closed Jason Garner/US Border Patrol Sept. 5 UNS Board Meeting Sportsmen's Retreat 6:00 PM Pot Luck 7:00 PM Board Meeting Sept. 12 UNS Membership Meeting Sportsmen's Retreat 6:00 PM Pot Luck 7:00 PM Meeting RANGE USE CALENDAR may be found on our Website: uns-duluth.com Shooting Hours A reminder about our shooting times. The ranges are open from 8:00 a.m. to ½ before sunset. Range closing times are posted on the ranges and also on the bulletin board on the Retreat Bldg. Please obey the rules or you may lose your shooting privileges. 2018 UNS Summer Picnic ON SATURDAY, AUGUST 4TH We will be having a great BBQ lunch, adult bean bag tournament and lots of games for the children. Come spend the day with us at UNS! Sign in 11:00 am Lunch 12:00 noon Fun & Games 1:00 to 3:00 pm Anyone interested in volunteering at the event or have suggestions, please contact Dana Dallum at 218-428-9192. 11th ANNUAL YOUTH OUTDOOR FIELD DAY One of our clubs priorities is to try to keep our youth involved in the great outdoors. On August 11th UNS will be hosting the 11th annual Youth Outdoor Field Day along with the Lake Superior Chapter of the Minnesota Deer Hunters Association. The activities will be similar to those in past years such as high-powered (deer) rifles, small bore range (.22 cal), archery range, trap range, black powder demonstration, tree stand safety, trapping seminar and we have the very popular Black River Bandits booked for the day as well. Lunch will be served, and participants will have a chance to take home a great prize. As always, this event is free! While we are just finishing up the final details for the 11th annual Youth Outdoor Field Day event that is hosted in conjunction with MDHA, registration has begun. The event is open to the first 80 kids (ages 8 to 16). See page 2 for more details. This year's UNS event chairs will be Cody and Kathleen Privette. If you are interested in helping out the day of the event contact Cody at 218-260-2932 or Codyprivette@gmail. com. DNR's first statewide deer plan aims to increase transparency, build relationships A new statewide deer plan released today by the Minnesota Department of Natural Resources sets new goals and priorities, increases formal opportunities for citizens to influence deer decisions, and aims for a disease-free deer population. The 50-plus page plan is available on the DNR website at https://www.mndnr.gov/deerplan. The plan reflects a two-year planning effort that involved statewide meetings and hundreds of in-depth conversations with citizens and stakeholders. It includes input from a 19-member citizen advisory committee, dozens of public input meetings and open houses, more than 1,100 submitted comments and letters from tribal governments, hunting organizations and others. "We've listened, and the plan reflects that," said Tom Landwehr, DNR commissioner. "The document is largely about sharing a vision, clarifying expectations and improving two-way communication among hunters and other stakeholders for the benefit of deer management." Ruffed grouse counts down, sharp-tailed grouse down too Minnesota's ruffed grouse spring drumming counts were down 29 percent statewide this year compared to last year, according to a survey conducted by the DNR. See https://www.mndnr.gov/hunting/grouse. "Surveys indicate the peak occurred last year," said Charlotte Roy, DNR grouse project leader. "Grouse populations tend to rise and fall on a decade-long cycle and counts this year are pointing to the peak lasting only one year this cycle. This has occurred before, but it's always nice when the cycle stays high a little longer." UNS July MEMBERSHIP MEETING Minutes July 11th, 2018 Call to Order: by Director John Bathke at 7:00 pm. Conservation Pledge. Roll Call of Officers: Tina Sund, Mike Foy, Larry Chesney, Duane Lasley, Dave Shrader, Judy Foy, John Bathke, Sue Bathke, Mike Drager and Cody Privette. Excused Officers: Bob Kuettel, Tom Wasbotten, Gene Shaw, Dan Smestad, Eric Hansen, and Bob Klein. New Member: Charlie Eck Correspondence: Thank you letter from the St. Louis River Alliance. Agenda Additions: Motion to approve the agenda with the new additions moved, seconded and carried (M/S/C). Reading of Minutes: Cody Privette read minutes from the June Membership Meeting. Motion to accept minutes as corrected moved, seconded and carried (M/S/C). Treasurer's Report - Tina Sund: as of 6/30/2018 - Motion made to approve the report and pay the bills (M/S/C). Membership Secretary's Report- Tina Sund: 1,549 current members. 155 reminders for August and 52 expired reminders. Committee Reports: Web Master – Eric Hansen: Eric not present. Newsletter Editor – Sue Bathke: Newsletter deadline is 7/15. Incident Reports – Mike Foy: July 4th people went through the range closed sign and went shooting instead. Had issue with people overstaying on the lake side. Had great help from campers cleaning the retreat. Retreat Improvements & Maintenance – Dave Shrader: Zero turn mower is fixed. 48" mower and weed whacker had oil changed. Had 12 new fire rings donated by UPI. Sprayed for weeds. Hauled logs and stacked wood. Had a great help from campers this week. Jay Finout helped out with his tractor hauling dirt. Installed bumper on the dock. Grants Committee – Mike Drager: Mike gave overview of the variance for the dump station from the MDH. DNR grants should be awarded soon. Will follow up again soon. Volunteer Awards – Dan Smestad: Dan not present. Facilities Calendar – Bob Kuettel: Bob not present. Finance Report – John Bathke: Committee meeting was postponed. OLD BUSINESS: Campground Long Range Planning – Nothing new to share. Summer Fishing Contest – Tina Sund: $2,018.01 total profit. Above last couple years profit. Answering Machine Update – Tina Sund: Tina has the instructions to change the voicemail. Will change soon. Summer Picnic- 8/4/18 – John Bathke: Dana Dallum will chair again this year. Registration is at 11, lunch starts at 12. Youth Outdoor Field Day – 8/11/18- Cody Privette: Gave overview of event. UNS Website Committee: Nothing new to share. NEW BUSINESS: UNS Banquet 2019 – Tina Sund: Banquet will be on a Saturday this year. 4/13/19 Rules for the UNS Club Facilities #13 Change : Addition of Camp Table Rule – John Bathke: John gave overview of rule change. "make changes to rule #13 on the camping rules to not allow hot items that will melt the plastic table to be placed on the table." Motion to approve the change (M/S/C). St. Louis County Volunteer Rescue Squad Donation $250 – John Bathke: John gave overview of the donation to be made to SLC rescue squad. Second Harvest Food Bank Donation $100- John Bathke: John gave overview of the donation made to Second Harvest Food Bank. Discussion followed about the Wildwoods facility. Attendance Drawing: Mike Drager won the $20.00. Progressive Drawing: Joel T Baker was not present, therefore did not win $70. Members sick or in distress: George Overfors- Moment of Silence. Adjournment: Motion was made (M/S/C) at 7:41 pm; Carried. Respectfully submitted by Cody Privette, Secretary. Next meetings will be the August BOD meeting on August 1st and the August Membership meeting on August 8th. Both will be at 7pm at the retreat. IT'S NOT YOUR IMAGINATION: RAINSTORMS ARE GETTING WORSE! Scientists are validating U.S. residents' perceptions that rainstorms are getting more severe. In recent weeks, intense precipitation has inundated the Great Lakes region, the Deep South and the suburbs of major cities along the Atlantic coast. In addition, several cities in Maryland saw serious downpours. Atmospheric researchers say the intense rains are the result of long-rising air temperatures and the rise in the utter size of the storms. Warmer air can hold more water, so storms can produce significantly more rain in a shorter time period. "Things are definitely getting more extreme," said Andreas Prein, an atmospheric scientist at the National Center for Atmospheric Research in Boulder, Colo. "You just have to look at the records. All areas of the continental U.S. have seen increases in peak rainfall rates in the past 50 years. ... And there is a chance that we are underestimating the risk, actually." (Craig/Fritz, Washington Post, June 24, Published June 26th) Bison's return could help save threatened oak savanna Bison are being reintroduced to Minnesota's Anoka area for the first time in over a century, part of a larger effort to save endangered oak savanna ecosystems. The mix of oak trees and prairie once made up 9 percent of the state. But under 1 percent remains after land clearing for crops and domestic animals. At the Cedar Creek Ecosystem Science Reserve, scientists have been looking at how to save the savanna since the 1960s. One critical piece is fire. It can help clear out plants and trees that shade the prairie and kill the grass. But it also makes it difficult for oak saplings to survive. Scientists hope the bison will remedy that problem by eating the grasses that compete for space and nutrients, making more room for oak saplings to grow and making blazes less intense. "It's bringing back a missing piece of the puzzle," said Forest Isbell, an assistant professor of ecology at the University of Minnesota who helped lead the project. "It's about time." At the same time, bison have likely been gone from the ecosystem for more than 150 years, so some scientists don't know what to expect. They could, for instance, just as easily trample the young oaks. "Whatever it is, it is — whether the bison come out to be the hero or goats," said David Tilman, Cedar Creek's director. (Hannah Covington, Minneapolis Star Tribune, June 17, Published June 18, 2018).	<urn:uuid:d6eacc5e-ef09-46fd-9c54-4a1fd95bf67e>	CC-MAIN-2019-09	http://unitednorthernsportsmen.org/Newsletter/Aug%202018.pdf	2019-02-21T12:18:40Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247504594.59/warc/CC-MAIN-20190221111943-20190221133943-00605.warc.gz	277,907,032	2,382	eng_Latn	eng_Latn	0.997797	eng_Latn	0.998158	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2608, 4245, 7882, 10356 ]
AN ORDINANCE CREATING A NEW SECTION 14-3.20 SFCC 1987 TO ESTABLISH RESIDENTIAL CONDOMINIUM REQUIREMENTS; AMENDING SECTION 14-6.3(D)(1) SFCC 1987 TO REQUIRE THAT A RESTRICTIVE COVENANT THAT IS REQUIRED TO BE IN COMPLIANCE WITH 14-6.3(D) BE RECORDED PRIOR TO THE ISSUANCE OF A CONSTRUCTION PERMIT FOR AN ACCESSORY DWELLING UNIT; CREATING A NEW SECTION 14-10.6 TO PERMIT LEGALLY NONCONFORMING RESIDENTIAL CONDOMINIUM UNITS; AND MAKING SUCH OTHER CHANGES AS ARE NECESSARY. BE IT ORDAINED BY THE GOVERNING BODY OF THE CITY OF SANTA FE: Section 1. A new Section 14-3.20 SFCC 1987 is ordained to read: 14-3.20 [New Material] RESIDENTIAL CONDOMINIUMS A. Applicability The provisions of this Section 14-3.20 apply to residential condominium declarations recorded on or after May 30, 2012 that create a condominium or that amend an existing condominium declaration to change the number of condominium units or reserved development rights. B. Requirements A residential condominium declaration shall contain written confirmation from the land use director that the proposed or amended condominium declaration complies with the zoning density requirements of Chapter 14 SFCC 1987. C. Submittals Prior to the recordation of a condominium declaration, the declarant shall submit information to the land use director sufficient to determine whether the proposed or amended condominium declaration is in compliance with the zoning density requirements of Chapter 14 SFCC 1987. The land use director shall determine the sufficiency of the information submitted. D. Written Confirmation of Compliance with Zoning Density Requirements of Chapter 14 If the proposed or amended condominium declaration complies with the zoning density requirements of Chapter 14 SFCC 1987, the land use director shall issue a written confirmation to the condominium declarant for inclusion in the contents of the condominium declaration as required by 47-7B-5 NMSA 1978. The land use director shall maintain copies of written confirmations issued pursuant to this Section 14-3.20. E. Existing Residential Condominiums (1) A condominium (including constructed condominium units and unconstructed condominium units in the form of reserved development rights) is in conformance with the zoning density requirements of Chapter 14 when: (a) The condominium meets the zoning density requirements of Chapter 14; or (b) The condominium met the zoning density requirements of Chapter 14 when the most recent condominium declarations were recorded. (2) A condominium (including constructed condominium units and unconstructed condominium units in the form of reserved development rights) is subject to the provisions of Section 14-10.6 (Nonconforming Residential Condominiums) if the condominium declarations were recorded prior to May 30, 2012, and: (a) The condominium does not meet the zoning density requirements of Chapter 14; and (b) The condominium did not meet the zoning density requirements of Chapter 14 when the most recent condominium declarations were recorded. Editor’s Note: For applicable state law see §47-7B-5 NMSA 1978 of the Condominium Act [47-7A-1 to 47-7D-20 NMSA 1978]. Section 2. Section 14-6.2(A)(5)(b)(ii) SFCC 1987 (being Ord. #2011-37, §8) is amended to read: (ii) Short-term rental units that are operated in compliance with Subsection 14-6.3(D)(1) (Accessory Dwelling Units) and in compliance with this Subsection 14-6.2(A)(5)(b)(ii) are allowed. Section 3. Section 14-6.3(D)(1) SFCC 1987 (being Ord. #2011-37, §8 is amended to read: (1) Accessory Dwelling Units Accessory dwelling units located on residentially zoned property: (a) Are required to meet parking standards as set forth in Section 14-8.6; (b) Shall be regulated as per City regulations and policies regarding City utilities; (c) Are exempt from the density restrictions set forth in this Chapter 14; provided, however, that only one accessory dwelling unit shall be permitted per legal lot of record; (d) Shall be built only when permission to construct is granted to the owner-occupant of the principal dwelling unit; (e) Shall have lot coverage not exceeding the square footage of the lot coverage of the principal dwelling unit or not more than one thousand five hundred square feet, whichever is less; (f) Shall be limited to one story and shall not exceed fifteen feet to the top of the parapet or to the highest point of the roof if there is no parapet; (g) Shall be of the same architectural style as the principal dwelling unit; (h) May be rented as follows: (i) By the owner-occupant who may rent the principal dwelling unit or the accessory dwelling unit as a short-term rental unit pursuant to Section 14-6.2(A)(5) during which time, the owner-occupant shall occupy either the principal dwelling unit or the accessory dwelling unit; or (ii) By the owner-occupant who may rent either the principal dwelling unit or the accessory dwelling unit; or (iii) By the property owner who may rent both the principal dwelling unit and the accessory dwelling unit to the same lessee, however, no separate subletting of either unit is allowed. (i) Shall not be issued a construction permit until a restrictive covenant is recorded at the office of the county clerk that requires the current property owner and all future property owners to comply with Section 14-6.3(D)(1). The covenant shall be in a form approved by the land use director and the city attorney and shall be notarized prior to recordation. A copy of the recorded covenants shall be provided to the land use director with the construction permit application. The land use director shall maintain copies of recorded covenants pursuant to the provisions of this section. An affidavit filed prior to the adoption of Ordinance No. 2008-5 (ordaining Subsection 14-6.2(A)(5)) and amending Subsection 14-6.3(D)(1) remains in effect and is automatically amended to reflect the provisions of Ordinance No. 2008-5. (j) Shall not be subdivided from a principal dwelling unit or sold under separate ownership from a principal dwelling unit unless the accessory dwelling unit meets all applicable requirements for a principal dwelling unit. In such case, the restrictions set forth in Section 14-6.3(D)(1) shall no longer apply and the affidavit or restrictive covenant in Section 14-6.3(D)(1) may be voided upon approval of the land use director; and (k) Shall remain in continuous compliance with the provisions of this section to maintain the validity of the certificate of occupancy of the accessory dwelling unit. The certificate of occupancy of an accessory dwelling unit may be revoked for noncompliance with this Section 14-6.3(D)(1) as provided in Article 14-11 (Enforcement). Section 4. A new Section 14-10.6 SFCC 1987 is ordained to read: 14-10.6 [New Material] NONCONFORMING RESIDENTIAL CONDOMINIUMS A. Applicability This Section 14-10.6 applies to a condominium (including constructed condominium units and unconstructed condominium units in the form of reserved development rights) if the condominium declarations were recorded prior to May 30, 2012, and: (a) The condominium does not meet the zoning density requirements of Chapter 14; and (b) The condominium did not meet the zoning density requirements of Chapter 14 when the most recent condominium declarations were recorded. B. Density Exception for Constructed Condominium Units Constructed condominium units described in Section 14-10.6(A) are legal nonconforming uses and structures with regard to the zoning density requirements of Chapter 14. A constructed condominium unit described in Section 14-10.6(A) that is destroyed by any means may be reconstructed if the reconstructed unit complies with all other applicable provisions of Chapter 14. C. Unconstructed Condominium Units Unconstructed condominium units described in Section 14-10.6(A), that are in the form of reserved development rights in excess of the zoning density requirements of Chapter 14, are not legal and may not be developed. D. Condominium Units Owned by the Original Declarant A condominium described in Section 14-10.6(A), where all condominium units are owned as of May 30, 2012 by the original declarant, or by an entity controlled by the original declarant, are not legal and are nonconforming uses and structures. E. Condominium Units Constructed without Required Permits Condominium units described in Section 14-10.6(A), that were constructed without required construction permits are not legal and are nonconforming uses and structures. Such condominium units must be issued all required construction permits and a certificate of occupancy to become subject to the provisions of Section 14-10.6(B). F. Applicability of Other Regulations The density exception provided in Section 14-10.6(B) is not intended to provide an exception to the other provisions of Article 14-10 regarding nonconforming uses and structures. Section 5. Article 14-12 SFCC 1987 (being Ord. #2011-37, §15, as amended) is amended to amend the following definition: OWNER-OCCUPANT or RESIDENT OWNER. As used in Sections 14-6.2(A)(5) (Short Term Rental of Dwelling Units) and 14-6.3(D)(1) (Accessory Dwelling Units) means a natural person who holds fee simple title and resides on the property. Section 6. Effective Date. This Ordinance shall be effective immediately upon adoption. PASSED, APPROVED AND ADOPTED this 30th day of May, 2012. DAVID COSS, MAYOR ATTEST: YOLANDA Y. WIGIL, CITY CLERK APPROVED AS TO FORM: GENO ZAMORA, CITY ATTORNEY	<urn:uuid:1870fef4-0eb1-48a4-aac4-c55780f0ad85>	CC-MAIN-2020-24	https://www.santafenm.gov/archive_center/document/5975	2020-06-06T15:32:28+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-24/subset=warc/part-00196-b4a094ce-c3a1-4796-8c26-d927e48e4b4a.c000.gz.parquet	865,770,008	2,255	eng_Latn	eng_Latn	0.834307	eng_Latn	0.976731	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "slk_Latn" ]	false	docling	[ 1130, 2820, 4266, 6068, 7939, 9490, 9579 ]
CHARTER TOWNSHIP OF ORION PLANNING COMMISSION SYNOPSIS – REGULAR MEETING – WEDNESDAY, NOVEMBER 20, 2013 Open Meeting/Roll Call Chairwoman Thurber called the meeting to order at 7:00 p.m. Members Present: Carol Thurber, Justin Dunaskiss, Dick Christie, Don Walker, Karyn Pennington, Joe St. Henry Member Absent: John Steimel Minutes Motion carried to accept: the November 6, 2013, regular meeting minutes; the November 6, 2013, PC-2013-22, Mullins BBQ Restaurant SLU Public Hearing minutes; and, the November 6, 2013, PC-2013-23, Guest House SLU Public Hearing minutes as presented. Agenda Review and Approval Motion carried to accept the agenda as amended, which was to remove agenda item 8,A, Shops on Waldon Pond PUD Amendment to construct a Kroger Fuel Facility D-649, at the petitioner's request. Public Comments for Non-Agenda Items Public comments were heard. Consent Agenda No items. ___________________________________________________________________________________________________________________ Chairwoman Thurber recessed the regular meeting and opened the PC-2013-24, Pomeroy Living-Orion Campus Special Land Use Public Hearing at 7:05 p.m. and closed it at 7:14 p.m. Chairwoman Thurber reconvened the regular meeting at 7:14 p.m. ___________________________________________________________________________________________________________________ New Business A. PC-2013-24, Pomeroy Living – Orion Campus Special Land Use and Site Plan located on the east side of Lapeer Road between Scripps Road and Stadium Drive (Sidwell #09-14-400-016). Motion carried to approve the special land use. Motion carried to postpone action on the site plan. Motion carried to approve the building design. Unfinished Business A. PC-2013-03, Shops on Waldon Pond Planned Unit Development (PUD) Amendment to construct Kroger Fuel Facility D-649, southeast corner of Baldwin and Waldon Road s. This agenda item was removed from the agenda at the petitioner's request. B. PC-2013-17, Clark-Orion, Inc. Gas Station Special Land Use & Site Plan, 3865 S. Baldwin Road, Sidwell #09-29-326-016. Motion carried to approve the special land use with conditions. Motion carried to approve the site plan with conditions. C. PC-2013-26, Text Amendment to Zoning Ordinance No. 78, Article III, Temporary Use Permits. Discussion only. No action taken. Planner Wortman will revise the proposed text as discussed. Public Comments None. Communications None further. Committee Reports Chairwoman Thurber commented regarding her report for the Site Walk Committee's recent site walk for case PC-2013-24, Pomeroy LivingOrion Campus SLU and Site Plan, which was held on Friday, November 15, 2013 at 5:00 p.m. Upcoming Public Hearing A. 12-04-13, PC-2013-26, Text Amendment to Zoning Ordinance No. 78, Article XXX, Temporary Use Permits Public Hearing is scheduled for 7:05 p.m. Adjournment Motion carried to adjourn at 8:42 p.m.	<urn:uuid:3168b77c-0a13-4eb8-be08-37bdbb10e34d>	CC-MAIN-2018-47	http://oriontownship.org/Portals/33/planning/2013/PC-11-20-13-Synopsis.pdf	2018-11-14T21:35:48Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-47/segments/1542039742316.5/warc/CC-MAIN-20181114211915-20181114233915-00116.warc.gz	255,845,487	729	eng_Latn	eng_Latn	0.987689	eng_Latn	0.987689	[ "eng_Latn" ]	false	rolmOCR	[ 2951 ]
I. Call to Order & Roll Call II. Changes or Additions to the Agenda III. Approval of Previous Meeting Minutes a. November 2021 Regular Meeting IV. Public Comment a. Greenspire ARP ESSER III Plan Use of Funds Feedback V. Recognitions VI. Board Correspondence VII. Presentations VIII. Reports a. Superintendent's Report b. President's Report c. Treasurer's Report i. CSP Grant d. Authorizer's Report e. Faculty Summary IX. Consent Agenda a. Committee Reports i. Facilities & Finance ii. School Expansion iii. Personnel iv. Curriculum & School Improvement Team v. Student Support Council X. Discussion Items XI. Action Items a. Emergency Operations Plans i. Middle School ii. High School b. Enrollment Policy 2022-2023 XII. Public Comment XIII. Adjournment into Closed Session a. Quarterly Superintendent Feedback and Review Session XIV. Reconvene Open Session XV. Adjournment Upon request, The Greenspire School shall make all reasonable accommodations for a disabled person to attend this meeting. BOARD OF EDUCATION Regular Meeting - December 13, 2021 ~ 5:30 pm Video Conference via Zoom https://us02web.zoom.us/j/82699008237	<urn:uuid:a2c8fdc2-f13b-441e-878b-cfa643eecbde>	CC-MAIN-2022-05	https://greenspireschool.org/wp-content/uploads/2021/12/Greenspire-Board-Agenda-December-2021-.pdf	2022-01-21T19:43:17+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-05/subset=warc/part-00147-1e2959d8-5649-433a-b76e-f1b876a6479d.c000.gz.parquet	345,973,144	294	eng_Latn	eng_Latn	0.737558	eng_Latn	0.737558	[ "eng_Latn" ]	false	rolmOCR	[ 1142 ]
VALLEY STRIDERS CYCLING CLUB SAFETY GUIDELINES Valley Striders Cycling Club is committed to encouraging participation in cycling of all ages. The provision which we offer for junior (<12 years), youth cyclists (12-15 years) and young adult cyclists (16-17 years) are different and are summarised below: 1. JUNIOR CYCLISTS (up to age 11 years) We consider "Junior Cyclists" to be those at junior school, so below the age of 12. The club will act as an information source only for junior cyclists, providing relevant information about opportunities such as the following: 1. other clubs' training sessions which may be appropriate 3. bike handling skills training 2. sportives and organised events which are family friendly in that they encourage participation by cyclists who are below 18. 4. races such as grass track, cyclocross or multi-sports. We are unable to accommodate junior cyclists on VSCC organised rides. On occasion however we may organise "junior cyclist friendly" events. These will be clearly communicated and will typically be family focussed to encourage younger riders to get on their bikes and to take part in longer road rides. 2. YOUTH CYCLISTS (aged 12-15 years) We consider "Youth Cyclists" to be those at secondary school, so aged 12 or older. The club actively encourages participation from youth cyclists in club rides and will offer informal encouragement, support and direction to help develop appropriate skills and experience for whatever type of road cycling they desire to pursue. The rules for participate by youth cyclists are: 1. Youth cyclists must be accompanied and supervised by a ride-guardian on all rides. 3. VSCC are not able to offer formal ride-guardian services to youth cyclists, and all arrangements for supervision must be agreed between the youth cyclist's parent/guardian and their nominated ride-guardian. 2. A ride-guardian for a youth cyclist may be appointed with written consent of the parent/legal guardian using form XXX which can be found in XXXX and must be submitted to the ride leader prior to the ride commencing 4. Ride-guardians may be the youth cyclists parent, guardian or friend and must be 21 or older. 5. In the event of a youth cyclist requiring to break away from a VSCC ride (due to such things as tiredness, inability to maintain the pace of the group, bicycle mechanical problem, accident) it will be the sole responsibility of their ride-guardian to ensure the appropriate actions are taken to remedy the situation. o the ratio of ride-guardian to youth cyclist must be a maximum of 2 youth cyclists to every 1 ride-guardian 6. Where a ride-guardian is responsible for more than 1 youth cyclist, they will remain responsible for both of their youth cyclists and ensure they all remain safe and together with the group throughout the ride. If 1 youth cyclist or their ride-guardian needs to break away from the group, then both of the youth cyclists with their ride-guardian will also need to. 7. VSCC ride leaders will seek to incorporate the youth cyclist in to the group ride, but will not be obliged to make special provisions to cater for their needs, as they will remain responsible for the entire group of cyclists. There is no limitation on the ride that the youth cyclist can join, provided they have the ability to keep up and display the appropriate behaviours to engender the trust of the ride leader. 9. Additionally, if whilst on a VSCC organised ride, the Ride Leader considers the youth cyclist to be in need of remedial action or support to continue on VSCC rides, that support and action is the responsibility of the youth cyclist ride-guardian. This recommendation would normally be made at the end of a ride, however if the ride-leader feels that any dynamic situation is jeopardising the safety of the group or any of its riders, the youth cyclist and his ride guardian may be asked to leave the ride and return home by their own means. The ride leader will inform the Junior Section Officer so contact or assistance can be offered 8. The youth cyclist and their ride-guardian are accompanying the VSCC organised ride, but unlike a situation where an adult rider requires remedial action or support, in the case of the youth cyclist that remedial action remains the sole responsibility of the ride-guardian. In such an event, it is anticipated that the VSCC ride group will continue on its ride leaving the ride-guardian and youth cyclist to return home by their own means. 3. YOUNG ADULT CYCLISTS (aged 16-17 years) We consider "Young Adult Cyclists" to be those aged 16 or 17. The club actively encourages participation from young adult cyclists in club rides and will offer informal encouragement, support and direction to help develop appropriate skills and experience for whatever type of road cycling they desire to pursue. The rules for participate by young adult cyclists are: 1. Participation in at least 2 VSCC organised rides with different ride leaders. 2. Written permission from their parent or legal guardian using the " Parental Consent Form" which can be found in files section of the VSCC FB page and must be submitted to the ride leader prior to their first unaccompanied ride. *On this form the parent/guardian will be required to state the dates and ride leaders who have witnessed the young adult cyclist on their ride, in order for them to be able to offer a reference that the young adult cyclist is, in their opinion, suitable to ride unaccompanied on an organised ride. Once the form is accepted by VSCC and logged centrally on the Valley Striders Dropbox, the young adult riders will be able to participate in rides and treated as adults. It is therefore the responsibility of the parent/guardian to consider whether their young adult cyclist is able to safely join an adult activity unsupervised. VERSION CONTROL V1.0 Issued 15/09/2015 JB/HK V 1.1 Issues 15/09/2016 JB	<urn:uuid:4e1252ba-40be-4b0d-a29e-ea6a07ee3bbe>	CC-MAIN-2020-40	https://vscc.now.sh/assets/docs/VSCC-Juniors-Policy-v-1.1.pdf	2020-10-01T21:35:38+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-40/subset=warc/part-00029-50bb8e61-7c5b-4d2c-bd34-dad6ca92b697.c000.gz.parquet	679,672,398	1,267	eng_Latn	eng_Latn	0.998812	eng_Latn	0.998825	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3263, 5926 ]
Brockville Police Service 2008 Annual Report "Teamwork Is Our Strength" Messages from The Chief of Police Adrian Geraghty It is my pleasure to present to you the Brockville Police Service Annual Report for the year 2008. I would like to extend my sincere appreciation to the Chair and members of the Board for their ongoing support of the Service. In 2007, the foundation of our service delivery review commenced with the intent of examining staffing levels and to establish adequate levels of service for the community in the most cost effective manner. I thank the members of our service and the members of the public for their continued support. Community policing is the police and the public working together to make a safe place in which to live, work and play. Adrian Geraghty Police Chief Vision The Brockville Police Services' vision of the future is one of change to being more proactive in the delivery of community policing: strengthening the role of enforcement of federal, provincial and municipal laws, and the provision of quality management of the Police Service. The Brockville Police Service is a progressive, community oriented Police Service, which owes a great deal of success to the dedication of our officers and civilian employees, the cooperation of the citizens of our City, the support of City Council and staff as well as the guidance of the Brockville Police Services Board. Members of the Brockville Police Service are very committed to working with the youth of the community, as well as creating and maintaining co-operative partnerships with community groups, to help keep Brockville a healthy and safe community. 2007 marked the 175th anniversary of the Brockville Police Service and it is our goal to continue delivering a high level of service to the community into the future. King Yee Jr. Chair, Brockville Police Services Board Mission Statement The Brockville Police Service, while responding to the needs of our multiracial and multi-cultural society, will maintain a standard of excellence in professional conduct and community service. Attention to Youth Youth continue to play an important part in the future of the Brockville Police Service. From an early age our V.E.P. (Very Effective People) program with Sergeant Doug Locke continues to show young people proper and healthy choices to make in life. Our High School "Adopt-a-Cop" program with interaction of our police officers on a daily basis has been a successful endeavour. Our V.I.P.P. (Volunteering in Policing Program) helps to create a partnership with our local St. Lawrence College Police Foundation students with handson experience with our Police Service. Communications Our Police Service continues to be proactive in providing the citizens of Brockville the latest information of crime trends. Through our state of the art website to "Brockville's Most Wanted" section we strive to make Brockville the safest place to live, learn, work and play. Community Partnerships Our strength in our Police Service is our people who make a difference every day in the continued partnerships with community organizations. There's not an organization in our community that we don't touch somehow with police interaction, board participation or committee involvement. This interaction makes our community a better place because of the personal touch by the men and women of our Police Service. Visibility and Presence Our H.E.A.T. (High Enforcement Action Team) Program in our downtown corridor meet the growing need of enforcement and visibility. It offers a chance for the citizens to interact with the police officers on the street. Once again our participation in the downtown sidewalk sale gave us the opportunity to display our fleet along with services and programs of our Police Service. Crime Statistics \| \| \| \| 2007 \| \| 2008 \| \| % Change \| \|---\|---\|---\|---\|---\|---\|---\|---\| \| Assaults \| \| 251 \| \| 229 \| \| -8.8% \| \| \| Sexual Assaults \| \| 25 \| \| 19 \| \| -24% \| \| \| Robbery \| \| 4 \| \| 7 \| \| 75% \| \| \| Break and Enter \| \| 146 \| \| 155 \| \| 6.2% \| \| \| Theft \| \| 551 \| \| 822 \| \| 49.2% \| \| \| Frauds \| \| 94 \| \| 91 \| \| -3.2% \| \| \| Bail Violations \| \| 191 \| \| 285 \| \| 49.2% \| \| \| Arson \| \| 6 \| \| 2 \| \| -66.7% \| \| \| Counterfeit Currency \| \| 6 \| \| 11 \| \| 83.3% \| \| \| Disturb the Peace \| \| 141 \| \| 131 \| \| -7.09% \| \| \| Indecent Acts \| \| 7 \| \| 14 \| \| 100% \| \| \| Mischief to Property \| \| 284 \| \| 326 \| \| 14.8% \| \| \| Drugs \| \| 122 \| \| 130 \| \| 6.6% \| \| \| Impaired Driving \| \| 44 \| \| 41 \| \| -6.8% \| \| \| \| Totals* \| \| 1,872 \| \| 2,263 \| \| 20.89% \| * Selected Categories The Brockville Police Service responds to the needs of our community through a combination of preventative, pro-active and reactive programs. 2008 Joint Forces Operations Project "Islander" is a joint-forces drug enforcement team comprised of investigators from Brockville Police Service, the Ontario Provincial Police drug enforcement section, Leeds County detachment of the Ontario Provincial Police and Gananoque Police Service. Cash Seized - $644,795 (CDN) $3,290 (USD) Property Seized - $338,100 2008 Expenditures 2008 Staffing Levels \| \| Position \| \| Authorized \| \| Actual \| \|---\|---\|---\|---\|---\|---\| \| Chief of Police \| \| 1 \| \| 1 \| \| \| Deputy Chief \| \| 2 \| \| 2 \| \| \| Staff Sergeant \| \| 1 \| \| 1 \| \| \| Sergeants \| \| 6 \| \| 6 \| \| \| Constables \| \| 29 \| \| 29 \| \| \| \| Total Police Staff \| \| 39 \| \| 39 \| \| Special Constables \| \| 6 \| \| 6 \| \| \| Civilians \| \| 19 \| \| 19 \| \| \| \| Total Civilian Staff \| \| 25 \| \| 25 \| \| \| Total \| \| 64 \| \| 64 \| 2008 Budget \| \| 2008 Summary \| \| Budget \| \| Actual \| \|---\|---\|---\|---\|---\|---\| \| Revenue \| \| $ 899,434 \| \| $ 1,339,229 \| \| \| Expenditures \| \| $ 6,672,699 \| \| $ 7,130,459 \| \| \| \| Net \| \| $ 5,773,265 \| \| $ 5,791,230 \| Calls for Service \| \| \| 2007 \| \| 2008 \| \| % Change \| \|---\|---\|---\|---\|---\|---\|---\| \| Calls for Service \| 13,220 \| \| 11,902 \| \| -9.97% \| \| \| Population \| 22,257 \| \| 22,113 \| \| -0.65% \| \| Public Complaints \| \| Type \| \| 2007 \| \| 2008 \| % Change \| \|---\|---\|---\|---\|---\|---\|---\| \| \| Total Complaints \| \| 5 \| \| 5 \| 0% \| \| Unsubstantiated \| \| 2 \| \| 5 \| \| \| \| Substantiated \| \| 0 \| \| 0 \| \| \| \| Withdrawn \| \| 3 \| \| 0 \| \| \| \| Pending \| \| 0 \| \| 0 \| \| \| Clearance Rates \| \| \| 2007 \| \| \| \| \| 2008 \| \| \| \| \|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\|---\| \| \| \| Actual \| \| Cleared \| % \| \| Actual \| \| Cleared \| % \| \| Crimes of Violence \| 447 \| \| 414 \| \| 92.6% \| 379 \| \| 335 \| \| 88.4% \| \| Property Crimes \| 1,108 \| \| 330 \| \| 29.8% \| 1,424 \| \| 358 \| \| 25.1% \| \| Other Criminal Code \| 448 \| \| 406 \| \| 90.6% \| 555 \| \| 486 \| \| 87.6% \| \| Drugs \| 122 \| \| 111 \| \| 91.0% \| 130 \| \| 120 \| \| 92.3% \| "Partners for a Safe and Healthy Community" COMMUNITY SAFETY SERVICES Safe Schools Safe Streets Safe Community Rail Safety Crossing Guards VEP Program VIPP Program Risk Watch Crime Prevention Asset Development PATROL SERVICES 24/7 Community Patrol Media Liaison Canine Services Marine Services Bike Patrol SOCO Invest Adopt-A-Cop Special Events 911 Dispatch ERT – Emergency Response Team SUPPORT SERVICES CPIC / CRISYS OPTIC – CAD / RMS Integrated Justice Information Services Communications Board Licensing Criminal Records Property / Evidence ADMINISTRATIVE SERVICES Financial Services Technical Services Training - External Clerical Services Human Resources Professional Standards Records Services FOIPP Provincial Standards Fleet / Facility Emergency Planning INVESTIGATION SERVICES Detectives Intelligence / CISO Forensic Ident Drugs / JFO Major Crime Invest. DNA/VICLAS COURT SERVICES Court Security Case Management Crown Liaison Court Liaison Prisoner Escort WASH Court POA Services Document Service Deputy Chief OPERATIONS Deputy Chief ADMINISTRATION Chief of Police BROCKVILLE POLICE SERVICES BOARD CITY OF BROCKVILLE A World Health Organization“ Designated Safe Community” March, 2007 Police Service Community 2008 GOALS –CORPORATE PRIORITIES - Reducing the Fear of Crime - Support to Victims of Crime - Selective Traffic Management - All Offences Against the Elderly - Asset Building for Children & Youth - Effective & Efficient Community Policing - Sexual / Domestic / Child Abuse Prevention - Compliance with Provincial Adequacy Standards - Safe Schools, Safe Neighbourhoods, Safe Communities	<urn:uuid:dbf15664-388e-4dd9-97e9-1cbb77a9ce2c>	CC-MAIN-2018-26	http://brockvillepolice.com/wp/wp-content/uploads/2008AnnualReport.pdf	2018-06-24T05:08:29Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267866358.52/warc/CC-MAIN-20180624044127-20180624064127-00592.warc.gz	49,036,504	2,481	eng_Latn	eng_Latn	0.660584	eng_Latn	0.980996	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 72, 2095, 3825, 5159, 6798, 8408 ]
Scientiﬁc risk-taking and grant funding: A "risky research" agenda for NIH Pierre Azoulay, 1 MIT Sloan School of Management and NBER May 2023 Note: This piece was prepared for the Building a Better NIH project, a partnership between the Brookings Institution, the Institute for Progress, and the Good Science Project. For more information about the project, please visit the Building a Better NIH project page. Few topics elicit as much consensus as the idea that peer review punishes risk taking. Reports abound, ranging from the popular press to U.S. Congressional testimony, from tweets to the pages of Nature, and are authored by NIH-funded investigators and leading science policy makers (Kent, 2018; Kolata, 2009; Kornberg, 2007; Nielsen, 2022; Sutter, 2022; Woolston, 2014). So pervasive and prominent are these concerns that it leads scientists to write articles satirizing how riskadverse grant funders are and muse if even former Nobel Prize winners could receive funding for their seminal discoveries in the modern funding climate (Fields, 2014; Petsko, 2012). Yet, despite the abundance of anecdotes, there is surprisingly little evidence to support claims that peer review punishes risk taking. Azoulay et al. (2011) compare two grant funding mechanisms—the Howard Hughes Medical Investigator competitions and the R01 grants awarded by NIH—and show the former encourages more risk taking. Beyond just theoretical interest, grant funders potentially punishing risk taking has very direct implications for what research is undertaken. In a recent survey of investigators supported by Fast Grants, 78% stated they would make significant changes to their research program if they were not constrained by the demands of grant funding agencies, including pursuing more ambitious research programs, pivoting to new topics, and testing hypothesis others see as unlikely to succeed (Collison et al., 2021). More generally, the choice of what scientists choose to study is fundamental to determining the rate and direction of innovation. Not all proposed scientific projects, however, have an equal likelihood of extending the scientific frontier. High-risk, high-reward projects may be more likely to lead to breakthrough innovation (Foster et al., 2015; Uzzi et al., 2013; Veugelers and Wang, 2019; Wang et al., 2017). The costs of undersupplying risky research may be especially salient for earlystage fundamental research, because it is often the type of research providing the broadest shoulders for follow-on innovators to stand on (Aghion et al., 2008; Azoulay et al., 2019; Fleming et al., 2019). 1 The author did not receive financial support from any firm or person for this article or from any firm or person with a financial or political interest in this article. The author is not currently an officer, director, or board member of any organization with a financial or political interest in this article. This short document has two objectives. First, it reports on new results on scientific risk-taking in the context of competitive renewal decisions for R01 grants at NIH. I believe this evidence is useful both because most research on scientific risk-taking has focused on other settings, and because most research on scientific risk-taking typically studies novelty rather than risk-taking per se. Second, I propose a three-pronged research agenda for NIH as it considers how to encourage risk-taking. First, administrative data (which contains information about applications, not just funded grants) could be used to replicate the results, in particular to study whether the "risk-taking penalty" is present at the stage of a grant's initial cycle. Second, the NIH could help validate the metrics of scientific risk-taking proposed below. Third, I propose four ideas for randomized controlled interventions that could produce a solid empirical foundation for efforts at reforming the NIH peer review process to alleviate (or even reverse) the risk-taking penalty. 1. New evidence on risk taking and NIH grant renewal My collaborators and I study how risk taking is penalized or rewarded in 103,164 NIH-funded R01equivalent grant cycles, 1980-2015 (Greenblatt et al., 2022). After controlling for a robust set of covariates for investigator demographics and talent, institution quality, and grant characteristics, we observe the relationship between risk taking in publications that acknowledge funding from the grant and whether the grant was competitively renewed. Risk taking, much like creativity, is a nebulous concept. There is no consensus on what constitutes risk in science nor how it should be measured (Althaus, 2005; Franzoni and Stephan, 2021). As there are different aspects of risk taking, each of which may have distinct dynamics, it is unlikely a single measure of risk taking can fully represent the phenomenon. We develop four separate measures of risk taking, each of which captures a different way investigators may take risks (or how NIH study sections may evaluate risk). First, risk taking may be associated with more extreme tail outcomes, with greater variance in outcomes and both more exceptionally good and exceptionally bad results (Azoulay et al., 2011). Second, risky research may be more disruptive, seeking to overturn the status quo, rather than consolidative, reinforcing earlier results (Funk and Owen-Smith, 2017). Third, researchers may pivot from what they have done in the past to follow new scientific opportunities, capturing the idea that risk is not only inherent to the project itself but depends also on who is undertaking the project. Finally, researchers may stand out from the crowd, selecting projects that are intellectually distant from those of other investigators (Uzzi et al., 2013). Across each of these measures, we take a non-parametric approach in exploring effects across the full distribution of different levels of risk taking. This lets the data speak for itself in whether any observed effect is driven primarily by differences in conventional levels of risk taking, or alternatively, by extreme tail risk taking – arguably those projects with the most potential to lead to breakthrough innovation. Across each of these measures, we find that risk taking is penalized. When comparing grant cycles in the top and bottom decile of risk taking, grants with greater risk taking have a 9.5% lower renewal rate (20.5% decline) when measuring risk taking using extreme tail outcomes, an 11.1% lower renewal rate (24.4% decline) when measuring risk taking by its disruptiveness, a 7.7% lower renewal rate (16.9% decline) when measuring risk taking by an investigator pivoting from her prior research, and a 6.1% lower renewal rate (12.4% decline) when measuring risk taking by standing out from what other investigators are studying. The obdurate nature and magnitude of this risk penalty is shocking in light of the often-expressed desire by NIH officials to encourage and support "high-risk, high-reward" projects. Of course, two caveats are in order when interpreting these results. First, these four metrics have not been validated using external sources of data. Second, the data at our disposal is limited to information about funded grants. In particular, this implies that we cannot distinguish grants whose principal investigators unsuccessfully applied for a renewal from grants that simply lapsed because the scientists shifted their interest or left academic science. Our team would love the opportunity to make progress on both fronts, as explained below. The rest of this document will proceed on the assumption that the risk penalty we estimated corresponds to a robust, pervasive, and salient phenomenon within the NIH peer review system. 2. A "risky research" agenda I propose a three-pronged agenda to advance the state of knowledge in this area: (1) a retrospective analysis using NIH administrative data; (2) the validation of risk-taking metrics using external sources; and (3) randomized, controlled interventions. 2.1 Observational data The results mentioned above demonstrate that insights can be extracted from publicly available data. However, access to administrative data—especially information about unfunded applications—would provide a firmer foundation for empirical work in this area. First, one could examine whether the results extend to grants in their initial cycle. Second, one could distinguish between grants that the NIH declined to renew and those for which the grantee failed to submit a competitive renewal application. 2.2 Metrics The research mentioned above proposes four metrics of risk-taking that draw on bibliometric data (publications and citations) on the one hand, and the structure of the review process on the other hand (e.g., other grants funded by the same study section and institute). While these metrics have a certain amount of face validity, they need much more thorough characterization and validation. How do they correlate with expert judgement of risk taking? How do they correlate with reviewers scores in the peer review process? With access to full-text information for the grant application, is it possible to use modern word embedding techniques (such as SciBERT) to score applications for risk taking? 2.3 Randomized controlled interventions I sketch below four ideas for interventions. * Experiment #1. Randomly select a subset of R01 grantees and announce to them that if/when they choose to apply for a competitive renewal, their application should not contain any preliminary data. The hypothesis to be tested is that this early knowledge would allow the new investigator to choose a bolder agenda, relative to a situation where she will face the burden of early proof. * Experiment #2. Randomly select a subset of R01 grantees and announce to them (at the time they receive notice that their project has been funded) that the length of their grant is going to be extended by n years, where 1≤n≤5. The treated investigators would be secure in the knowledge that they face a longer time horizon than expected to plan their investigations. Nothing else would change (Epstein, 2011). 2 * Experiment #4. For a random subset of R01 grantees (in the first year of the grant cycle), announce that they will not have to submit yearly progress reports, and in fact are encouraged to follow the logic of their investigations, wherever it leads them. Do the treated applicants take on more risk? Are they more or less likely to submit a competitive renewal? * Experiment #3. For a random subset of special emphasis panels, implement a version of quadratic voting so that the intensity of evaluator sentiment, as well as the variance in sentiment, can be taken into account to generate a proposal score. Do the applications selected for funding under quadratic voting take on more scientific risk than those selected for funding under the traditional system? When assessing risk and reward for each of these interventions, I can imagine having three dimensions in mind: (i) cost, (ii) time to generate results, and (iii) organizational overhead needed. As can be seen, these experiments vary in their profile of costs and benefits to NIH. To various extents, however, they can be conducted in the regular course of peer review business. The biggest challenge is therefore likely to be the agency's own appetite for risk. 2 This may strike the reader as being very reminiscent of the MERIT R37 program. This is correct, but (1) to our knowledge, the R37 mechanism was never the target of a rigorous evaluation; and (2) the R37 was only awarded to applicants who score in the top 2 percentiles of the score distribution. But one may wonder if the investigators very skilled at impressing study section members are necessarily those whose taste for exploration are constrained by the current system. References Aghion, P., Dewatripont, M., & Stein, J.C. (2008). Academic freedom, private-sector focus, and the process of innovation. RAND Journal of Economics, 39(3):617-635. https://scholar.harvard.edu/files/stein/files/academic-freedom-rand-2008-final_0.pdf Althaus, C. E. (2005). A disciplinary perspective on the epistemological status of risk. Risk Analysis,25(3):567-588. https://onlinelibrary.wiley.com/doi/10.1111/j.1539-6924.2005.00625.x Azoulay, P., Graff Zivin, J.S., & Manso, G. (2011). Incentives and creativity: evidence from the academic life sciences. RAND Journal of Economics, 42(3):527-554. https://onlinelibrary.wiley.com/doi/10.1111/j.1756-2171.2011.00140.x Azoulay, P., Graff Zivin, J.S., Li, D., & Bhaven Sampat. (2019). Public R&D and Private-Sector Patenting: Evidence from NIH Funding Rules. The Review of Economic Studies, 86(1):117152. https://academic.oup.com/restud/article/86/1/117/5038510?login=true Collison, P., Cowen, T., & Hsu, P. 2021. What We Learned Doing Fast Grants. Future. https://future.com/what-we-learned-doing-fast-grants/ Epstein, J. A. (2011). Enhancing discovery and saving money with MERIT. Journal of Clinical Investigation, 121(4), 1226–1226. https://doi.org/10.1172/JCI57708 Fields, S. (2014). Would Fred Sanger get funded today? Genetics, 197(2):435-439. https://academic.oup.com/genetics/article/197/2/435/6074290 Fleming, L., Greene, H., Li, G., Marx, M., & Yao, D. (2019). Government-funded research increasingly fuels innovation. Science, 364(6446):1139-1141. https://www.science.org/doi/10.1126/science.aaw2373 Foster, J.G., Rzhetsky, A., & Evans, J.A. (2015). Tradition and Innovation in Scientists' Research Strategies. American Sociological Review, 80(5):875-908. https://journals.sagepub.com/doi/10.1177/0003122415601618 Franzoni, C., & Stephan, P. 2021. Uncertainty and Risk-Taking in Science: Meaning, Measurement and Management. National Bureau of Economic Research Working Paper #28562. https://www.nber.org/papers/w28562 Funk, R.J., & Owen-Smith, J. (2017). A Dynamic Network Measure of Technological Change. Management Science, 63(3):791-817. https://doi.org/10.1287/mnsc.2015.2366 Greenblatt, W., Maity, S.K., Roger P. Levy, and Pierre Azoulay. 2022. "Does Grant Peer Review Penalize Scientific Risk Taking? Evidence from the NIH." Working Paper, MIT. Kent, D. 2018. Scientists can't take risks until they are in their 40s. University Affairs. https://www.universityaffairs.ca/opinion/the-black-hole/scientists-cant-take-risks-until-theyare-in-their-40s/ Kolata, G. (2009). Grant System Leads Cancer Researchers to Play it Safe. New York Times. https://www.nytimes.com/2009/06/28/health/research/28cancer.html Kornberg, R.D. (2007). 2006 Nobel Laureates. U.S. Senate Committee on Commerce, Science, and Transportation. https://www.commerce.senate.gov/2007/5/2006-nobel-laureates Nielsen, M. (@michael_nielsen). (2022). (A brief afternoon rant.) Twitter. https://twitter.com/michael_nielsen/status/1559318292120027137 Petsko, G.A. (2012). Goodbye, Columbus. Genome Biology, 13(5):155. https://genomebiology.biomedcentral.com/articles/10.1186/gb-2012-13-5-155 Sutter, P. M. (2022). Risk Aversion Is Ruining Science. Undark. https://undark.org/2022/04/27/risk-aversion-is-ruining-science/ Uzzi, B., Mukherjee, S., Stringer, M., & Jones, B. (2013). Atypical Combinations and Scientific Impact. Science, 342(6157):468-472. https://www.science.org/doi/10.1126/science.1240474 Veugelers, R. & Wang, J. 2019. Scientific novelty and technological impact. Research Policy 48:1362-1372. https://www.sciencedirect.com/science/article/abs/pii/S0048733319300459?via%3Dihub, Wang, J., Veugelers, R., & Stephan, P. (2017). Bias against novelty in science: A cautionary tale for users of bibliometric indicators. Research Policy, 46:1416-1436. https://www.sciencedirect.com/science/article/abs/pii/S0048733317301038?via%3Dihub Woolston, C. (2014). Sanger's legacy stirs up digital chatter. Nature, 511(9). https://www.nature.com/articles/511009f	<urn:uuid:fd77e821-8f6b-44be-82be-973feadc9a21>	CC-MAIN-2023-23	https://www.brookings.edu/wp-content/uploads/2023/05/AzoulayFinal-2.pdf	2023-05-30T18:58:38+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-23/subset=warc/part-00284-ffa3bf93-6ba1-4a27-adea-b0baae3b4389.c000.gz.parquet	759,065,077	3,677	eng_Latn	eng_Latn	0.77272	eng_Latn	0.986774	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "dag_Latn" ]	false	rolmOCR	[ 2927, 6823, 9911, 11867, 14860, 15874 ]
Immortal Love Will Always Be Dead(werewolves pov) By: IceBreaker Adrianne is a seventeen year old girl who has to face complications in her life of being a werewolf. Published on Booksie booksie.com/IceBreaker Copyright © IceBreaker, 2015 Publish your writing on Booksie.com. Table of Contents Immortal Love Will Always Be Dead Your thoughts say differently Your Mine...Only Mine This is it She's just too much The Plan Can't be trusted It's Todd's world What Todd wants A hot mess Nothing but the rage Unbreakable Can't fight any longer Breakable Epilogue Chapter 1: Immortal Love Will Always Be Dead Sorry for any spelling errors i½ His fangs slid out of his gums and he growled at me. I gasped as he charged at me. Before I had the chance to scream, his body fell on top of mine. "Get off me!" I yelled. I was just as strong as him. I felt myself about to change. I growled back at him. His hands grabbed my neck and he squeezed. I felt the familiar burning feeling filling my body. My eyes turned a dark crimson. My inner wolf was coming out. I finally managed to push the vampire off of me. He flew across the field and got up the second he fell down. I got on all fours and screamed out. It felt like my body was ripping apart. The vampire smiled and came over to me again but not before my wolf ran to him. My mouth opened and my teeth sunk into his skin. He didn't scream, he pushed me off. "Come here, doggy." He teased and then ran off deeper into the woods. I ran after him. My claws dug into the earth and I snarled as his scent seeped into my nostrils. I felt nothing but anger. I growled at him and caught up with his fast speed that was until I was knocked out by something. I fell onto my stomach and instantly got up looking around. Another wolf—one I immediately knew the second I saw him was growling at me. I growled back at him and continued chasing after the vampire. I stopped when he ran out of the woods and ducked into the edge of the lake. I growled angry that I couldn't catch him. The same vampire has been coming around my pack for months and he's too fast for everyone. Even me and I'm the fastest wolf in my pack. The wolf came beside me and his emerald eyes stared into mine. I growled at him. Why was he following me? It's his fault the goddamn vampire got away. I ran away and hid behind a tree where I phased back. My black hair hung down covering my breast. I stood up and walked until I found the bush where I placed my clothes before I phased. I slipped on my black shorts and black tank top. I almost never wore shoes. I was comfortable walking barefoot. I looked up at the moon. It was a half. I sighed and turned as Eric's wolf stopped in front of me. His body shook and he let out a low dark growl and then transformed into his human form. He got up. His eyes turned back to hazel. "Why the hell did you tackle me?" I asked trying to keep my eyes on his face. I've always wanted to fuck him and he always wanted to fuck me but it never happened and it never will. "You can't go chasing after that vampire. He could've killed you, Adrianne." He said. "I am not your concern." I growled. He sighed and looked down at his feet. I closed my eyes. "Can you put some clothes on? It'll be easier to look at you if I didn't have to make sure my eyes don't wander down to your cock." I opened my eyes and Eric smirked. He slowly turned and grabbed some fabric from behind a tree. He slid a pair of black jeans on and looked back at me. "As I was saying, you don't know what vampires are capable of. You have to be careful." There was true concern in his voice but it hardly affected me. "Why do you care so much? You hate me." I reminded him. He shook his head and sighed. "You're not the most likeable person in the world." I shrugged. "Am I supposed to change my personality because one person doesn't like my attitude?" I asked. "I love your attitude. But the way you act towards your family is a different story." "Don't even mention them to me." I said as I turned and walked away. Eric followed me. The moon lit up the woods but it was still kind of dark. Because of my wolf, I could see in the dark. i½"Why do you hate my family?" He asked. I laughed quietly to myself. "I don't hate your family. I hardly hate you. It's your goddamn sister that gets on my nerves. She feels that just because she's alpha that she can tell me what to do." Eric was quiet for a second. I heard his feet crunching down on the leaves so I knew he was still there. I looked over to him and his eyes met mine. "Well.....she can tell you want to do because she is alpha." I rolled my eyes. Just the mention of her made me angry. Lana was the alpha of our pack. I and Eric's family were two separate packs at first but when we all met each other, we became one pack. There were nine people in my pack and now….it was over thirty. "She's such a bitch." I commented. I suddenly felt my arm being grabbed tightly. I turned and looked at Eric in shock. "That's enough! Stop talking about my sister like that." I snatched my arm away and glared at him. He glared back at me. It wasn't even anger we felt towards each other. It was Lust. But we rather not act on that. I began to walk away but I felt myself being pushed against a tree and Eric's lips closed over mind. I gasped in shock. I was a virgin and this was new to me. But my fingers moved throughout his hair, gripping it tightly and then they slid over his chest. My body was pressed hard against the tree. His tongue explored my mouth. Every inch of it. Shivers ran down my body as his hands moved over my breast and then down to my waist and over my ass. A growling sound rose from his throat. He was getting turned on. I could feel it through his pants. I opened my eyes and pushed him away. "Don't ever do that again." I said clenching my teeth. Eric smiled. "Or what?" He asked. I pushed him again and started making my way back towards the pack. "Or what?" He asked again following me. I ignored him until he stepped in front of me. "Or I'll cut off your dick and make you eat it." I threatened. Eric smiled. "I'd like to see that." He challenged. I sighed. Suddenly, Eric picked me up and slammed me onto the ground. My head hit the ground hard. "Ow!" I yelled. Eric climbed on top of me and held my hands down and looked at me. "I'm stronger than you. You can never hurt me." He said. His eyes were excited. "Fuck you and your sister." I couldn't hurt him physically but I can hurt him emotionally. "Say it again and I'll kiss you." He smiled. I didn't want that anymore. He leaned down. His hazel eyes turning back emerald. Our lips were inches apart. "I didn't say it again." I said looking up at him. He didn't answer. His lips kissed mine. Small pecks at first and then he deepened the kiss. This was basically like lip rape. I didn't want this. I bit his lip and he quickly sat up. A small amount of blood was trailing down his lip. He licked it away with his tongue and then smiled at me. "You got quite a bite. I like that." He whispered. His voice turned me on and made me sick at the same time. "Get off of me before I call my brother to come here and kick your ass." I said. My brother, Kevin, was taller than Eric and much stronger. Much older and faster. Eric was scared of him. I saw the immediate fear in his eyes. He got off of me and I got up and looked at him. "I'm still going to tell him about what you tried to do." "Oh please, Adrianne. You wanted it." He said. I walked ahead of him and held my hand up and stuck up my middle finger as I continued walking away from him. Chapter 2: Your thoughts say differently Sorry for any spelling errors Chapter 2: Your thoughts say differently Eric's footsteps were still following me. I sighed in frustration. "Admit it, Adrianne. If my pack decided to leave one day, you'd be heartbroken." I scoffed. Yeah, right. I would love for his pack to leave. They already take up too much goddamn space. "Actually I would be happy. My family hardly likes yours." "But you like me." He said. So fucking cocky. That's the main thing I hated about him. "Who said I did?" I asked looking at him. He shrugged. "I can tell you do. You didn't pull away when I kissed you. You liked it." He grinned. I wanted to hit him. I fucking hated him. "You don't know anything about me." I assured him. He grabbed my waist and made me turn to him. I pulled away from him. "I know everything. Your favorite color. Your favorite song. When you're angry, your eyes become darker. And you hate your family. That's basically what you're about." He shrugged. I pulled away from him. "All of that is irrelevant. I'm sick of having to deal with this. I'm leaving and I don't want you to follow me." I left him behind as I came back to my pack. My heart was beating fast. My pack came into view and I frowned as I saw my mother. Her eyes looked into mine and I glanced away. I and my mother haven't been getting along. Ever since I finally phased four years ago. It took me thirteen years to phase which is quite late for most werewolves. Four years ago my dad got attacked by a vampire. He got killed and I had to watch. I got so angry that night that I phased right there in the house. That night was scary and confusing. But it was in the past. My brother, Kevin walked up to me. "Did you catch him?" He asked. I looked at him confused. "Who?" "The vampire." He answered. I shook my head. "He's still wandering around like a little bitch." I said. Kevin chuckled. "Don't worry about him. He won't get near the pack." He patted my shoulder and then growled. His head suddenly turned to the woods. I turned my attention to where he was looking. Eric was walking out of the woods towards us. "Oh, calm down." I said to Kevin. His growls deepened. I rolled my eyes and walked away from him. I didn't want to get in the middle of their fighting. A hand suddenly grabbed me. I turned to see Eric. "Would you stop walking and talk to me?" He asked. "No. Stop talking and walk away from me." Eric led me away from my pack and back into the woods. I sighed. "I know that all you want to do is get me alone so that you can take advantage of me." I said. He led me to the lake. "Take your clothes off and get into the lake." Was he serious? "No." He let go of my arm and unbuttoned his pants and pulled them down. I looked away from his naked figure. His gorgeous naked figure. "Come swim with me." He said. I shook my head and looked up at the moon. I felt his hands force my shorts down. I looked down at him shocked. My shorts were down at my ankles and I reluctantly stepped out of them. He stood up straight and then grabbed my shirt. "I can do it myself." I snapped at him. He smirked. I sighed and then lifted my shirt up over my head and threw it down on the ground. Eric stared at my figure and smiled. His hands brushed my hair out of my face. I pushed his arm away. "Keep your hands to yourself." I said turning and walking towards the lake. "That's a large request, Dri." I turned to him. Anger was burning in my muscles. This fucker gave me a nickname? "I'm not yours. You call me by my name." I said. He held his hands up as if he was surrendering. I walked in and put my feet in the water. It was a warm temperature. Eric grabbed my hand and intertwined our fingers together. I looked at him and he didn't have that normal cocky smile on his face. There was something else in his hazel eyes. Love. Resist him, Adrianne. Resist him. I turned to him and grabbed his hair. His lips touched mine instantly. He tasted like...cinnamon and strawberries too. It was intoxicating. His hands slid up my body. His hands unsnapped my black bra. I gasped when the straps slid down my shoulders. I stepped away from him and folded my arms over my chest to hide my breast. Eric grabbed both of my arms and pulled them apart. I was a little embarrassed. Nobody except for me has ever seen my breast. Eric smiled and leaned his head down. His tongue touched my nipple. I gasped. Chills ran down my back. I closed my eyes and sighed. But my breaths were shaky. It felt so good. But this was wrong. I could feel regret approaching. I will not let Eric take my innocence. His head snapped up. "Why not? You want me to." He said. My jaw dropped. A wolf couldn't hear another were unless they were in love with each other. I gasped. But...I don't love him. I mean I think I don't. "You know what this means." He whispered. I shook my head. "No. No. I don't love you." I said as I turned at walked into the lake. I swam at the deep part. He was right behind me. "Why don't you just admit it? You do have feelings for me. And don't say you don't because I can read your thoughts and you know that can only happen if two wolves are sharing love." I swam away and after a few minutes, I looked back and Eric was nowhere to be found. I suddenly felt hand grab my ankles and pull me down. The water was dark blue and I came face to face with Eric. He pulled me over to him and pulled me tight against his body. I pushed him away from him and got back up to the surface. I let out a heavy breath and wiped water from my eyes. I felt my panties being pulled down. I kicked him but I missed every time. He suddenly came to the surface and smiled at me. "Where are my underwear?" I asked. He shrugged. This is why I don't love him. He's so annoying. "No I'm not. You love me." I glared at him. "Stop reading my thoughts!" I growled. He just laughed and swam around me in circles. "Make me." He challenged. I swam over to him and stared into his eyes. "No. You make me sick. Just looking at you." I said he smiled because deep down inside, he knew it was bullshit. And for some reason, even I knew it. 'You can hear my thoughts, can't you, Dri? That means you love me.' My head hurted. I could feel him in my mind. "Ow! Get out of my head!" I yelled. He smiled and grabbed my waist and pressed his erection against me. A surprising heat was burning inside of me. Then I realized we were both naked still. "Oh! Get away from me." I said pulling back. I swam back to the woods and got out of the water. Eric grabbed my arm and turned me and kissed me. I tried pushing him away at first but he was stronger and he managed to get me down to the ground. My eyes were closed as his lips were on mine. I wrapped my arms around his neck. I felt his cock against my stomach and I instantly got scared. I pushed his shoulders. "No. Get off me." I moaned as he kissed my neck. He held my hands drown to the ground and continued using his mouth to explore my body. I closed my eyes as his lips landed back on mine. "Don't tell me to stop." He said against my lips. I fucking hated him but...I wanted him. So bad. Eric pulled back and chuckled. His hands brushed over my womanhood. I shivered from his touch. "No. Eric. You have to stop." I said trying to push him off of me. "Why?" He asked. "Because I don't want to be the mother of three cubs at my age." I said. Eric smiled. "We don't have to be in our human form to have sex, Dri." He reminded me. Right. Of course he was right. Two werewolf lovers have to be in human form in order to conceive a cub. If they're in the wolf form, they wouldn't be able to make a child. Never understood the rules. "I don't want to be in wolf form during my first time, Eric." I said looking up at him. He smiled. "I love your innocence, Dri. That's what attracted me to you. The fact that you haven't experienced anything sexual and I will be the first to be able to rock your world." I rolled my eyes. The cockiness was back. "There are plenty of other wolves here that I'd rather them take my virginity." I said. Eric snickered. "Like who?" He asked. Still pinning my hands down. "Like your brother." I snapped at him. His smile disappeared. He knew his brother, Kier, had a thing for me and it pissed him off. Eric got up off of me and sighed as he walked into the woods. I got up suddenly missing the warmth of his body on mine. I followed him. Great, now I'm the follower. "You know I didn't mean it!" I said. He started running and I knew what it meant. I ran after him. Eric's body shook and black and golden fur sprouted from his body as he got on all fours. He didn't stop running as he was fully in wolf form. I sighed as he ran away. I'll never be able to catch up with him in human speed. I thought of something. Anything that pissed me off. My dad's murderer. My eyes grew dark and crimson again. I got down on all fours as the familiar burn rippled through my body. I let out a scream as the fur ripped out of my skin. I closed my eyes and opened them back as I was in my wolf form. In this form, everything in the woods was brighter and sharper. I dug my claws into the earth and took off running after Eric. Chapter 3: Your Mine....Only Mine Chapter 3: You're Mine....Only Mine I ran after Eric. His running wasn't faster than mine. There was no way, I pounced on him and he growled in anger. I growled back at him. I crawled off of him and stared into his emerald eyes. He bared his teeth at me and before I knew it, he was on top of me. I was laid down flat on the ground. I felt his hot body on mine. He positioned himself above me and I felt his huge member at my entrance. He was about to take me from behind? In wolf form? Was he crazy? I phased back into my human form and rolled over on my back. Eric was still in his wolf form and was still on top of me. His head leaned down so it was inches from my face. I was so scared. I gulped. His teeth were sharp and his eyes were piercing green. "I'm sorry for what I said." I said in a shaky tone. "I didn't mean it. I only want you." I admitted. Did I just say that? Oh god. Eric phased back. His human form naked and on top of my body. He didn't speak. He just crushed his lips against mine. His hand traveled all over my body. Over my breast down to my womanhood. Down to my thighs. "I have to take you. Please let me take you right now." Eric breathed against my lips. I wanted him too. I wanted it so bad but what would Lana say? She was the Alpha and if she didn't want me near her brother, I was supposed to stay away. But oh well. "Okay." I answered. Eric looked at me with a shocked expression on his face. "Really?" He asked. I nodded yes to him. His lips nipped at my bottom lip and sucked it and bit it. All of this made me wetter and wetter. A pleasurable heat was rising out of my body. I wanted him to take me. I wanted it so bad. He kissed my neck and I felt his tongue lick it sending a shot of heat down 'there'. I let out a low moan as he sucked my breast and sucked at my nipple. My fingers gripped his hair. He left kisses from my nipple, up to my chest and to my neck. He smelled like fresh grass and strawberries. He pulled back to look at me. "This is going to hurt a little. You may even start bleeding." I nodded. I was okay with that, I just needed him inside of me. I never yearned for someone so much. His eyes stared into mine and I suddenly felt something enter a little. I stiffened. "Relax." He whispered softly to me. I let out a shaky breath and looked up into his hazel eyes. He pushed in a little more and I felt him force through something. I gasped. I felt a stinging pain. I wanted him to stop but at the same timeâ ¡I really didn't. I whimpered as tears rolled out of my eyes. "I'm sorry baby." He whispered. He brought his lips to mine. He didn't move. I guess he was waiting until I could adjust to his size. The pain wasn't fading at first. "Go ahead." I said against his lips. He sucked in a breath and pulled out slowly. He softly pushed back in. I dug my nails into his back and cried. "Want me to stop?" He asked. I shook my head. I wanted this and if he'd stop now, I would probably die. His strokes were painful at first but then the pain started to fade slowly. His eyes never left mine. That's when I realized that maybe I did really love him. How couldn't I? His lips went back to mine and he thrusted in and out slowly. I gasped and moaned unable to hold it in. Fuck. It felt so good. I gripped his hair with my fingers. I could hear his moans in my ear as he slowly but deeply pushes in and out of me. My nails dug into his back drawing blood. 'I love you. I love you. I love you.' I told him in my mind. Because I was too embarrassed to say it out loud. 'I love you, too. You're mine, Dri. You're mine now.' He growled in his mind. My heart pounded fast. I felt something. Almost like a tickling feeling inside of me. The feeling became more intense and soâ ¡â ¡unbelievable. My moans were cries now. 'Cum with me, Dri.' He moaned. I threw my head back and gripped his ass. "Oh! Oh!" I cried. Oh my god. My whole body shook with pleasure and I never felt anything soâ ¡â ¡amazing. I let out another scream of ecstasy. Eric was panting and he grunted as he squirted inside of me. He held my arms down onto the ground and he was breathing hard into my neck. I looked up at the dark sky. I tried to calm my breaths down but it was taking a while. 'You're mine.' He growled into his mind. I closed my eyes. I was and am his and I actually didn't mind it. Eric slowly got off of me and rolled onto his back beside me. He looked just as dazed as I was. "You're bleeding." He said. I nodded and turned my head to look at him. "Soâ ´...you were my first." I said. I knew it was a weird conversation to have afterwards but I didn't know what else to say. "Yes." He breathed. 'Your first and your last and your only.' He said in his mind. I looked at him. He turned on his side and pulled my waist against his body. "I love you," He whispered in my ear. 'You're never going to get me to say it out loud, Eric.' He sighed and pressed his lips against mine. He smelled so good. 'I want you to ride me' 'Who said we were ever going to have sex again?' 'I did.' He suddenly rolled me on top of him. I looked down at him in shock. He smiled and rubbed his cock against my entrance. A low growl escaped out of my mouth. 'I'm sore.' 'You're a Were. You'll heal soon.' I leaned down and kissed him. This kiss wasn't filled with Lust. It was 100% Love. I suddenly heard footsteps and smelled the scent of another wolf. But I ignored it. Could have been a random wolf passing through. Damn Weres. But then I recognized the scent of coconuts and vanilla. It was Lana. Eric's sister and Alpha of the pack. Before I had the chance to get off of Eric, she saw us. I gasped and got off of him. Eric glared at Lana. "What do you want?" He asked. Lana's dark long hair stopped at her lower back. Her eyes were dark brown and her skin was a little darker than ivory. She was beautiful but I hated her so much. "We're all going out to hunt. And we need you two." She said. I wonder what she was telling him in her mind. Family members can automatically hear each other's thoughts. I'm sure she was saying something bad about me. "What exactly are we hunting?" I asked. Lana didn't even look at me. She kept her eyes on Eric. "That damn vampire that keeps coming on our land. We figure that if more wolves were helping us chase it, then we might catch it this time. We wouldn't want any more wolves killed by vamps like your daddy was." Lana looked at me when she said 'daddy.' My eyes watered. That was like a kick in the stomach that would cause internal bleeding. She turned around and disappeared back into the woods. Eric looked at me and sighed. He grabbed my body hugged me tightly. "Don't worry about Lana. She'sâ ´â ´â ´I don't know. She's just Lana." I nodded and pulled back from him. He wiped the tears that rolled down my cheeks. "Come on," I grabbed his hand. "We have to go catch that goddamn vampire before he kills one of us." We grabbed our clothes and pulled them on. Eric, once again, intertwined our fingers together as we walked through the woods to get back to our pack. We all had our land. Us wolves had a certain part of land. Vampires have a certain part of land and the Werepanthers and Shape shifters had a part of land. It was illegal to cross it. Well as far as the supernatural rules go. But the only problem my pack has ever had was with the vampires. The beautiful, yet dangerous, cold, heartless vampires who invaded our land and was only able to because they was too fast for us to catch. Me and Eric walked in silence throughout the woods. "Soâ ´â ´I was just thinking about something." He said. If I wasn't lost in my own thoughts, I could have heard what he was thinking. "What?" I asked. He scratched the back of his head with his other hand and I stopped walking and looked at him. "If you say something stupid that's going to piss me off, I suggest you don't say it." I warned him. He shook his head. "No. It's justâ ´â ´â ´um. I came in you." He said. I nodded. I was smiling inside because of the amazing memory. "And?" I asked. "And you could easily be pregnant right now." Those words echoed in my head. Why the hell wasn't I thinking about that? Oh my god. I'm so stupid! My mother did always tell me that unprotected sex had its consequences. "I didn't even think about that." I whispered looking down at the ground. He lifted my chin with his finger and stared into my eyes. "But would having my baby be so bad?" He breathed. No. It wouldn't. "I don't know." I said out loud. He chuckled. "You just said it wouldn't be bad in your mind." I sighed. "You know, just because we have feelings for each other don't mean I want you to read my mind 24/7." Eric shrugged and grabbed my hand again. "Why don't you read my thoughts? They're not that bad." He assured me. "I don't want to. When I hear them, it's not on purpose." He looked at me and smiled. 'I want to throw you down on the floor and fuck you so hard until I make you scream.' I rolled my eyes. Of course that's what I wanted to happen, but we had something more important to do. As we got back to our area where our family stayed, we saw most of them in wolf form. Kevin walked near me and Eric. He was in his wolf form. Silver and white mixed in with black fur. I smiled at him and patted his head. He swung his head to look behind him and then ran off as he heard a howl come from Lana as she turned into a black wolf. "She's ready." Eric said pulling his pants down. I pulled my shirt over my head once again and from my peripheral vision, I caught Eric staring. I shook my head. Horny teenage boy. Eric chuckled and pulled his boxers off next. I tried not to look. But it was hard. I pulled my shorts off next and then my underwear. Eric closed his eyes and growled as he got on all fours. A violent growl escaped from his mouth as I heard the ripping sound coming from his body. His beautiful gold and black fur sprouted out and covered his body and his eyes turned emerald again. I unsnapped my bra looked at Eric's wolf. His eyes were on my body. 'Stop looking at me.' 'It's hard to.' He replied in his head. I shook my head and closed my eyes and relaxed. Anger. Think of something that pisses me off. Ummmm. That goddamn vampire that keeps coming on our land. I growled as I felt the burning feeling again. My back burned violently. My eyes watered as I fell onto the ground on all fours and panted as I felt my fur come out of my body. When the pain stopped and I was my gray and black wolf, I nuzzled Eric's neck. He growled. I smiled on the inside. 'Come on. I read Lana's thoughts; she wants us to go north.' Eric said as he shot away from me through the woods. I followed him. Thank god he was her brother. She wasn't a part of my family and I damn sure didn't love her so If I couldn't read her thoughts, I wouldn't know where to go. The woods were much brighter as me and Eric ran through it. I smelled the Vampire's scent. We were close to it. There was more than one vampire. I smelled five. I gasped on the inside. Oh god. We couldn't take five vampires. For once, I needed to know Eric's thoughts. 'Oh shit. I smell six vampires. What the hell? Did Lana send us this way on purpose? I have to protect Adrianne. No matter what. Fuck this. Vampires aren't shit. I can take them.' Oh no. Eric was about to get himself killed...for me. Chapter 4: This is it I was right beside Eric. We ran together north as the vampire scent got stronger and stronger. I'm scared, Eric. Maybe we should turn back.' I said telepathically. 'No! We can't go back now. They can smell our scent. Even if we do turn, they'll chase after us. We have to keep going.' My anger increased as I ran faster. I was suddenly tackled to the ground and not by Eric this time. I hit the ground with a hard thud. I saw Eric get tackled by something that was fast. I rolled back onto my feet and growled at the vampire I saw. The same one that I've seen earlier. He smiled. His eyes became dark. "Come here, girl." He whistled. I growled again and charged at him. He suddenly disappeared and was on top of me. I whined. I heard him laugh. "Not so tough. Are you dog?" He asked. I heard Eric's growls and whines. 'I'm going to distract them. I want you to run as fast as possible.' 'No! Eric....No! I'm not going to let you do that.' 'Adrianne, don't argue with me. Run in 5....4......3.....2.. 'No! 'I.....Go!' Eric growled. I took off running even with the vampire still on top of me. I growled as he pinned me back down to the ground. I rolled over to my back, making him fall off of me and then I got back on my feet and ran back towards the Main Area. Oh my god. Why did I leave Eric? Why? I'm so stupid. I love him and I left him like he was nothing. I turned back to my human form. 'Eric? Eric can you hear me?' I didn't get an answer. Oh no. Something must have happened. 'Eric.....Answer me...please.' I begged in my mind. I never beg for anyone. But......for Eric, it's different. He still didn't answer. I had to go back. I just had to. 'Answer me, please!' There was nothing. Just as I was about to go back towards the vampire's territory, Eric was coming toward me in his human form. Blood was pouring down his chest. I gasped and phased back. I ran over to him and grabbed his face with both of my hands and kissed him hard with passion. He wrapped his right hand against my back pushing me against his body. Once I broke the kiss, I looked down at his chest. "What happened?" I asked. "I phased back mistakedly and they just started biting me. But they didn't realize that wolf blood is poisoness to vampires." I smiled. "Vamps......they are so stupid." Eric snickered. "Yeah. The bites will heal soon. We're going to have to go back out there." I shook my head. "No. No. There's no point. It's almost six in the morning. The vampires will have to go to their 'hideout' soon. We might as well stay here." I said. He hesitated but nodded anyway. "Get your clothes on." I said. He walked away from me for a second. I then realized that I was still naked. I grabbed my clothes and placed them on. He came back to me with his clothes on and a small smile on his face. "What?" I asked. "I can't believe that when you realized that I wasn't dead, you couldn't even tell me you love me." I rolled my eyes. He can't be serious. "I've told you." "Yeah, in your mind.....while we were having sex." He answered. There goes the irritating Eric again. "You better be happy I said it at all." He sighed and pulled me against his body. "I am happy you told me, Dri." He kissed the top of my head. I wrapped my arms around him, closed my eyes and breathed in his scent. He smelled like honey, roses and apples. I didn't realize we were being watched until I opened my eyes. I gasped and stepped away from Eric. He looked at me confused and then turned his head and saw Lana. "You too are suppose to be out, hunting." She said. I wish she'd put some clothes on. 'me too.' Eric said telepathically. I chuckled and looked at him. "What's so funny?" Lana asked. I just shook my head. "We were out, until both of us almost died." Eric said glaring at her. She raised her eyebrow and looked at me. "You let my brother almost die?" She asked. She thought I did it on purpose? That fucking bitch. "I didn't do it on purpose and he told me to run. I wanted to stay but he told me to leave." Lana scoffed. "And you listened?" I nodded. "We'll you're the omega, of course you would have to listen to the brother of the alpha." I'm sick of this. I stepped to her so we were face to face. "Lana, I don't give a fuck that you're alpha. I don't. So stop trying to rub it in my face because it doesn't fucking affect me." I said. She smiled. "You want to be alpha more than anybody, Adrianne." "Lana, just go. Now." Eric said. She looked at him and then turned her head back to me. "Stay away from my brother." She grabbed Eric's hand and led him away into the woods. I sighed. God I hate her. I wonder where everyone else was. I suddenly heard a growling coming from behind a tree. I slowly turned. I breathed in the air and smelled the scent of.....death. There's a fucking vampire around, before I had the chance to shift, the same vampire we've been chasing was walking towards me. He had a smile on his face. "I thought the 'lone wolf' was just a saying," he said. My heart pounded fast and hard. "My family is out right now chasing you and your little friends." "And you're here alone." His fangs slowly slid out of his gums. "What do you want from me? You can't have my blood. You'll die from it." I said. "I don't want your blood for me." He said. "What do you want it for then?" I asked. "That's my business. I just need a little wolf blood, and I won't come back to your side of the land." Was he serious or was this a trick? Trusting a vampire was stupid. Right? I have to do this.....for my family. Even though I disliked them....I had to do it for them. "Promise?" I asked. He nodded once. "How are you going to get it? I asked. He stepped closer to me and pulled a small clear vial with a small red top out of his pocket. He held it in his left hand while he pulled out a small knife with his right hand. "Hold out your arm." He said. I hesitated for a second but then held out my arm and look into the vampire's eyes. His pale, cold hand wrapped around my arm while the vial was still in his hand. The knife lowered and then touched my arm diagonally. He pressed down and I could feel my skin rip as he drove the knife across. I bit my lip to keep in the cries of pain. As the dark red liquid emerged from the cut. The vampire placed the knife back in his pocket and grabbed the vial, and placed it against my skin. Drops of blood filled the vial quickly. Soon, the vial was filled completely and he let go of my arm. He placed the top back on the vial and placed it in his pocket. "Thank you, dog." He said to me. "Your welcome, bitch." He chuckled and turned around. I felt a whoosh and he was suddenly gone. I looked down to my wound. I decided to lick it myself. When you're a wolf, your mate is suppose to lick your wounds. It's like an act of compassion. The taste of my blood was salty but it had a small sweetness to it that I enjoyed. The sun was about to come up and that made me excited knowing that we won't hear or see the vampires for at least twenty hours. The vampires can only come out at midnight. No time before. My mother was walking out of the woods. Dirt and leaves were in her hair. She looked at me and she looked apologetic. "Can we talk?" She asked. "No." I answered walking away from her. She grabbed my arm and made me turn around to look at her. "Listen to me, Adrianne." I sighed and listened. "I know you're mad at me. And I'm sorry. I thought by now, your grudge would be over. But I guess not." She shrugged. "I just don't understand where we went wrong. You know? I hate that my daughter hasn't even attempted to talk to me in over half of a year." It was longer than that. "We don't have to talk. It's not necessary. You made your decision." I snatched my arm from her and walked off. I hated my mother and it was because she got remarried only a few months after my dad died. Fucked up. Right? When I smelt Eric's scent and Lana's, I got closer. I heard them talking away from the main pack area. I hid behind a tree to listen. "You're unbelievable, Eric. Mom doesn't like her. I don't like her." "But I love her. She's my mate rather you like that or not." "I'm the alpha. I can make you stay away from her." Eric grew quiet. Why did Lana want to mess up me and Eric's relationship? Why is she such a bitch? Lana suddenly turned and I could have sworn she saw me. I hid more behind the tree. "Not only can I sense you, Adrianne. I can smell you." I sighed and got from behind the tree. My eyes were locked on Eric's. "I'll give you two some time. Eric, do what you have to do." She said before turning away and running off. I sighed and turned to him. "What does she mean by that?" I asked. His eyebrows were pulled together in an angry expression as he looked down to the ground. "Eric?" I asked. He let out a deep sigh and his eyes finally looked into mine. "She doesn't want us together, Adrianne. And she can make us break up. She's alpha." "You're going to listen to your sister just because she's alpha?" He didn't answer. "You can't be serious." "But I am." He replied. "Why are you listening to her? Don't let her push you around. You're stronger and faster than her. You could kill her easily if you wanted. Don't let her control you." "You think I want this? She's the fucking alpha, Adrianne! She can do whatever she wants. Even if none of us likes it." "Don't let her break us apart." I placed my arms around his neck. He just looked down to the ground and grabbed my arms putting them back to my sides. He really wanted nothing do with me? Now I am the one begging for him to love me back. "It's already done." He said. I felt tears come to my eyes. I just don't understand how after such a short time after we decided we were mates, how could I be so deeply in love with him that it makes my heart hurts? As tears escaped my eyes, he looked away. "Okay. Okay. You want to hear me say it?! I love you! Okay! There. I said it! Now please don't do this." I said placing my hand on his cheek. His eyes turned dark for half a second. He stared into my eyes and then after a while, he placed his lips against my forehead. I closed my eyes. "Go find another mate." He whispered. My eyes snapped open and looked at him. He slowly turned and walked away from me. I felt myself about to break down. My heart was broken. Eric was my first love and yeah, it felt stupid to love someone so deeply, so fast but I couldn't help the way I feel. Werewolves fall in love fast. But suddenly, my tears didn't come down because of sadness and heartbreak. It was because of anger. I dropped to my knees and growled. I felt my body burn and sting and the familiar ripping sound of my skin filled my ears. My growls got lower covering my screams of pain as my fur sprouted from within me. Lana was dead fucking meat. Chapter 5: She's just too much I growled loudly as I spotted Lana in the main pack area. She turned and looked at me. "You wouldn't dare." She said glaring at me. I snarled at her. I jumped and flew to her at an instant. Before I could reach her even an inch, she shifted and knocked me down to the ground. I growled and pushed her off of me using my body. She growled as she glared at me. "Stop it!" My mother yelled as she ran in between us. 'Move out of the way before I end up killing you.' I told my mother telepathically. She looked at me and shook her head. "Both of you stop it. Right now." Without warning, Lana charged towards me, pushing my mother back a few feet and bumping into me slamming down into the ground. I growled out of anger and pushed myself up to look back at her. I wasn't in any pain. Any scars or bruises I see when I'm back in my human form will heal almost immediately. She paced back and forth measuring my next move. I didn't have to read her thoughts to know that. "What the hell is going on?" Asked Eric as he came near us. 'Go away. This is between me and your stupid ass sister.' He looked at me. 'No. You have to stop this. Stop it right now, Adrianne.' I calmed down a little. I was happy because if he could hear my thoughts, this meant he still cared for me. He looked back at his sister and glared at her. "Stop it, Lana. Both of you calm down." I sat down on the floor and felt my form vibrating as I shifted back to my human form. Eric looked at my body and then down to the ground. "You can't keep me and your brother away from each other." I said grabbing Eric's arm and looking at Lana. I was happy when he didn't push me away. Lana growled and turned back into her human form. "I'm the alpha. And what I say...goes." "We're not hurting you by being together. Or are you just jealous because everyone in the pack has someone but you and you just don't want to be the 'odd one out'?" "My brother cannot be with a weak wolf. Do you understand how that makes our family looks? Me having the position that I have, I cannot have a weak family or I will be reposted as lower than alpha and I'll be damned if I'm going to lose my position over you." "I'm not weak." I said clenching my teeth. She rolled her eyes. "Yeah right. Could have fooled me. You're the weakest of us all. And it won't be much time before you realize that. You and your pathetic family are the weakest of anyone." I was about to walk over and grab her by her hair and pull until her whole outside of her head comes off. 'Calm down. Please, for me.' 'What's the point? You obviously don't care anymore.' 'Of course I do. Would I be able to hear your thoughts if I didn't?' He had a point. I tried to calm down but my body was still shaking with anger. "We're going to be together if we want. And not even the fact the you're the leader of us all will stop us." "Actually, you may want to rethink that, Adrianne." "What are you talking about?" A small smile appeared on her face. "We've—me and mom have been thinking about leaving. Our packs separating. And you two wouldn't want to be too far from each other now would you?" "What are you saying?" Eric asked. "I'm saying that as long as you two stay away from each other and find other mates, we'll stay here but if otherwise, we're gone, Eric. And I do have the power to do that." Where the hell does she get all of her wickedness from? I mean her mom is nice. Her dad is nice. Eric is……amazing. And she……she is just a bitch. Eric sucked in a breath and looked down to the ground. "Mother wants us soon, so finish whatever business you have with her and come on. I'll meet you at the cottage." She turned and ran off deep into the woods. It was lighter outside as the semi-circle of the sun appeared from behind the clouds. Eric looked down at me. "We don't have to listen to her." He sighed. "Yes……we do. We don't have a choice. Would you rather be broken apart or broken apart 3,000 miles away from each other?" "Neither." I answered. "Let's just obey her for now and find out what to do, later. I'll see you later." He said walking away from me. As he reached the woods, he got on all fours and changed into his wolf form. I stood there looking after him. I was heartbroken and upset. Upset that I had to obey a girl who only takes joy in making people's life a living hell. I have to get away from here. I have to. I went into my cottage that was in the middle of the woods. I opened the door and slammed it shut. Kevin was snoring on the couch. I rolled my eyes and went to the bathroom. I took a quick shower and placed on a long-sleeved shirt, dark blue jeans, and black boots. I walked out of my cottage and sighed as I breathed in the air. I suddenly smelled the scent of oranges and grapefruit and grass and something else I couldn't identify. I turned to see a guy leaning against a tree watching me. I stared back at him. "Um…who are you?" I asked. He smiled, "Todd." He answered. "Well, Todd, you standing here watching me is kind of freaking me out so can you just go back from where you came from?" He ran his fingers through his hazel-colored hair and smiled as the sun glistened off of his dark eyes. "I've been watching you for a while and you didn't notice." I suddenly felt a little nervous. "Why were you watching me?" I asked. He grinned. "Well, let's just say I've been admiring you. You stand up to the vampire that comes to your land. You fuck your boyfriend or should I now say ex—in the woods with no fear of being caught and you stand up to the alpha of your pack. What's not to admire?" I never thought of all those things as admiring. I thought of them more as irritating. "You seem to get irritated fast." Did he just read my thoughts? How can that be possible? Does he love me? Are we related? "Not exactly to the first one and to the second—well….we definitely don't have the same bloodline." "So what do you want exactly?" I asked. "I want to join your pack." My eyebrows pulled together as I looked at him. "Are you sure because there's a lot of drama all the time." "I love drama. My middle name is drama." I laughed but he frowned. "No. I'm not kidding. That's really my middle name." I stopped laughing and became serious. "Oh." Was all I could say. "Todd Drama what?" I asked. "King." He answered. I nodded and put on a smile. "Well, fine. I guess you're in. But you'll have to talk to the alpha." "Yes. The bitch- as you call her- that you dislike. Can't wait." He said indifferently. I led him deep into the woods to the cottage that Eric, Lana and their parents lived. I knocked on the door and Eric opened the door. He glared at Todd. "Who is he?" He asked. "Todd King." He answered. Eric looked at me. "It's amazing how short of a time it took you to find someone else." I stared at him in disbelief. "I'm not with him. How could you think I'd find anyone else?" Lana then came at the door and as soon as she looked at Todd, she was in love. I could see it in her eyes. An automatic smile appeared on her face. "Um...Hi.....wh-who are you?" She asked. He flashed a sexy smile. "Todd. Todd King." she began to walk down the small stairs and almost tripped as she came face to face with Todd's perfection of a face. "So.....you're a werewolf too?" He nodded and tried to hide the smile that was on his face. I wonder why. "Yeah. I want to join the pack. I stumbled upon the scent of wolves and followed it and ended up here. I watched you guys for a few days just to make sure you were all safe. And here I am." he said. "Yep....here you are." Her black hair blew in the wind. "So am I in?" She nodded and smiled. He smiled also. "Great. Where do I sleep?" He asked. "You can sleep at my place. I have an extra bedroom. Lana and Eric's house is all crowded." Todd smiled. Almost deviously. "I will be more than happy to stay at your place with you." "I don't like that idea very much." Eric muttered. I sighed in frustration. 'Nothing is going to happen. Trust me.' 'Make sure he keeps his hands off of you. You may not be mine anymore but I will still make sure you're safe.' 'I know and thank you for that, Eric. Your name will always be permanently tattooed on my heart. You know that.' 'Same here.' I smiled as I led Todd away from Lana and Eric and towards my house. Chapter 6: The Plan I led Todd to my cottage in the middle of my woods and opened the door. "Kevin was still snoring on my couch. I rolled my eyes. "This is Kevin, my annoying brother. If he irritates you at any point, just break his nose." Todd flashed me a smile. "That sounds like fun." He commented. "Doing it is more fun than talking about it." I led him through the small hallway and into an empty bedroom. The floors had a dark brown wood. With a small beige rug in the middle. There was a queen sized bed with brown sheets and a comforter. Across from the bed was a fireplace and two small windows beside it. "Wow....this is...." "I know," I answered. "Believe it or not, my room is nicer than this." Todd smiled as his eyes roamed around the room and looked at me. "So....Lana is single?" He asked. I nodded. As far as I'm concerned. I don't know anyone who would want a wicked bitch from the west. "I think I like her. And you too." "You barely know either one of us." He shrugged. "I've watched the both of you. I know just about everything I need to know about you two." I looked down at the floor. 'I know you still have feeling for.....Eric.' Todd said telepathically. I looked at him and smiled slightly. "Of course I do. But Lana won't let us be together. She thinks I'm weak and it'll cause her to lose her position of Alpha." "I can distract her." He said. I raised my eyebrow. "What?" "You saw how she was when she looked at me. If I spend a lot of time with her, then she won't bother you and your boyfriend." This Todd King was smart and devious. I swallowed and looked to the floor. "Would you be okay with this? Like anytime I want to spend with Eric, you'll be with Lana?" He nodded once. I smiled slightly. This could work. "Okay. Let's do it." He stepped closer to me. "I want something in return though." "What?" I asked. He took another step closer until we were face-to-face. "A kiss." He said. My smile vanished and I stepped back. "No." I answered. He stepped closer to me. "One kiss or you'll have to deal with Lana for the rest of your life." He was right. I would have to deal with her. He had a cocky smirk on his face. I closed my eyes and breathed deeply. Kissing another guy makes me feel.......like a slut. Todd chuckled. "We're not going to be fucking. It's just a kiss. Harmless and innocent, Dri." I winced at the sound of the nickname that Eric gave me. "I can't." I whispered. Todd walked over until I was pressed against the wall. "I'll be the solution to your main problem. All it takes.......is one," He leaned in close. "Touch of the lips." He whispered as his lips slowly closed over mine. I felt weird. His skin was warm. And that was odd. Normally, all wolves would have hot skin. But Todd didn't for some reason. He pressed me against the wall and his hands were on my ass. That's when I decided that enough was enough. I pushed him away with as much force as I had. He smiled at me as he licked his lips. "You taste good, Dri. I can understand why Eric loves you so much." I stared down at the floor. I just kissed another guy. Another guy that was not Eric. I felt so ashamed of myself. I spoke softly as I said, "Can you distract her tonight? I want to be alone with Eric tonight." I said. Todd nodded. "Sure. Would like to go out for a run?" I looked him in his eyes and nodded. He followed me outside and began to unbutton his pants. I felt a little embarrassed. I was about to change right in front of this guy I hardly knew. I pulled my shirt over my head and turned as I unsnapped my bra. I pulled my pants off and then my underwear. I got down on all fours and closed my eyes as the burning transformation took over my whole body. I screamed in pain. I felt my fur sprout from out of my skin. My hands turned into claws. My eyes burned as they became a crimson color. I growled and turned to see Todd in his wolf form. I never seen the color of a soft white furred wolf. His eyes were black. He growled at me. 'Follow me, Adrianne.' He told me in his mind as he took off running with extreme force. I ran after him as fast as I could and couldn’t keep up. It was weird. I was told that next to Lana, I was the fastest wolf in the pack but Todd took off with blinding speed. I kept up as much as I could. The wind whipped through my fur. Adrenaline pumped through my veins. I felt so much energy as I ran faster and faster. This is the one good thing about being this......creature. The speed. The strength. The running just calms you down way more than a hot bath would. Todd finally stopped running and turned to look into my eyes. His eyes were now white. How did that change colors? I mean, my wolf form and my human form had two different colors. And so did Eric’s. But Todd……..he had one eye color in human form and two eye colors in wolf form. What’s up with that? He slowly walked over to me. His white eyes turned back to black. He nuzzled my neck and I stepped away. Don’t even think about it. He growled at me and then turned looking at something farther out in the woods as if he was expecting something to happen. I walked and stopped beside him looking in his same direction. A black and golden wolf was running towards us rather gracefully. I smiled on the inside knowing exactly who it was. The wolf stopped in front of us. 'So you like spending time with him huh?' My internal smile disappeared. He thought I liked Todd. I really don’t. 'You can’t be serious, Eric. I only want you. You know that.' Eric’s wolf head swung to look at Todd who was standing on his haunches looking up into the sky. 'I want us to meet tonight in the woods. Near the lake. The exact same place where.....' 'We first made love?' He finished my sentence. 'Yes. That place.' 'Lana isn’t going to be happy about that.' 'That's where Todd comes in. He'll distract your sister while me and you are together. You saw how she looked when she first saw him. She looked like she was in love.' 'You sure about this?' 'Beyond positive.' I answered. Eric stepped closer to me and pressed our noses together. 'I love you.' Hearing those words made my heart beat quicken. 'I love you more. Meet me at nine tonight.' 'Gotcha, babe.' Eric turned around and ran back through the woods and I saw his black and golden fur disappear. I hoped to god that this whole thing works. ********** I was sleeping heavily when I felt something touch my cheek. I opened my eyes and saw that it was night time. I couldn't see who was touching me because it was so dark in the room. "It's Todd." He said. I sat up and rubbed my eyes. "Oh. Hey." "Are you ready?" He asked. At first I was about to ask, 'ready for what?' But then I remembered. A small smile appeared on my face. "Yeah, let me just take a quick shower. I'll be out within seconds." Todd sat down on my bed as I got up and grabbed my towel and took a quick shower. I threw on a black bra and panties. Along with a white tank top and white shorts. I combed through my hair and then went back into my bedroom. Todd smiled when he saw me. "Eric sure is a lucky motherfucker." I blushed and placed my towel on top of my dresser. "Ready?" I asked. He nodded. "You know what to do right?" He stood up. "Of course." We both went outside. He went to Lana and Eirc's cottage while I went out into the woods and by the lake. I could smell his scent already and it got me immediately wet. "I missed you." Said a deep voice that was suddenly behind me. I smiled as I turned to him. He only had on a pair of jeans. "I missed you more." I said. He smiled and pressed his lips against mine. I felt dizzy. Almost high from the touch of his lips. He pulled back and unbuttoned his pants. Then he stopped and looked around in the darkness of the night. "We're kind of out in the open don't you think?" "That didn't stop us before, did it?" He smiled and pressed me against the bark of a tree as his lips began to kiss my neck. I closed my eyes and moaned. I missed his touch. His taste. And I needed him inside of me right now. His lips went to mine and I gripped his hair in my fingers as I enjoyed the taste of his tongue in my mouth. He pulled back only slightly and slipped his fingers beneath my tanktop and rose it up. He pulled it up over my head and placed it on the ground. My white tanktop on the dirty ground. Thanks a lot baby. Eric chuckled at my thoughts. "I hope you know that you're washing that." He shook his head. "Make me." He challenged, I smiled back and turned so that he was now against the tree. "Oh, I'll make you. I'll make you do whatever I want you to." I said licking his bottom lip. He smiled. "That sounds like fun." I placed my hands on his chest and began leaving sucker bites on his neck. I pulled back only enough to look into his eyes. "If your sister asked what this mark is on your neck, tell her it's a rash from a tree." Eric rolled his eyes. "As if she'll even notice. With that Todd guy around, she'll only be focused on him." "Stop talking and kiss me." I whined. He smiled and placed his lips down to mine. Our kissing got out of control and we both fell down on the ground still kissing. He was on top of me biting and sucking on my lips. He was in between my legs and I could feel his erection against my stomach. Eric broke the kiss and sat up on his knees and licked his lips. It was so sexy. I looked up into his eyes as he unbuttoned my shorts and pulled them down. He chuckled somewhere into the darkness. His hands traveled over my body. His hands rosed up my legs, to my thighs and then my inner thighs and over my panties. But the panties was so thin, the small touch brought a great pleasure to my clit. I moaned and he smiled as if he was happy with my erection. He sat me up, reached around and unsnapped my bra. I laid back down onto the dirt and leaves as his fingers slipped under the fabric of my underwear. I felt them slide down my legs. He stood up, unbuttoned his pants and pulled them down. He didn't have on any boxers and I smiled up at him. He laid back down on top of me, between my legs. I ran my fingers through his hair and looked into his eyes. "I love you." He grinned. "I love you." His eyes stared deeply into mine and I felt him push inside of me. I automatically wrapped my legs against his waist to feel him more inside of me. I moaned as he pinned my wrists to the ground and kissed my lips as he rhythmically pushed in and out of me. I gripped his hair in my fingers and closed my eyes. I heard a growl deep in his throat. Once again, I felt high from all the love he was giving me. Like there was no end. I didn't want there to be an end. I was suddenly on top of him, pending him down. I didn't know what to do considering the fact that I never rode anybody before. Eric smiled at my thoughts and guided my hips back and forth and threw his head back and moaned. I loved hearing him moan. It just sounded so sexy and it made me get closer to my orgasm. "Eric!" I moaned as I also threw my head back. I was losing control. I never been this way before. It was slightly embarrassing. He sat up and still guided my hips as he kissed me. I never felt so.....safe So good. So right with a person. Eric was the one person, the only person who made me feel shy, or happy, or angry before. Yes the anger was bed but I was always numb since my dad died and Eric actually made me feel again, even if he was annoying when we first met. Eric nipped my bottom lip while his hands removed from my hips to my ass. He grunted as I rode him faster and harder. Me and Eric cried out as he came seconds before I did. I stared into his eyes and breathed deeply. He was breathing fast and hard. I leaned my forehead against his and closed my eyes. "I love you." He breathed. "I love you more." I responded. He kissed me deeply and we both laid down. I fell asleep on top of him......in the woods. Chapter 6: The Plan Chapter 7: Can't be trusted I felt large hands rubbing my back slowly back and forth. My eyes opened and I noticed that I was still laying on top of Eric. I turned my head slowly to the other side. "Are you woke, baby?" "Yeah." I whispered. He grabbed some pieces of my hair and played with them in between his fingers. "I had the weirdest dream." He said. I turned my head again and rested my arm on his chest and rested my chin on my arm. "About?" He took a deep breath. "I don't know....it was more like a nightmare." My eyebrows pulled together. Eric looked like he was in pain. "What happened?" He turned his head so he wasn't looking me in my eyes. He licked his lips and then closed his eyes. "You......you were laying down on your bed. I believe you were sleeping. It's like I was there but I wasn't. Anyway, your door opened and then it shut. Everything was dark at first until somebody placed their hand over your mouth. You screamed and screamed and whoever it was that snuck into your room.....they......." "They what?" I asked. I had a feeling that I knew what he was about to say. He sat up with me still on him. His lips attacked mine right away and I was suddenly down in the ground with him on top of me. "I love you and you belong to me. Do I make myself clear?" I nodded and forced his lips back down to mine. "Want a quickie before we have to go back?" He asked against my lips. "Yes." I responded. Without any hesitation, he was inside of me. It was quick, dirty and so damn good. I didn't want to moan too loud. Werewolves have good ears. I could hear Eric's moans in my ear. And they turned me on. I was seconds from coming. Just a few more thrusts and I will be there. "Fuck. Eric." I moaned. I felt his cum filling my body and he moaned while kissing my lips. I moaned in ecstasy as I came also. Eric continued kissing me aggressively but blissfully. He held me tight in his arms. "Well that was definitely entertaining." Said a voice. Eric immediately got off of me. and I looked up to see Todd leaning against a tree with his hands in his pocket and a smirk on his face as he looked down at me and Eric. "Well it wasn't a show for your benefit." Eric said holding me close again. "Still entertaining." He said looking up at the sky. Me and Eric got up. But Eric made sure I stood behind him. I had a feeling that he didn't want Todd to see me because I was naked. "What are you doing out here anyway?" Eric asked. "I was coming out for a run and to hunt." I grabbed my clothes and slipped them back on and threw Eric his clothes. "Hunting what?" I asked. I never saw Todd eat. So it made me curious about what he eats. "Just....hunting." He said as if it wasn't a big deal. Eric pulled his clothes on and grabbed my hand. "Well sorry that we couldn't do an encore for you but we have better things to do." Eric said as he led me away. I look back at Todd who was still smiling at me. I turned back and Eric placed an arm around my waist. When we got back to my cottage, Kevin was sitting on my couch talking on the phone. I rolled my eyes. Doesn't he have anything better to do? Me and Eric walked pass him and went into the bathroom and took a shower. We had another quickie in there and got out. We laid under the covers naked and just began talking. "So what are we going to do?" He suddenly asked. I looked over to him. "About what?" His eyes slowly met mine. "This Todd King guy. What are we going to do?" I sat up on my elbow. "Why would we do anything? He's a good person and he makes Lana happy." Eric shook his head. "I don't trust him and have you smelled his scent? Werewolves don't smell like that." "Yeah I noticed the wolf scent was slightly off but maybe he's just a different wolf. One that we never knew existed." I shrugged. "Yeah....maybe." He responded with a low sigh. I reached over and turned his face to mine and kissed his lips. It was a short but meaningful kiss. When I pulled back, he smiled. "We fucked twice today." "And?" I asked straddling him. "And, twice is not enough." He said. I smiled as I leaned down and kissed him. Lana's Pov I smiled as Todd once again was at my door. I couldn't help but blush every time I saw him. "May I come in?" He asked. I nodded and moved out of the way as he came in. His scent was different somehow. Werewolves have three scents tops but he had more than three. He smelled good but unusual. I didn't understand it. "Where's your parents?" "My dad died a while ago and my mom is out somewhere." I said. Todd had a big smile on his face as he sat on the couch. I sat down on the chair across from him and crossed my legs. "Can I confess something to you?" He asked. I nodded. "You are one of the most beautiful people I've ever known." He said. I blushed. I wasn't used to a guy making my heart jump excitedly. "Really?" I asked. He smiled and nodded. "Well same to you." He ran his fingers through his hair and stared me in the eyes. "Lana, how long has it been since you last got fucked?" He asked. My blushing got deeper. I mean, any asshole ask me that and I'd bite his head off but with Todd saying that to me, it turned me on. "A while." I admitted. It has been a while. When you have alpha duties and to keep everyone in control at all times, you don't exactly have time for romance. "How about, we go to your bedroom?" He asked. My smile slowly disappeared. "No, Todd. We just met. I'm sorry but....no." I said. Todd didn't look disappointed. He just kept the smile on his face. He got up and grabbed my hand. He looked deeply into my eyes and something happened. I felt dizzy. Almost drunk. I couldn't tear my gaze from him almost as if he was keeping my eyes locked on his. I suddenly wanted him. I needed him bad. He kissed me forcefully and grabbed bunches of my hair as his tongue danced with mine. He picked me up and forced me onto the couch where he got on top of me and pinned my wrist to the couch. "Do you love me?" He asked. I couldn't answer. It was a sudden question that I was at a loss for words. He looked deeply into my eyes which gave me that drunk feeling again. "Do. You. Love. Me?" My heart beat quickened and I smiled and nodded. I did. I do. I loved Todd and I refuse to hold it in any longer. "Do you love me?" I asked. He didn't answer. He just continued kissing me which was much aggression. So much aggression, it was painful and rough. I was suddenly being thrown onto my bed and I felt my shirt disappearing. Next were my pants. I looked up to see his light eyes were now dark with lust and danger. He rips my bra off and then my panties. I felt both scared and excited about how rough Todd was being. He suddenly turned me on my stomach. How the hell was he moving so fast? He placed his weight on me and I could feel him pulling his pants down and then his boxers. He was breathing hard in my ear and he let out a low moan as he entered inside of my pussy. His cock was huge. Too huge. I gripped the covers in my hands as I let out both moans of pleasure and whimpers of pain. "Am I hurting you?" He breathed in my ear. "No." I lied. He pushed in deeper as if he wanted to hurt me. He placed his fingers in my hair and pulled hard. I gasped as my head jerked back. He began to kiss my neck and his teeth began nibbling my skin. His teeth were sharp. "You smell delicious." He whispered as he kept fucking me. He placed his hands on my wrists and fucked me harder. He was almost hurting me but for some reason......it felt good. I was nearing my orgasm. "Cum, Lana." He whispered as his lips were against my neck. Seconds before I felt one of the best orgasms I've ever had, I felt a sharp pain in my neck. I gasped and cried out in pain. Todd was.......biting my neck. I tried to push him off of me but he was stronger and continued to hold me down as my consciousness slipped away. Adrianne's POV The sun was going down soon. Eric went back home and I just went outside for a run. I was carrying a pair of pants and a t-shirt in my mouth. I can once again feel the adrenaline and it relaxed me. But that relaxation disappeared as I smelt the scent of a vampire. I slowed down my running and growled. I knew that scent quite well. That same goddamn vampire that's always coming around. I growled as I saw him sitting on his knees feeding from a girl that was laying against his chest. His eyes were closed and blood was around his mouth. The girl wasn't screaming in pain but moaning in pleasure. I must be in the vampire part of the land. It's hard to not run fast and far when it relaxes you. The girl looked at me wide eyes and reached back to grab the vampire's dark hair. "What?" He growled as he looked down at her. The girl pointed to me. The vampire looked up and smiled as he saw me. He pushed her off of him. I wanted to run back but...I knew the vampire would chase me and I didn't want him near The Pack. So I changed back into human form and put my clothes back on. The vampire looked down at the girl he was feeding from. "Angel, go wait for me at Aries's house. I'll be there when...I'm done here." He didn't leave my eyes for a second. The girl, Angel, got up and went deep into the woods until I couldn't see her anymore. "Isn't this a lovely surprise?" He asked. I rolled my eyes. "I didn't come here for a purpose. I must have ran too far." I said. His eyes roamed over my body. "Still good to see you here. It's fun when you chase me." "Yeah, well to me, it's....annoying." I stopped because I suddenly smelled something. Something that smelled familiar on the vampire. I slowly walked towards him and stopped. "You.....you smell like someone I know." I said. "Uh....thank you?" "No. I mean, there's this werewolf that just joined our pack and he smells slightly like how you smell." "A werewolf that smells like a vampire? Are you sure it's a werewolf?" I nodded. "Yeah, he turned into a white wolf right in front of me and he's fast. Beyond fast. And his eyes were changing colors and..........." The vampire's eyes grew big. "He's a hybrid." Chapter 8: It's Todd's world "What?" I asked. "A hybrid. A werewolf/vampire hybrid." The vampire said. "A what?" I was beyond confused and scared to death. "You need to stay away from this guy." I ran my fingers through my hair. I didn't know rather or not I should tell Eric and the rest of the wolf pack. Todd was a vampire and a werewolf. How the hell was that even possible? "You need to get as far away from him as possible. Do you understand?" "Yeah. Yeah I do but what if he doesn't let me leave?" "Then I don't know what to tell you because it's hardly my problem." "But still. I mean if he's a hybrid, wouldn't he have control over both vampires and wolves?" He thought for a second. "You're rather smart for a dog." He said as he began to pace. "What is this guy's name?" He asked. "Todd King." I answered. His eyes grew wide. It looked like he was about to cry for a second. "Todd?" He asked. I nodded. He had a look on his face as if he was about to pass out but that wasn't possible for vampires. "Do you know him?" I asked. He looked like he was in pain. "Todd.......King is my......dad." He whispered. "What?" I asked. "That fucker is my dad." He growled. I never saw someone so angry. "Wait, then why aren't you part.....werewolf?" He shrugged. "I don't know. I just never gotten the trait and neither has my sister or brother." "So what do we do?" I asked. He thought for a second. "Well...maybe if he serves his purpose here then he'll leave. I doubt if your pack and my coven can kill him. I heard that werepire hybrids are more powerful than at least forty wolves and fifty vamps put together." "Werepire?" I asked. "Ignore the name and be serious. This is a serious matter." "I know but I just don't know what to do." The vampire sighed and leaned against a tree. "Well should I pretend like I don't know anything until we know what to do?" I asked. The vampire slowly nodded. "You can get the hell out of there. But either way is the smartest. Just don't piss him off." I nodded. "I won't." He looked down to the ground. "What exactly does he want?" He asked to himself. Yeah. What did Todd want from my wolf pack? Or was it me that he wanted something from? Or Lana? "Okay, so you should meet me back here tomorrow night around midnight. We'll form a plan but make sure until then that you don't know shit about what he is." I nodded. "Okay." I said. He nodded once. "By the way, My name is Aeryn." He said. "Adrianne." I said. He smiled slightly but in a way it was fake. He didn't like working side by side with a werewolf and I felt the same but Todd is a danger to both wolves and vampires. "I'll be here around midnight." I said. Aeryn nodded once. I turned and instantly phased back not giving a shit if I tore my clothing. I can't think about it. Todd can read my thoughts. I have to think about anything but that. As I ran through the trees with fast speed, I got back to the main pack area where everyone was acting tense. My eyebrows pulled together. What was going on? My mother came over to me along with Eric. Eric looked angry. Almost like he was ready to shift but trying his hardest to keep the process down. "What's going on?" I asked. My mother bit her lip. I looked to Eric he looked heated. "Tell me." I whispered. "Immortal Love Will Always Be Dead(werewolves pov)" "Todd is alpha of the pack now." He said. My eyes grew wide with fear. "What?!" I asked. Eric nodded. Why would Lana give up her title for Tod? 'He probably charmed her and convinced her to let him have her title.' Eric said telepathically. I shook my head. That explanation isn't good enough. I walked pass Eric and my mother and tried to sniff out Lana's scent. When I smelled the familiar scent of coconuts and vanilla, I followed it. I spotted Lana sitting on a chair watching the wolf pack. She didn't look angry, she looked.......high. "Lana?" I asked. She slowly looked up at me. "How could you give a position like that up? And for a guy you barely know?" "I love Todd." She said standing up face to face with me. "How? You don't even know him! He could easily be evil!" I yelled. "Can I?" Said a deep voice. I looked over to see him coming out from behind a tree. "It's rude to make assumptions about someone before you know everything them, Dri." He smiled. I swallowed. My throat felt dry and I felt nervous. "I wasn't making assumptions. I was just saying......" "Saying what exactly?" He asked. I bit my lip afraid to say another word. "Well, if you have nothing to say, I suggest you keep your mouth shut." He said as he forced Lana out of her seat and they disappeared into her small house. "What was that about?" Eric asked as he came near me. I looked at him in disbelief. "You know you heard the conversation even from all the way over there." He sighed and placed an arm around my waist. "I have to talk to you later, not here." I said. He nodded and kissed my forehead before walking away. I looked after him for a second before turning my head back to Lana's cottage. What the hell was happening? **** It was two in the morning and I still haven't told Eric about Todd. It was impossible. Because if he finds out everything, he's going to charge in his family's house, try to fight Todd and Todd just might end up killing him. I couldn't risk that. Eric turned the shower off and I heard him step onto the tile floor. I was sitting against the headboard of my bed and looked at him as he came into the room with a towel wrapped around his waist. He dried himself off and threw the towel onto a chair and climbed into bed with me. He began to kiss me and when he noticed I wasn't kissing back, he pulled back and looked at me. "What's wrong?" He asked. I closed my eyes and shook my head. "Nothing." I responded. He slightly smiled and began kissing me again. I kissed him back this time to show him there was really nothing wrong. He pulled me on top of him. He placed his hands on my thighs and through my hair. I just stopped. I couldn't do this. I got off of him and he looked at me, confused. "Did I do something to piss you off?" He asked. I shook my head. "No. I'm just tired." I said. "You want me to hold you until you fall asleep? I have to get back home soon anyway." I smiled at him. "Yeah, hold me until I fall asleep." I said. He laid down and pulled me into his arms. My head was under his chin and my leg was over his. I closed my eyes. I loved the feeling of his body against mine. "I love you." He whispered. I smiled. "I love you too." And I was off to sleep. **** When I woke up, the sun was rising and I was in my bed alone. It made kind of upset that I didn't wake up in Eric's arms but I got over it and got up. I got on a pair of shorts and a tanktop and went into the kitchen where Kevin was sitting eating a bag of chips. "Can you not eat all my food? You've got a house too." "Yeah but mom is there with you-know-who and I am not going home if they're doing what I think they're doing. Fuck that." I rolled my eyes and got out the ingredients to make a sandwich. "Did you go out for a run this morning?" I asked putting a slice of ham on the bread. "Yeah, with that Todd guy. He's faster than any other wolf I've ever seen." I turned to him. What was Todd up to? Was he trying to get close to my brother only to manipulate him? Or am I being paranoid? "Kevin, you have to promise me that you'll stay away from him." I said. His eyebrows pulled together. "Why?" "Because I said so." "Last time I checked, I was older." "Only by two years. It's not that big of a difference. But seriously, promise me Kevin." He sighed and nodded while looking down at the floor. I turned back, made my sandwich and sat down at the table across from Kevin. After I was done eating, I took a shower, threw on a pair of clothes and went outside. I heard yelling coming from Lana and Eric’s house so I ran as fast as I can. When I got there, Eric and Todd were yelling at eachother. What the hell is going on? I ran and placed myself between them too. "What's the problem?" I asked. Eric looked mad. His eyes were that emerald color they always turned when he was in wolf form. And Todd's eyes were white. "Tell your boyfriend to get the fuck out of my face." Todd growled. I looked to Eric who glared at Todd. "He put his hands on my sister. I'm going to kill him." Eric retorted. "I'd like to see you try you fucking prick." "Stop it!" I yelled. They were both quiet and glaring at eachother. Lana slowly walked towards us and I can see a mark on her neck. I squinted my eyes. Don't think. Don't think. He can hear my thoughts. I couldn't make assumptions about the marks. Not yet any way. Without warning, Eric managed to reach over and punch Todd in his jaw. Todd touched his jaw and it was red but changed back to his original skin color. "Okay. Okay. You'll see, Eric. I'm going to hurt you in a way you never imagined." Todd said. "Lana, come with me." He demanded as he walked away from us and grabbed Lana's arm. She winced in pain as he pulled her away. I looked back at Eric who's fist were balled up at his sides. "He's doing something bad to her. Lana doesn't take shit from anyone and now all of a sudden, this asshole took her postion and is taking control over her." "Calm down." "No. He has to go. I'm sick of him. I want him gone. Now." "He will be.....soon. Just give it some time." Eric's eyes turned back to normal. He let out a low sigh and he unballed his fist. He took a deep breath. "What do you mean give it some time?" He asked. I was hoping he wouldn't ask that. I reached up and gave him a kiss to distract him and luckily, it did. Eric's POV** I loved the taste of Adrianne's lips. It was sweet and intoxicating. To me, she smelled like bananas, hazelnut, and freesias. Whenever I kissed her, it blocked everything else out. All my problems. Everything bad that's happened. It clouded my thoughts. The bad ones and the good ones. I guess that's how it is when you're with your mate. She curved her fingers into my hair and I pulled her tight against my body. I needed to feel all of her. She pulled away from me and looked down at the ground. "What's wrong?" I asked. She shook her head. Something was wrong. I could feel it. I had to get into her head. Don't think about it. Don't think about it. Don't think about. "What are you hiding from me, Adrianne?" "Nothing." She said. "Okay." I said nodding casually. She narrowed her eyes as she looked at me. She knew what I was up to. I bent down and picked her up and flung her over my shoulder. "What are you doing?!" She screamed. I just smiled as I started to run towards her cottage. She was hitting my back as I got the door open. Kevin wasn't here which surprised me. I closed the door and took her to the bedroom. I closed the door and threw her onto the bed. She looked up at me angry. I pinned her hands to the bed and stared down at her. "What are you hiding from me?" I asked again. She shook her head. "Nothing." She whispered. I leaned down and began to nibble on her neck. She moaned and giggled at the same time. I stopped and pulled back to look at her. "Tell me." I breathed. She shook her head. I leaned back down and licked her bottom lip. She tasted sweet like candy. We kissed each other aggressively and my grip on her wrists had tighten. "Eric....fuck me." She said against my lips. "Tell me what's been on your mind and I'll fuck you day and night if you want." She frowned and turned her head to the right looking out of the window. "I can't." She whispered. "Why can't you?" She looked back at me. "It's not important. Can we just continue the whole foreplay thing?" "If something is bothering you--" "Nothing! Nothing is bothering me for the last damn time! Now can you just shut up and fuck me?" It's amazing how quick she can piss me off. I got off of her. "Why don't you just go fuck yourself?" I asked. I opened the door and slammed it shut. Adrianne's POV I sighed and got up. I made Eric mad and him being mad made me mad. I wanted to tell him so bad about everything. But Aeryn said not to tell anyone. We had to keep it a secret until we find out what we can do about it. If only we knew the reason Todd was here in the first place. When it was ten o clock, I was laying in my bed, naked. I missed Eric and I wanted him here with me. To hold me. To make love to me. To do anything but be mad at me. I soon fell asleep. I was in the state where I was half sleep but half woke. I had my eyes closed and was halfway through a dream but I was also aware of the things around me. I slowly heard my door open. My eyes opened. I was facing away from the door. I smiled. I knew Eric would come back. When I turned, it was Todd standing there by my bed completely naked smiling down at me. I gasped and sat up. I was naked in my bed and Todd was naked right here next to me. "Todd. What are you doing here?" I asked. My voice trembled. "I want something from you, Adrianne. And I'm going to get it." He said. My eyes grew wide from fear. "Wh-what do you want?" I asked. His smile disappeared. "I want a child." Chapter 9: What Todd wants I tried to take in what Todd just told me. He said the words 'I want a child.' Goose bumps were suddenly on my arm. I was on the verge of tears. "You know what I am, Adrianne. I heard you and my son talking, trying to think about what to do. The answer is....you can't do anything except let everything I do.....happen." "But Todd..." "But Todd...nothing." He ripped the covers from on top of my body and he was suddenly on top of me. "Don't try to reach your boyfriend with your thoughts. He won't be able to hear them." He whispered as he kissed my cheek. He pulled back to stare into my eyes. He opened his mouth and I saw sharp pointy elongated fangs. My eyes widened in fear. He grabbed my hands and pressed them down against the bed as he leaned to kiss me. I turned my head so that he couldn't but he forced his lips on mine anyway. "Don't make this hard, Dri." He breathed. "Fuck you." I said. He smiled and I noticed that my sentence had a double meaning. He wasn't going to stop. Not until he gets what he wants and what he wants is for me to give him a baby. So many things mixed in my mind at once. "Get off of me." I tried pushing him away. He smiled at my weak attempts. "We can play this game all night, sweetheart. But I'm still going to get what I want." He growled. "Please don't do this Todd. Please. Please. I'll do whatever you want just don't do this to me. Please." I begged. With one quick motion, I was on my stomach. I gasped as I felt Todd breathing in my ear. "This is going to make us both, very, very happy." He whispered and I felt him painfully slide in. I let out a cry of pain and he moaned in my ear. "Shh." He whispered kissing my ear and then my neck. "Todd.......please." Warm tears escaped out of my eyes. "Shh. Just give me what I want, Dri. That's all you have to do." He said. "No!" I yelled. His nails dug in my skull. I gasped in pain. "Stay quiet!" He growled. As he started sliding in and out of me, I can hear his moans echoing throughout the room. I closed my eyes. I wanted him to stop. It was hurting so bad. I had to somehow contact someone. Someone to help me. 'Mom? Mom? Kevin? Eric?' I asked in my mind. There was no answer. I suddenly felt something sharp go into my neck. I screamed out and clutched the sheets in my hand. Todd's fangs were inside my neck and he growled in satisfaction. His thrusts were faster and harsher. "Stop." I cried. His fangs disappeared out of my neck and went to the other side. I screamed again unable to say a word. He was taking so much from me. How could he do this? Todd pushed in harder forcing a cry of pain from my lips. He grunted as he thrusted in harder than ever. Eric was never this rough with me. He didn't make me cry out in pain every few seconds. "Owww!" I cried. I felt some kind of wet liquid inside of me but I knew he didn't cum yet. It was coming from me. Was I wet? Or was it......blood? "Oh! Adrianne." He moaned as I felt his cum spill inside of me. I buried my head into the bed as I realized what just happened. I continued to cry as he slid out of me. I was ashamed of myself. It wasn't my fault but I still felt guilty for all of this. Todd placed his hand on my back and rubbed it softly. And it made me cry even louder. "I'm sorry I had to do that to you but I knew you would say no if I asked." "Get out." I muffled through the covers. His hand disappeared and I heard his footsteps walk away. The door opened and then slammed shut. I didn't want this. I wanted Todd dead. I wanted his fucking heart to be shoved down his throat. He's evil and pathetic and a prick. I sat up slightly and pulled the covers over me and then laid down staring up at the ceiling with dried up tears on my cheeks. Lana's POV My house has basically become Todd's house within days. He was alpha now and so whatever he says, goes. I forgot how he became alpha again. One second, I was alpha and the next, he is. It just didn't make sense to me. The door opened and Todd walked in the house with a satisfied smile on his face. Why was he so happy? He kissed my lips softly and then sat down in a chair. His shirt was messy with dirt and so was his black pants. "Where have you been?" I asked. He shrugged. "Out." He flicked the tv on and looked at it with disinterest. I knew he was lying. I smelled a scent. A very familiar scent of hazelnut and bananas. It was Adrianne's scent. Why would her scent be on him? "Where were you?" I asked again. He didn't answer. He kept his eyes focused on a commercial that was playing. "Why is Adrianne's scent on you?" I asked. His eyes flashed with anger as he looked at me. "Are you accusing me of something?" He asked. "No. I just want to know why I can smell her scent on you." Todd got up and came over to me. He placed his hands on both sides of my face and stared deeply into my eyes. I felt a wave of dizziness and lightheadedness. "Don't ask me another question tonight." He breathed. I felt the sudden urge to be quiet. Everything became blurry and flashes of images filled my head. Everything stopped when his gaze left mine. I just sat down on the couch and kept myself quiet. Talking seemed wrong for some reason. Adrianne's POV The dream stuck in my head even as I woke up and looked at my clock. Todd on top of me. Me screaming. It tortured me. There were footsteps walking towards my door. I closed my eyes. If it was Todd again, then it was too bad for me. I was too weak to fight it. The door opened and in stepped the vampire, Aeryn. "Where have you.....?" He looked down at me and then around my room. He sniffed the air and his eyes grew wide. "He was in here. I can smell it." Aeryn snarled. I looked at him and didn't talk. "Did he......Did he do something to you?" He asked slowly. I didn't speak. I couldn't. I couldn't find my voice. He sat on my bed. As far from my body as he could be. "What did he do to you?" Aeryn asked. I stared up into the ceiling. Everything was hopeless and useless. I couldn't tell anyone. Because no one could help. Todd was too strong and everyone was too weak. He could kill us all if he wanted to. And I wouldn't be surprised if he did. "Adrianne, what has he done to you?" I kept silent. As far as I was concerned, the vampire wasn't right here on the bed asking me a question that had an obvious answer to it. The vampire sighed and got up. He stared down at me. "When you're ready to talk, you know where to find me." There was a blur of color and then he was gone. I was pretty frightened at the sight of Todd. Seeing him in my mind. I pulled the covers off of my body and slowly got up. I clicked on the bathroom light and looked down to see blood slowly trailing down my inner thigh. I closed the door and turned the shower on. I wanted to wash every inch of my skin that Todd has touched. I scrubbed my body and washed my hair repeatedly and my face. I cleaned everywhere repeatedly but I still felt dirty. I dried my hair off and wrapped myself in a towel. I got back in my room and threw on some panties. A shirt and some bed pants. I climbed into bed and went to sleep for the night. ******** When I woke up the next day....I felt it. I could feel it in my veins. In my skin. In my blood. I was pregnant. My mother explained how I could feel it the next day if I was pregnant. She told me how I'd feel. And I could feel it. And since Todd was the dad, I'm pretty sure he could physically feel it also. I sat up in bed and looked down. I slowly lifted my shirt and touched my stomach and closed my eyes. I could feel the connection I had with the baby already. I let out a soft sigh and opened my eyes to see Eric standing in my doorway. He let out a small smile. But I didn't smile back. I couldn't. I was pregnant with Todd's baby and my boyfriend was not aware of it. "I'm sorry about yesterday. I was being a dick as usual." He slowly walked in and sat on the bed a little too close to me. I scooted back a little. He looked disappointed at my sudden movement but smiled slightly. "I want you to forgive me. I was just unhappy. That's all but if today....you still want me to fuck you....I'll be more than happy to." He leaned over trying to kiss me and I scooted away again. He sighed. "What did I do now?" I ran my fingers through my hair and just shook my head. I looked down at the sheets. Eric sighed and reached over to touch me. I flinched away. "What is wrong with you? What did I do, Dri?" My head snapped up and I glared at him. "Don't call me that." I growled. He looked hurt by my sudden snap at him. "Adrianne, talk to me.....what happened? Did I do something to piss you off besides what happened yesterday?" My eyes glittered with tears. I couldn't tell him. It would hurt him too badly. I couldn't bear to see hurt in his eyes. "Can you leave?" I asked. Eric looked shocked. His eyebrows raised and his jaw dropped. He reached over to touch me but I snatched my arm away. "Don't touch me." I whispered glaring into his eyes. His eyebrows pulled together. "I'm sorry." He sounded like he was begging. "Just leave, Eric. Please. Let's take a break. Okay?" He looked confused, upset and angry all in one facial expression. "You want to break up?" He asked. "I said take a break." "What's the difference?" He asked before he slowly turned and slammed the door shut as he walked out. I sighed and laid back in my bed and turned to the side. My throat felt dry and my stomach rumbled. But I didn't want to eat. I couldn't. My heart beat was fast and hard as it slammed against my chest. 'Come here. Now.' Said a voice in my head. I knew the voice the second he said the first word. He was the alpha so I had no choice but to obey. I pulled the covers off of me and climbed out of my bedroom window. I landed in the dirt and began to walk towards the main pack area. It's dangerous to shift when you're pregnant because of all the changes that goes on throughout your body during the process. Once I arrived at the pack area, everyone but me were in their wolf form. The wolves eyes looked to me like I was a stranger. Todd wasn't in his wolf form, he knew the reason I couldn't be in mine. He smiled at me and I quickly looked away to look at the golden and black colored wolf looking at me. 'I called this meeting for a reason' Todd said telepathically. Perhaps so me and the wolves could know what he was saying and so he could hear the thoughts of those around him. 'There's a vampire lurking in the woods. As I've been told that he comes here occasionally to try to start some shit with people in this pack. But after tonight, that's going to change.' What was Todd talking about? 'We're all going to take him out.' He demanded. My eyes grew wide. Why would he try to kill his own son? What was he up too? 'You prick'. I growled in my mind. Todd looked at me with a smirk on his lips. 'Looks like soon, you won't have a partner in crime.' He made it so only I could hear his thoughts. 'Partner in crime? What are you talking about?' 'Using my own son against me is a bad idea because you're about to get him killed.' 'You're killing him because you don't want him to kill you first.' 'He can't kill me. No one can. When are you going to get that into you beautiful, intelligent, brunette head?' 'Go fuck yourself' 'No....fucking you last night was way too much pleasure.' After that reply, I stopped and stayed out of his head. I didn't want to hear anymore. I've learned to be scared of Todd and he took joy in that. I just didn't know what to do. Chapter 10: A hot mess Adrianne's POV I felt horrible. I had to stay in bed for days. I had a fever and I've been throwing up and sleeping constantly. This was hell. I couldn't let anyone know about this. About the fact that Todd got me pregnant. Lana would be angry and so would Eric. He would think that I broke up with him to be with Todd. And that is not the case at all. I sat up and sipped my glass of water and then sat it down. I laid back down in bed and placed my hand on my stomach. It was slightly bigger. I didn't know what to do. There was a knock on my door. I didn't say a word. The door swung open and Todd walked in. I glared at him as he came in smiling. My eyes watered as I watched him come near me. "How's my baby?" He asked. I turned my head so I couldn't look at him. Todd placed his hand on my forehead. "You're burning up, baby." I closed my eyes and let the tears slide down. "Don't worry, this will be over soon and you won't ever have to deal with me again, okay?" He wasn't getting a response out of me. He kissed my forehead and then walked out of the room. My eyes burned with tears as I turned to my side. I took another sip of my water and laid down in the bed. My stomach began to hurt and I could feel myself about to throw up. I leaned over into the bucket next to my bed and released all that my stomach would allow. I haven't eaten anything all day so it was painful. I grabbed my water, and rinsed out my mouth, and spit it into the bucket. I wiped my tears away with my sleeve and laid back in bed. This was about to be a long three months. Eric's POV I had no idea that werewolves could get depressed. I've just been in my room staring out of the window. I didn't think that because of one girl, I'd be so sad and empty. She wanted to break it off with me and she did. But she never told me why. What the hell did I do? I guess I fell for her way too hard. My door opened and Todd walked in with a beer. He was smiling. What the hell was he so happy about? He gave me a beer. "You okay?" He asked. I sighed and opened it. "And why exactly would you of all people care?" Todd shrugged and leaned against the wall. "Want to talk about it?" "Why would I want to talk about anything with you when you can just pick it from my brain? How can you do that anyway?" "Not important." Todd answered. He focused intently on me and frowned. "Adrianne broke up with you." I sighed and ran my fingers through my hair. "I don't understand why. Has she been acting weird to you lately?" Todd tilted the beer to his lips and took a sip. "Nope. Everything's been cool." He answered. I sighed. "Maybe I should go talk to her. See what I did?" "Maybe you should let her rest." Todd said. It didn't sound like a suggestion. It sounded more like a demand. I felt the need to probably obey. He was alpha after all. "Yeah, maybe you're right. So you postponed killing that vampire. Are we going after him tonight?" He nodded and took another sip of his beer. "Yeah. He fucks with the pack, he has to go. We should have killed him a week ago, but I wasn't up for it. Tonight is the night." I nodded and chugged my beer. Todd let out a sigh. "I'm sorry for kind of controlling your sister, when it comes to love, I get crazy sometimes." "You love her?" He nodded. "Yeah. Am I forgiven?" I sighed and nodded. I guess Todd was a pretty cool guy. "I'm going to go apologize to Lana. And with my advice, stay away from Adrianne. It'll be easier and maybe make her happier." "I'll think about that." He nodded and then disappeared out of the door. I laid back in bed. I'd give anything to have Adrianne back. Adrianne's POV I got in the bath to relax myself as best I could. I still had a fever and my stomach was hurting. I laid my head back against the tub and closed my eyes. 'Adrianne? Adrianne? I'm in the house. Where are you?' It was Eric in my head. I sighed deeply and opened my eyes as I heard his footsteps. There was a knock on the bathroom door. The door opened and Eric walked in. He quietly sat down on the seat of the toilet and looked at me. "What do you want?" All I could do is whisper. He looked like he was in pain. "I just want to know what I did. I mean you're mad at me and I don't even know what for. And it's killing me because I need you and you know I do. You just shut me down and you have no idea how badly it's hurting me. I need you. Just tell me what's wrong. Please." Tears spilled down my cheeks and I sucked in a breath. "I can't....I just.....can't." Eric sighed and covered his face with his hands. My love for Eric was so strong but I couldn't tell him about anything that happened a week ago. It was too painful and I knew it would hurt him. He took his hands away and his eyes were glistening with tears. He got down on his knees beside the bath tub. "Marry me." He demanded. I bit my lip as my vision blurred because of the tears that escaped out of my eyes. "I can't." I whimpered. "Adrianne, I'm not taking no for an answer." "You're going to have to." I whispered. Eric placed his forehead on the edge of the tub and began crying audibly but softly. And it hurts me because I never saw or would ever want to see him cry and all because of me. "Please. Please." He whispered. I placed my wet hand in his dark hair and looked up as more tears escaped my eyes. "I have never loved anyone as strongly as I loved you, Eric." I whispered. "Then why are you doing this to me?" He asked. I didn't want to. He lifted his head up to look at me. I smiled at him. "You love too strong." My voice squeaked. He shook his head. "There's no such thing as loving too strong." My smile slowly faded. "Go find someone worth loving, Eric because I'm not." "Why are you saying this? What happened to you?" "You're not going to want me." I whispered. "You're the only person I want. How could I not want you?" He asked. I sighed. I needed Eric more than life itself. But if I tell him what happened, he's going to go and get himself killed. How could Eric want a girl like me? Someone who would just break his heart and not give him a reason. A girl who couldn't be honest with him. A girl who would let another man take advantage of her. Eric deserved better than me. But the problem was that he didn't want better. I was the girl he wanted. "Please, Adrianne, just tell me what the problem is and I'll fix it. We'll fix it together because that's what mates do." "Nothing will ever be right anymore. Just leave while you still can." "No." He said. "Please!" I cried. "I'm not leaving until you tell me what's wrong with you!" He growled. "Leave my house before I throw you out." I snarled at him. I had to calm down. I couldn't shift. Not in my 'condition'. "Adrianneâ ¡â ¡please. I'm on my knees begging you." I got up and grabbed my towel as I stepped out of the tub. He followed me into my bedroom. "Adrianneâ ¡¡Why are you doing this to me? Why are you torturing me like this?" "Just leave, Eric. We're over. Pleaseâ ¡¡just go." He sighed and a tear glistened in his eyes. He dropped his head and turned around and closed the door. Eric's Pov There's nothing worse than rejection. Especially from the one girl you knew you couldn't live without. I leaned against her closed door and dug into my pocket. I looked down at the engagement ring my mother gave to me to give to Adrianne. But Adrianne didn't want the engagement ring. And she definitely didn't want me. Something happened to make her feel this way. To push me away. But what happened that could make her break up with me out of nowhere? But I think I knew what to do. Once she's sleeping, I'll just come back and hold her and when she opens her eyes, she'll see how much I need her and maybeâ ¦she just might cuddle with me. Maybe. But I was still confused. She said I wouldn't want her. What did she mean? I wanted her since the moment I saw her and I told her that I wanted her the day we met. Of course she responded by slapping me in the face. And as retarded as it may sound, that's what drew me into her. Not only was she so fucking hot and smart as hellâ ¦she was a tough badass who wasn't afraid of anything. But these last couple of daysâ ¡I've seen nothing but fear in her eyes. What was she so scared of? I placed the diamond ring back in my pocket and walked down the hall and out the house. Todd was standing outside looking at me. "Hey, what's going on?" I asked. He smiled. "It's time to get that vamp. Are you ready Eric? Ready to kill a man?" "He's a vampire, not a man." Todd smirked. "I like your thinking. Let's go." He turned and shifted almost immediately. Without any pain. How though? I always feel pain when I'm shifting. Oh well. I got down on my hands and knees and lowered my head as it began to burn with a fiery heat. I growled and screamed as I felt my fur sprout out of my skin. Once I was fully in wolf form, I followed Todd out into the woods. It was silent. Maybe too silent. 'So how's Adrianne doing? Still having communication problems?' Todd asked telepathically. 'Yeah, she won't tell me what's wrong.' 'Maybe it's a personal matter.' 'I still have a right to know. She's still mine rather she wants to be or not. I will never let her go.' I growled in my mind. 'That's the spirit, Kid.' Todd replied as he shot forward faster than any wolf I've ever seen. His white fur became blurry but it was bright so I could still see him. He suddenly stopped and I stopped too as I could smell the scent of maybe three vampires. I growled at the smell of them. They smelled likeâ ¦death. Obviously. Todd sniffed the air and shot forward again and I followed him without hesitation. The wind blew fiercely. But that didn't stop Todd nor me. We stopped again. 'This fucker is near. I can smell him. We take him out with no hesitation and no intention of stopping, am I clear, Eric?' 'Crystal.' I replied. Suddenly, a fast running noise came from nowhere and knocked me down to my side. I growled as I saw the vampire on top of me. His fangs were protracted and sharp as a needle. But no fear was in my body. I growled again and used my body to push him off. The vampire smiled and was soon knocked down by Todd whose eyes were now white. I've seen them that color before but it was still weird. Todd growled as the vampire pushed him against a tree. He got up and ran with full force knocking the vampire six feet in the air. He fell to the ground and got up as soon as he was down. "Is that all you got, Todd?" The vampire asked. Wait. They knew each other? How? Something wasn't right. 'Eric, you can leave. I'll deal with this asshole.' Todd said into his mind. So he brought me here just so he could tell me to leave? That's stupid. But I turned and left any way. Todd King is something else. I ran back towards the house and ran to Adrianne's bedroom window, quietly. I saw her lying down, sleeping. I changed back into my human form and opened the front door and closed it. I was quiet as I sneaked into her bedroom. I closed the door and slowly walked towards her. She was lying in the middle of the bed so I slid in beside her and wrapped my arms around her. I rubbed her soft skin. Her arms, her legs. Her stomach. Her stomach was hotter than all of the rest of her body parts and felt bigger. As I gently pressed down on it, it was hard. My whole body froze. I couldn't move. I could hardly think straight. That was the problem. She was pregnant. Why couldn't she tell me that? I wanted a family with her. I would have been happy to see her pregnant. I visualize it all the time and it always bring a smile to my face. I rubbed her stomach and a small smile speared on my face. My baby was inside of her and I couldn't be happier. Adrianne's POV The sun shined bright on my face. I yawned loudly and clutched my stomach. I felt nauseous. I turned to see Eric sitting in a chair beside the bed eyeing me carefully. My eyes widened. Has he been here all night? "Morning sickness?" He asked. My eyes widened. How did he know? How did he find out? "How did you-" "It doesn't even matter how I found outâ ¦..Adrianne. What kills me is that you didn't tell me. You thought I wasn't going to want you anymore? How could I not want you? You're the best thing that's ever happened to me." "I couldn't bear to see the hurt in your eyes." "I'd be hurt because you're pregnant with my baby?" He asked anger clear in his voice. He thought this was his baby. He froze. He heard my thoughts. He turned red for a second. I swallowed and took a deep breath as tears automatically slipped out of my eyes. So much anger was inside of me. I wanted to shift and go bite Todd's head off. "Todd? That's⠦⠦⠦Todd's baby?" His voice shook. I nodded my head. Eric got up and started stomping towards the door. "No! Please!" I yelled getting up as fast as I could. I pressed him against the wall. He breathed deeply as he looked down at me. "You cheated on me." He breathed. I shook my head. "No. I would never do⠦⠦." I remembered back to earlier when Todd kissed me just so I'd be able to spend time with Eric. Eric tried to push me but I stayed where I was. "Don't. Please. I didn't⠦I didn't cheat on you." "Yeah, his baby just magically ended up inside of you." He said sarcastically. I shook my head. "Heâ ¦he" "He what?" "Todd raped me." I whispered. His eyes flashed emerald. His wolf's eye color as he darted out the door. I ran after him but I couldn't run fast. "Eric! No! You'll get yourself killed!" I yelled as I ran outside. He shifted immediately and growled as he ran through the woods. "Eric! He's going to kill you!" I screamed. 'Kevin, Kevin?' 'What? I'm sleeping.' 'Please, you have to get Eric; he's going to try to kill Todd.' 'Your boyfriend has a fucking anger problem. Todd is awesome. What happened?' 'Just go stop Eric, I can't shift.' 'Why?' 'I'll explain later. Just please go stop him from trying to kill Todd.' 'I'm on it.' What have I done? I just made this whole thing worst. Chapter 11: Nothing but the rage Author's Note: Only a few chapters left. Thank you all for reading. Chapter 11: Nothing but the rage Eric's POV All I saw was rage. Nothing more than rage. I shot through the woods as fast as possible. I saw nothing but darkness surrounding me. Todd was a dead fucking wolf. Not only did he take over my sister's wolf pack, but he raped my girlfriend and she carries his child now. How could I not want to kill him? I smelled his scent and ran faster. I could hear someone running behind me and I could tell that it was Kevin because of his scent. He started running beside me. We're not connected in any way so he couldn't hear what I was thinking and I couldn't hear what he was thinking. He used his body and pushed me into a tree. I growled and got back up and started running after him. Was he crazy? I pounced on him and he whimpered. I growled as a warning for him to leave me the hell alone. I flew off of him and continued until I got to the Main Pack Area. Todd was in his human form. I charged towards him with full force. He had a small smirk on his face as he put up his hand and I felt myself flying through the air. I fell to the ground with a hard thud. My body ached as I turned back to my human form. I reached up and felt my nose bleeding. It might even be broken. I growled in anger and got up and wiped the blood from my nose. I walked back towards Todd. Adrianne's POV When I finally got to the pack grounds, Eric was upset and his nose was dripping with blood. I ran to him. "No! Eric please don't kill him. Please." "Why shouldn't I? He assaulted you. You should want him as dead as I do." "I do. Maybe more but I'm doing this for your own good. You can't kill him." "Watch me." Eric growled. He moved me out of the way and glared at Todd. Todd kept a small smirk on his face. "Try to kill me, Eric. Let's see what happens." Todd challenged. Eric growled. "You fucker." He ran to Todd and seconds before he got to him, Todd turned with fast speed and forced Eric's head to the ground. Eric groaned in pain. "Stop!" I yelled running to them. Kevin growled as he came near us. Eric slowly got up, his lip was now bloody. "Let's just go. Please." I begged. Eric shook his head. "No. I want him dead." He whispered. "Yeah, Adrianne. Let him try to kill me. He's pathetic really if he thinks he can." "What do you want from us?" I asked. Todd sighed and leaned against a tree. Lana came outside from her cottage and her eyes grown wide from looking at Eric. "What happened?" She asked. Me and Eric looked to Todd and she slowly did too. "You already know what I want, Adrianne. It's inside of you. Living and breathing and strong like a hybrid should be." It's going to be a hybrid? "That's the whole reason I came into this pack. Not because I didn't have anywhere else to go, but because I specifically, came looking for you, Adrianne." "Why?" I asked. He smiled and glanced at Lana. "I suppose you're not aware of how strong your bloodline is are you?" "Bloodline? What are you talking about?" I asked. "You have the Carter bloodline. The strongest bloodline there is. You were originally supposed to be alpha of this wolf pack." My eyebrows pulled together and I looked to Lana who also looked shocked. "I'm what?" He nodded. "I slept with you to make a son. A son that is a werewolf vampire hybrid and will also carry one of the strongest bloodlines there is. He'll be stronger than even me. There are vampires and werewolves after me and my other son and daughter. And ifâ ¦if they get us, my son will avenge my death and carry on as the strongest hybrid and he'll rule over everyone." "He won't be evil like you." I said. "That's his blood in me also, Adrianne. My evil blood just might overshadow whatever good blood you put in him. Evil will always overshadow good." "Not in my book." I whispered. Todd's smirk left and he was now frowning. "He will carry on as I did. I don't want to disappear from this earth without a piece of me still left here. And if they never come for me, I'll take my son, and we'll be on our way." Did he seriously think he was going to take my baby away from me? Was he serious? "As a heart attack." Todd whispered glaring at me. I shook my head. "This is my baby. Mine. And you will not ever touch nor ever see it." I growled at him. "Why would you want to raise the baby that I forced you to conceive?" "It doesn't matter why. It's mine." "My son will be weak if he stays with you. You may have a very strong bloodline, but you don't know how to use your powers correctly. If you came with me when I leave, however, I can show you. Then you would see how powerful your bloodline really is." "I will never go anywhere with you. And neither will my child." "I created it for a purpose. Not a little bastard that you can dress up and teach the fucking ABC's to. He will be stronger than anyone. And when he's old enough, I'll tell him to kill you all." Todd said. Kevin growled in anger. "I'm not going anywhere until I get my son." "And if it's a daughter?" I asked. Todd smiled. "It won't be." He slowly turned and walked out into the woods. I relaxed slightly and turned to look at Eric. His nose was healing. He took a deep breath and grabbed my hand tightly. He dragged me into my house and closed and locked the door. He punched a wall hard leaving a huge gaping hole. He took a deep breath and turned to me. He leaned against the wall and sighed. "Why didn't you tell me he was a hybrid?" He whispered softly. "Iâ´I don't know, Eric. I just don't know." "You can't hide shit like that from me, Adrianne. Now we're dealing with this guy. I can't kill him. He's too fast and strong. He got you pregnant. He hurt my sister. He controls her. Tries to break up my relationship. He's been successful in all of it. One man could do this to a wolf pack. It's justâ´pathetic." He looked down to the floor. I went to the bathroom and grabbed a clean rag from the cabinet. I wet it with water and gave it to him. He wiped his nose rid of the blood. "I didn't want to hide it from you. But I knew you'd go after him and get yourself hurt. And I didn't want that. So I kept it all inside. And it was obviously a mistake." He sat down on a dark blue chair and leaned his head back. "So what are we going to do about it? About all of this?" He asked. I shrugged and crossed my arms. "We just have to wait it out. Let the baby be born and thenâ´." Eric shook his head. "We'll kill him before the baby is born." "How?" "We need to find something that will kill a vampire and a werewolf. That has to be the only answer." "Wolf blood kills vampires." Kevin walked in and closed the door. He sat down on the couch. "I want him dead. What's the plan?" "What kills wolves?" I asked Kevin. He looked at me like I was crazy. "You are. What would you want to know that for?" "Is Todd not half werewolf?" I asked. Understanding appeared on Kevin's face. "Oh right. I have no idea what kills us." "Couldn't a vampire kill us? One did kill your dad." Eric said holding the rag to his healing nose. I sucked in a breath. That's right. So that meansâ´we need a vampire and vampire blood to kill Todd. That seems stupid." "Why?" Eric asked. "I don't know. I just thought maybe something stronger. Way stronger." "Bullets?" Kevin offered. I shook my head. "No. Bullets don't affect vampires and werewolves heal in seconds if they get shot." Kevin nodded. "A stake?" Eric offered. Wasn't a bad idea. Vampires die from stakes but we never knew rather a werewolf would or not. "Maybe." I said. "Sounds ethical. But where the hell could we get a stake from?" "A vampire." I answered. Kevin scoffed. "And why would a vampire have a stake when it could kill it?" "Why would people have guns and knives in their house when it could kill them?" Eric asked looking at Kevin. "I know a vampire we could go to." I said. "We?" Eric asked. I nodded. "No. You stay here and me and Kevin will go talk to this vampire. What does it look like?" I sighed. This vampire actually somewhat trusted me and he didn't know Kevin or Eric. "Um⠯⠯dark hair. Dark eyes. Pale skin. He's always in the woods near our area. And he always have somewhat of a cocky smirk on his face. He's always wearing black." "Todd killed him." Eric said. My eyes grew wide. Todd did what? "We were supposed to kill him together but the vampire had seemed to be kicking ass so he told me to leave. I think they knew each other because the vampire called him Todd." I pinched the bridge of my nose. "That vampire's name is Aeryn. That's Todd's son." "So he got other girls pregnant? When does this guy stop?" "I don't think he will until he's killed. And we have to be the ones to do it. All we need is a stake." Lana's POV "What the hell just happened out there? Adrianne is pregnant with your baby?" Todd didn't look at me as he paced around the room. "Don't talk. Just do me a favor and shut the fuck up." He stared out the window. "How could you force her to do such a thing? I thought you cared about me!" "You thought wrong. I just care about my son. My son who will be stronger than everyone combined and I'll be able to make him do whatever. Starting with destroying all the vampires and wolves that are after me and my other children." "And you can't. Why?" I asked. "They know how to kill me. They know the one way to kill me. But my son⠯⠯he will avenge my death. And I can't count on my other children to do so because they hate my fucking guts. And I can't expect you to do it because well⠯⠯you'll die within seconds of that whole situation." "You should leave." I couldn't stand Todd. He's created so many problems and I hated him. I thought that him coming into my life was a blessing but it wasn't. I was alpha and he just took control. It's time for me to take it back. "I'm not going anywhere until I get my son." "As alpha of this pack I command you to leave." Todd turned and glared at me. "I'm the fucking alpha and only I will tell you what to do." "Fuck you." Todd smirked and was suddenly in my face. I gasped as he pushed me against the wall. I winced in pain. He smiled and walked towards me. I looked around for any weapon. There wasn't enough room for me to shift. I grabbed onto an ash tray and I threw it at him. He caught it and slammed it to the ground. I looked down at the broken glass and then back up into Todd's dangerous eyes. 'Eric, please help me. Todd isâ ¡.' Eric was suddenly there within seconds. "Get the fuck away from my sister." He growled. Eric growled and shot to Todd. Todd grabbed him by his neck and raised him in the air. "You and your sister will both bow down to me. You understand?" Eric was gagging. I got up and Todd grabbed me with his other hand and squeezed my neck. A strained scream escaped my lips. "Will you both bow down to me?" He asked looked up at Eric and down at me. I nodded. He smiled and let me go. I fell to the floor. "What about you, Eric? I mean, I know I hurt your sister and raped your girlfriend and ruined your pack but stillâ ¡â ¡I deserve a small ounce of respect especially because you know what I'm capable of now." I looked up at Eric. I couldn't see him like that. "Please put him down, Todd. I'll do whatever you want." Todd smirked and let go of his neck. Eric fell down to the ground clutching his neck. "I won't." Eric said harshly. "Ericâ ¡â ¡quiet." I whispered. "No. Lana. You're Alpha of this pack. You're going to let this, piece of shit come into our lives and ruin it? That's not the Lana I know. You are so quick to insult Adrianne but you can't when it comes to Todd. And if you can't insult him, then you're no alpha." "I am. I justâ ¡â ¡â ¡There's nothing I can do. What would you expect me to do?" "Eric, just leave. Leave while you can. And I heard what you, Kevin and your little whore were planning. It's not going to work." Todd whispered. "I know." Eric said as he got to his feet. He held out his hand and I grabbed it. "No." Todd growled separating our hands. "Your sister stays with me. She stays." Eric sighed and nodded once to me. I nodded back. He then looked to Todd and took a few bold steps forward. "I will find a way to kill you. I'll find a way soon and when I doâ ¡â ¡!" Todd's fangs slid out of his gums and he snarled at Eric. "I don't like threats." He growled. "Well you're getting them from me anyway. Once you're dead, I'll be happy." Eric took one more look at me before he went off. He slammed the door shut. Todd looked at me with his fangs still protracted. "Get into the bedroom, now." He ordered. "No." He grabbed my hair in his hands and pulled. I let out a cry of pain. "Do you want me to do to you what I did to Adrianne? Only you might be more uncomfortable. I'd end up taking you on this hard floor. I and Adrianne were on a bed when we did it." "When you forced her." "Yes. When I forced her to conceive my child. If you don't want to end up like her, I suggest you keep your mouth shut and do what I say." He let go of my hair and I obeyed as I slowly walked to the bedroom. As he told me to do. Adrianne's POV I laid in bed rubbing my stomach softly. There was a bundle of joy inside of me. I'm sure he or she is good. They won't be evil as Todd. They'll be warm hearted just like me. Kevin walked in and leaned against my wall. "You okay?" He asked. I nodded. He came over and sat beside me on the bed. "I want this to be over. Just overâ ¡forever. I'm sick of thinking that everyone that comes into my life is good when they're really bad." "Who else?" I asked. He shrugged and closed his eyes. "That's not important. I want Todd dead. After what he's done to you. I just don't understand why I can't attack him right now." "Because you'll die, Kevin. You stay here until we get what we need to kill him. "What? A stake? You can get stakes from anywhere. You can get stakes from Wal-Mart." I rolled my eyes. "Shut up. This is serious." "I know it is, Adrianne. But this seriousness is stressing you out and this stress is putting the baby at risk." "You actually care about it?" "Yes. I do. I hate that Todd is the dad. I would have preferred it to be Eric butâ ¡.I think I kind of love it." "Wellâ ¡you're not the only one who wishes that it was Eric's baby." I said. Kevin sighed. "I'm going after him. I, Eric and Lana can kill him." "What about me?" Asked a familiar voice. It was Aeryn. My eyes widened at the sight of him. "Who the hell are you?" Kevin asked. "The vampire I was talking about. His name is Aeryn." "It has a name?" Kevin asked. "Yesâ ¡â ¡it does. What's your name? Dumbass?" Kevin growled. I held in my small giggles. "It's okay, Kevin. We can trust Aeryn. He's Todd's son and the same vampires that are coming after Todd is coming after him and the rest of his family, right?" Aeryn nodded and sat in a chair in the corner. "Yes. My dad has committed many crimes. He had broken the werewolf and vampire laws. The council that rules over us all wants him dead and they want me, my sister Aries, and a good friend of mine named Addison, dead. But I have a theory that if we could kill Todd before they can get to him, they might let my family live because Todd is a huge problem. He's the only Werewolf/Vampire hybrid there is except my grandfather." "Would he know how to kill a hybrid?" I asked. Aeryn nodded. "Yeahâ ¡of course." "Good. Where is he?" "Dead." "What?" "Dead. Stake to the heart dipped in silver. Millions of wooden bullet holes into his skin and burned by the sun. Plus loss of blood. Haven't fed in weeks. Was not a pretty sight." "So we have to get everything that can kill a vampire and werewolf and use it all against him all at once?" Aeryn nodded. "It's the only way to kill him. I won't be able to help because you need to kill him in the daytime when the sun is out. You have to get him to his weakest point and stake his heart. Make sure you get the heart and not the lung. Because if you miss, you better run because you've just pissed him off." "So convincing." "Harder than it sounds." "Oh trust me, it sounds extremely hard." I said. Aeryn shrugged and his eyes finally went to my stomach. I pulled the sheet over me and looked back at him. "So the wolf's having a baby. How interesting." "This isn't about him or her. Whoever. We're talking about your bastard father who did this to me." Aeryn's eyes grew wide with shock. His eyes slowly went back to my stomach and he gulped. "When you say he did this to you la." "He forced me...he just!" "No. I understand. Stop talking. Why would he conceive with you? I don't understand." "He said it was so once he dies, his son can avenge his death and rule over everyone. He wants his son to rule over everyone and I mean everyone." "Including the were panthers and shape shifters and even humans?" He asked. "I suspect." "But he never came to me or my sister and said he wanted us to avenge his death." "I think he's convinced that your family will surely die." "Well he's wrong. I'm going to get things you need to kill him. Whatever he has planned will surely fail. Use the supplies wisely. I won't be back till after midnight tomorrow. Until then, watch your ass." Kevin nodded and I did too as Aeryn got up. He was about to walk out. "Thanks for helping us." I said. He looked over his shoulder with a smirk on his face. "What are friends for?" He was suddenly gone with not even a millisecond. I couldn't wait. Soon, it was over for Todd King. Chapter 12: Unbreakable Eric dropped a pile of stakes and silver chains onto the floor next to my bed. I looked down at the items and then back up at him. "I guess that Aeryn guy is pretty cool. He gave me all this stuff. He must want Todd dead as much as we do." He said. I was lying down on the bed with my hand on my stomach rubbing it. "I guess so." I responded. Eric smiled. "All we need is the sunlight." Eric said. I looked out the window at the dark sky. "Doesn't look like we're getting it today." "Damnit." Eric muttered. "Do we really need the sun? You sure?" "Everything that will kill a vampire." "You're forgetting the guns with the wooden bullets." Lana said as she walked into the room. She had two guns in her hand. "You're going to help us?" Eric asked looking surprised. She nodded. "I want him dead." She said harshly. I couldn't keep the smile off of my face. "Fantastic. But I doubt the sun will be out today." I said. Lana sighed and rolled her eyes. "You are so damn stupid. The sun doesn't affect him. He's been out in the sun beforeâ ¡â ¡remember? "You're right, Lana, the sun doesn't seem to affect him." "Unless he puts on some kind of cream or something to protect himself from it?" Eric said. "What some kind of sunscreen?" Lana asked sarcastically. I looked at Eric and he looked back at me. "You can't be serious. Sunscreen? Really?" "It's a possibility, sis. We don't know yet. We'll discuss this later. I'm pretty sure the bastard can hear us. Right now and telepathically." Eric said. He was right. "So why don't you go so I can talk to Adrianne alone?" Eric asked. Lana rolled her eyes and carried her guns outside. Eric stared at me for a second and then sat on the bed next to me. I just had the urge to touch him. "Soâ ¡â ¡â !" Eric said as if he didn't know what to say. "So." I replied back. He sighed deeply. "This is bad timing. Very bad timing but I need to know whether or not we're together. Or if we even have a chance to be together again." I ran my fingers through my hair and breathed. "You're right. This is very bad timing." I said. He placed his hand on my leg. He scooted closer to me. "I just need to know if there is a possibility of us again." His hand slowly trailed up to my thigh and I looked him in his eyes. "Of course there is." I replied. He smiled and slowly leaned over. His lips brushed against mine softly at first. Our lips enveloped each other's perfectly. He placed his hand through my hair and pulled me closer to him. He made me straddle him and he rubbed my thighs. I licked his bottom lip and his hands moved to my back and he moved my shirt up slowly. I sucked in a breath. "I can't do this." I said as I tried to get off of him but he held me in place. "Stop pushing me away, Adrianne. You can't keep doing this to me." "How could you think about sex with what's going on with Todd?" I asked looking at him. "It'll take the stress off of both of us." "Ericâ ¡" "Shh." He whispered. Then he placed his hand on my cheek. "Just let me make love to you." I took his hand off of my cheek. I still thought back to that night when Todd raped me. Truthfully, I felt that maybe sex would get rid of the stress but truthfully, I was scared to have sex. It may sound ridiculous but I just keep thinking about that night. What Todd had done to me. "We'll take it one step at a time, Adrianne. I don't want you to be scared. I want you to feel better." Eric said. "I do. Just by you being here with me." "That's not it. I just feel like it's pretty stupid to let one man take every ounce of lust you had inside of you." "Well you wouldn't understand, Eric. You're not in my situation." "I don't want you to be afraid to do something you love to do." "Iâ ¡â ..I'm not scared." Even I could hear the lie clearly in my voice. "Prove it to me." He breathed. I bit my lip for a second before leaning down and kissing his soft lips. His hands squeezed my breast and his tongue fought with mine. His hand moved to my hair and his fingers tangled in it. I pulled away slightly to breathe. "Don't be scared of me. I don't want to hurt you. You know how much I love you, Adrianne." I nodded and closed my eyes. His lips were back on mine and he got off the bed and I was still wrapped around his body. He turned and laid me down on the bed. He looked deep into my eyes. "I will never, ever, let Todd or anyone else hurt you again. I'm so sorry." He whispered. "Don't be. He did something to block your thoughts from me and to block my thoughts from you. It wasn't your fault. Don't blame yourself." I said. He placed his hand on my cheek. "You will always be mine. I will never let anyone else have you." He leaned down and pressed his lips to my throat. I missed the way his lips felt on my skin. "Adrianne, please marry me." I looked up at him. "Why would you want that? I meanâ ¡..I'm pregnant withâ ¡" "Thisâ ¡is not your and Todd's baby. This is mine and yours. That's how I want you to think about it for now on. Todd wants to use your baby. Use him or her for bad. But me and you will love and raise this baby as much as possible." "You'd help me raise the baby?" "We'll raise it together. And maybe have some more." I smiled up at him and tears glistened into my eyes. "Whyâ ¡why are you so perfect?" I asked. Eric chuckled and kissed my throat again. Then his lips went to my jaw and then my lips. "Let's just admit to ourselves that we need each other." "We're too young to get married." I said. "Are you going to let age stop us? Age is just a number and besidesâ ¡you're never going to turn eighteen. And I'm never going to be twenty. We're these ages forever." Eric said. He had a small smile on his face. "My mother and your sister won't like that very much. My mom hardly trusts you and Lana hates me. How is it going to work?" "I'm sorry, is Lana and your mom in our relationship?" "Wellâ ¡no but...." "No but nothing. This is about me and you and how we can't live without each other. Let's just make this happen. We both want it. Tell me you don't love me and I'll leave right now and never look back." "If I said that, I'd be lying." I admitted. Eric smiled again. "I thought so." He pressed his lips against mine again. Eric was right. I loved him just as hard as he loved me. Maybe more. And Eric was everything. He'd raise the baby that I was forced to get pregnant with. He'd marry me no matter how young we were. He'd fight for me and die for me. I couldn't help but think back to that day. That day me and him met each other for the first time. It was a Monday morning and a sunny day. My mom was walking towards me out of the woods. 'We're going to have some other wolves in our pack.' "What?" I asked. We had enough. I can already tell these other wolves are going to piss me off. All wolf packs contained the same species but we didn't all get along and that was not against the law. "Yeah, they're here now. A girl named Lana is the pack master and will like to meet us all." "I'm fine. I'm just going to go home." "Don't be rude. It will only take a second." "I'm not being rude and I don't want to take even a second of my time to meet any other wolves. They just stay out of my way, and I'll stay out of there." My mom gave me a look. I sighed and followed her to the pack grounds. There were at least twenty unfamiliar faces I saw. A dark haired girl with fierce eyes looked at me. She tilted her head to the side as if something about me confused her. I looked back at my mom and then back at 'Lana'. "I'm Lana Foster. The new alpha of your wolf pack. I was sent here once my father, Jackson Foster, died. He was your alpha but now that he's gone, I'll be taking over since I'm the oldest in the next generation." She said. Her dark hair blew in the wind. "And this," Lana turned around and brought forward a guy. "This is my brother, Eric." Eric's eyes immediately went to mine and a small smirk appeared on his face. He had light hazel, golden eyes. His skin was smooth and flawless. His hair was dark and short. I bit my lip and looked down to the ground. God. He was so sexy. "Eric is second in command. Once I die, if I die, he will take over as the pack leader and you'll all have no choice but to obey him. But until then, you'll obey me." I looked back up and my eyes met with Eric's again. He was still staring at me. His smirk turned into a full grin. I slowly turned around and started walking back towards my cottage. This guy was hot. I won't deny it. But who has time for relationships? Especially when you're a freak of nature. I walked through the dirt and leaves slowly when I felt someone behind me. I slowly turned to see Eric behind me. Looking down at me with lust in his eyes. "Umâ ´can I help you?" I asked. He had a cocky smirk on his face. "I want to talk to you." He answered taking a piece of my hair into his fingers. I smacked his hand away. "Don't touch me." I snapped. He smiled. "You're not a nice girl. I like that." He said in a soft velvet voice. "Yeah, I'm not nice at all so unless do you don't want to get kicked in the balls, I suggest you leave me alone." I turned back around and continued walking. He grabbed my arm and I turned and swung at him but he caught my fist. "Can I tell you something before you end up killing me?" "Can you let go of me before I end up killing you?" I asked. He let go of my fist. "Now, what do want to tell me and make it quick. I want to go run for a little." "May I join you?" "I like to run alone, Erin." "It's Eric." "Same difference." I answered. I don't know why I was being mean to him. "You like me don't you?" He suddenly asked. I looked at him in disbelief. Why would he automatically think that? "What makes you think that?" I asked. "Well one, you didn't deny it. And two, I could feel it. I know you can feel that I like you too." "How can you like me and you don't even know me?" I asked. He smiled. "I'd like to know you. Starting with your name please?" He asked. I sighed. "Adrianne Renee." I answered. "So your name is two first names?" I nodded. "Is that a problem?" I asked. He shook his head. "I like it. It's different. Like you." "Stupidest line ever." "That's another thing I like, Adrianne. Your feistiness. It's a turn on." "Well turn it off because I'm going." I said turning away. "Wait. Wait!" He stepped in front of me. "What do you want?" I asked irritated. He gave me a small smile. "I want you to be my mate." My insides felt like Gello. Chills ran down my body as he gave me a seductive look no guy has ever given me before. Before I could take another breath, I slapped his cheek hard across his face. He turned his head back to look at me. "You stay away from me, freak." I said as I turned and walked away from him. Believe it or not, I only left him alone because I was afraid that if I didn't, I was going to attack him and fuck him. Even though, I was a virgin and wanted my first time to be taken by someone I loved. But I wouldn't have minded having sex with Eric right then and there. And now here we were. He wasn't the annoying, cocky, perverted little brother of the pack leader. Now he was the sweetest, beautiful, amazing sex god that I couldn't live without. "Whoa." He said sitting up. "What?" I asked him. He smiled and looked down at me. "I just… I just saw back to that day we first met. I was reading your thoughts and then out of nowhere, visions of that day started entering my head. It was… like some kind of movie." "You actually saw my thoughts?" I asked. He nodded and smiled. "What the fuck?" I laughed and sat up curling my fingers into his hair. "I guess that the deeper our love gets, the more we learn about our powers." He nodded and leaned his forehead against mine. "So, back to my question." "Mmh, what question?" I asked closing my eyes. "Will you marry me?" He asked. I opened my eyes and smiled. And then nodded. "Yes, I will." He grinned and then reached into his pocket. "I carried this ring in every pants pocket for months until I could find the perfect time to ask you." I held out my hand and he slipped the ring on my ring finger. "Perfect fit." He whispered. Then his eyes went to mine. "Just like us." I nodded and went to kiss him again. Lana's POV Chapter 12: Unbreakable Todd was a rough person. In general. He's a very complicated person if that's what he is. He's not even remotely human any more for crying out loud. It's obviously not easy to get on his good side and he trusts no one. I closed my eyes and stirred slightly. I was naked wrapped in the silk dark blue sheets. Todd was lying beside me holding me. I wanted him to leave me alone. To leave my wolf pack alone. But no one could tell him to leave because he won't do it. I can't wait until me, Eric, Kevin and the rest of the wolf pack kills him. Todd King is a fucking p- "Your thoughts are annoying." Todd said. I sighed. "Well no one told you to listen." I replied. Todd let go of me and rolled to the other side of the bed. "God would she just give birth already? This is so annoying." "She didn't ask to be put in this situation. You put her there. It's only been a couple weeks. You have hardly two months and a half left. Why couldn't you find someone else's life to ruin?" Todd sighed, "Because, I told you that her bloodline is strong. Extremely strong. And I need my son to be strong. He'll be indestructible. He'll kill every single vampire and wolf that killed and attempted to kill me. He'll be more powerful than the vampires that are on the council." "The what? What the hell are you talking about, Todd?" I asked turning to him. "The council. The vampires that are after me and my family. There are at least fifty of them. And with Adrianne's bloodline and my vampire and were wolf DNA, my son will be able to kill them all. Very simply." "You're going to use your son to do your dirty work for you." "Precisely, sweetheart." Todd replied. He was suddenly on top of me. "It's amazing what fucking can do. Wouldn't you agree?" He asked looking down at me. I could feel his erection on my thigh and I tried to move to get away from him. He grabbed my face and looks deep in my eyes. "Listen to me, Lana." He whispered. I looked up into his hazel eyes and I couldn't look away. "Once everyone is sleep. You're going to go steal every weapon they have. Every last weapon. Do you understand?" He asked. I nodded. I felt like I was flying. Like I was a light feather blowing through the wind. I nodded and smiled. "Okay." I breathed. He smiled and kissed my lips. "That's my girl." He got off of me and I sat up. The high feeling disappeared and I felt back to normal. That wasn't weird. As time approached, around twelve o'clock at night, I got up out of my bed. I felt dizzy as I left out of the house. I had to do what Todd told me. I slowly walked over to Adrianne's cottage and didn't bother knocking as I opened the door. I shut it closed. I have to find every weapon and take it. I remember where I hid the guns. I got them from out of the closet where I also found the stakes and silver chains. I gathered them all in a pile and went to the kitchen. I grabbed a huge black trash bag and placed all of the items in the bag. I smiled at the weapons I got. Getting them out of the house was another story. I had to actually drag them out. I heard the bedroom door open and Eric came out looking confused. "Lana, what are you doing?" He asked. I smiled. "I'm giving these weapons to Todd." Eric's eyes widened. "You're doing what?!" He closed the door and came over to me. "Did he tell you to give him the weapons?" I nodded. "What the hell is your problem?" He asked grabbing the bag from me. "Give me the bag!" I yelled. "Why are your eyes white?" He asked. He grabbed my face. "Let go of me! Give me the guns, Eric!" "Keep your voice down. Adrianne is sleeping." He whispered loudly. "Well then go sleep with her and let me get the bag." I said. He shook his head. "I'm not going to let you give that asshole these weapons and you're not going back there." "Please." I said. "Lana, maybe you should shift so your eyes can at least be the same color as your wolves's. The white is starting to creep me out." "It'll go away if you give me the bag." "No. Go to sleep on the couch. Don't you dare walk out of this house." "I have to get back to Todd." I whined. Eric shrugged. "He'll be alright without you for a night. Sleep on the couch." He started walking back into the bedroom with the bag in his hand. "No, I'm going home." I said heading for the front door. "No, Lana. You're staying here, I don't give a damn if I have to force you into Adrianne's bed and make you sleep in between me and her. If you're not going to act like the goddamn alpha of this wolf pack, I am. You're staying here." He said. My little brother was taking charge and it honestly scared me a little. "Fine." I pouted. He dug a key from his pocket and locked the door from the inside. What the hell? "I don't trust you 100%. Go to sleep." He dragged the bag into the bedroom with him and closed the door. Goddamn asshole. What does Adrianne see in that idiot? I sat on the couch and laid my head down on the arm of the chair. And I was soon off to sleep. Adrianne's POV When I woke up, Eric was in bed next to me fully dressed. He looked anxious. "What's wrong?" I asked. Eric sighed. "We're going after him today." "Today?" I asked. He looked pass me out the window. I turned to see the sun shining brightly. "It's time." I looked back to him. "I need you to stay here, Adrianne. You have to stay here no matter what. No matter what thoughts you hear, you have to stay here." He placed his hand on my cheek and looked deeply into my eyes. "I love you, okay?" I felt tears swell up into my eyes. "Eric, please don't go." He smiled at me. "I don't want you to worry about me. I want you to think about other things. Good things. Like what you want to name the baby. What song you want for our wedding." He chuckled slightly but I couldn't find it in myself to laugh. Tears slowly spilled out of my eyes. "Please." I begged. "I have to, Dri. I just have to. I'm doing this for us. Just be strong for me and stay in bed." He said. I nodded and closed my eyes. His pressed his lips against mine hard. His fingers ran through my hair. He kissed me like this was our last day on earth. "I love you." He whispered against my lips. "I love you." I said back. He leaned his forehead against mine and closed his eyes. I did the same. "As soon as this is over, we're getting married." He said. I nodded and curled my fingers in his hair. "Okay." I whispered. Eric slowly pulled away from me. He walked backward out of the door and shut it as he finally left out. He was gone. Todd was unstoppable. And I doubted if Eric was going to make it out of this. I couldn't let this happened. I looked down at the engagement ring that Eric gave me. It shined brightly as the sun reflected off of it. I loved Eric, I loved Kevin. I even loved Lana. I loved my wolf pack too much to let anybody get hurt. I wiped my tears away on my sleeve and got up. My stomach was bigger. I placed my hands on my stomach. "I love you, baby." I whispered. I got up and put on some pants. I grabbed on my shoes and ran out of the door. Kevin and Eric were already gone. I ran out the front door as fast as I could. If I transformed into my wolf, I'd lose the baby. So I stayed in my human form. Adrenaline pumped through my veins. I didn't have any weapon but I wanted Todd dead as much as everyone else and I will do whatever it takes to kill him. Chapter 13: Can't fight any longer Author's Note: This is an extremely short chapter. I know. I'm sorry. Next chap will be longer and better. Comment Chapter 13: Can't fight any longer Adrianne's POV I ran as fast as I could. I could smell everyone's scent. It got stronger the closer I got to the pack grounds. I knew that if I fight Todd, I'm fighting him out of hate and anger and to protect my unborn child. My feet kept moving. They didn't stop not even for a second. As I got closer, I could hear Todd talking. Good, no one has started fighting yet. But from what I could hear, anything was about to start. Anything. When I got to the pack grounds, I stopped. Todd and Eric were face to face. Lana had a gun pointed to Todd and Kevin had a chain and a stake in his hand. I slowly walked over and tried to pull Eric back. "Stop it, Adrianne." He said shrugging me off. "This isn't your fight." I said. Eric glared at me. "I thought I told you not to come here." "Ericâ ¡â ¡this isn't your fight." I said again. And at that moment, everything happened so quickly. Todd suddenly moved from his spot and was holding Lana down by her throat. She gagged for air. And before me and Eric had time to react, Todd twisted her hand so she was pointing the gun at herself self and he made her pull the trigger. Lana had a huge bloody hole in her eye and blood spilled out. Eric and Kevin ran over at the same time and jumped on Todd. Todd threw Eric seven feet in the air. Kevin wrapped the silver chain against Todd's neck and smoke rose off of his body. Todd screamed in pain and then pushed Kevin back onto the ground. I ran over and went for the gun that was still in Lana's hand. Todd grabbed the chain and threw it off of him and he went over and grabbed the gun first from Lana and aimed it at me. I stopped running and stayed where I was. He glared at me and then smiled. "You won't win, Adrianne. My son will soon be born and you will soon be dead afterwards. Or I could just kill you now and find someone with a stronger bloodline than you butâ ¡I don't think there is another person or family with your kind of bloodline." He said. "I know. So you can't kill me." I whispered. He nodded. "But I can still hurt you." He turned the gun to Eric and pulled the trigger. I don't know where the bullet hit. I didn't even think. I immediately ran over and dropped down to my knees and grabbed his face. Eric was breathing hard. "Eric, are you okay?" I asked. He slowly nodded. I looked down and saw that the bullet hit his chest. But it was quickly healing. I smiled and kissed him before standing up and turning to Todd. I glared at him. Kevin threw a stake at me. I caught it and continued glaring at Todd. "Come and get me sweetie." Todd teased. Eric slowly got to his feet and got down on all fours. He was about to shift. Distractions were all we needed. And Eric can distract him. Eric cried out as I heard his bones breaking and could hear his fur sprouting from his body. Todd looked back and forth between us all. Between this time, I'm wondering where the rest of our wolf pack is. "I compelled them to stay away." Todd said. Eric was now in his wolf form and growling menacingly at Todd. He charged towards Todd and as Eric did that, Todd shot Eric's wolf in the chest again and Eric fell to the ground. But he couldn't shoot me down if I changed. And if I changed, I would lose the baby. I didn't know what to do. Kevin wanted to shift. I could feel it. I walked over to Todd. Kevin went to help Eric up. I stood now face to face with Todd. He looked me dead in my eyes. "You can't kill me." He whispered. "Watch me." I said back. I lifted the stake that was still in my hand and he grabbed it and twisted it around to me. He was way stronger than me. The point of the stake was now in my shoulder causing me to bleed. Kevin suddenly was behind Todd. Todd didn't notice though. Kevin had the chain wrapped in both of his hands. He was about to wrap it around Todd's neck again. Todd elbowed him back and grabbed the stake from me andâ ¡â ¡â ¡I felt it. I looked down and saw the stake sticking out of my stomach. Pools of blood erupted out of me as I dropped down to the ground. My eyes closed and the darkness took over my body. Chapter 14: Breakable Eric's POV Adriianne's body fell to the ground and I watched as blood spilled out of her mouth and her stomach. Her body twitched as she looked up into the sky. My eyes grew wide at the scene. My fiancé was dying. As soon as I ran for her, Todd pushed me to the ground. Then he stepped down hard on my leg, and I heard a crack. I cried out. Todd walked near me and looked down at me. "I'll be taking my son now." He said smiling. He looked over at Adriianne and his fangs slowly extended. "Her blood smells delicious. I think I'll take a taste or two." He smiled and then walked over to Adriianne whose eyes were still open looking up at the sky. She was expressionless. Todd stood over her and looked down at her. "That's a lot of blood, baby." He said. I couldn't stand. My leg was bleeding and red and swollen. "Fuck." I whispered. I began to drag my body to Todd and Adriianne. Where the hell was Kevin? "Adriianne!" I yelled. She didn't respond. Todd got on his knees between her legs. He examined something and then looked back at me. "Her water just broke. She's not dead." He turned back to her. Slowly, I could feel the excruciating pain in my leg slowly disappear. When it did all the way, I got up and ran over and grabbed Todd and forced him down to the ground. As soon as I did this, Adriianne shrieked and I looked at her and her eyes were bloodshot red and her stomach wasn't moving. What the hell? Todd made me fall to the ground and then he wrapped his hand around my neck and squeezed. I couldn't breathe and he had a strong grip on my neck. My eyes widened as my vision got blurry before me. Adriianne was still crying and screaming loudly and twitching on the ground. There was suddenly a loud bang and I looked up to see a bloody hole in Todd's chest. Todd looked down at the hole and then smiled and looked at me. He leaned down and I felt his teeth pierce into my neck and I grabbed his hair pulling him back from me and a chain was wrapped around his body and his neck by a red headed girl who looked like a teenager. My neck was released and I could breathe again. Aeryn then came out with another man. I guess they were all vampires. How were they out during the sun? The man had a gun in his hand. Todd was on the ground and smoke was rising from his skin because of the silver chain wrapped around his body. Two silver bullets struck into his chest. And another one into his head. Kevin came to him and held up something in a can. He glared down at Todd who was already groaning in pain. Kevin pressed down on the little button and as soon as the liquid touched Todd's skin, it began to dissolve and his groans turned into screams. Wolfsbane. They were doing it, using the weaknesses of vampires and werewolves to kill a hybrid. Other unknown people came over with stakes tight in their hand and began to pierce his dissolved skin. He was turning into blood and bones slowly. I looked over at Adriianne who was twitching in pain still. I ran over to her and kneeled beside her. "Baby." I whispered. She looked up at me weakly. Tears coming out of her eyes. "I'm scared. I think he's..." She whispered. I shook my head. I lifted her pale dress and looked under her dress. She was breathing heavily. "Push baby." I whispered. She shook her head. "I can't." She whispered. I nodded. "Yes you can." She closed her eyes and screamed as she tried to push. Kevin came over towards her. "We need to get her home. "She's about to have the baby." I said. Kevin looked behind him and then to me. "Truth be told, wolf," Aeryn said leaning down between us. "I never actually heard of a hybrid birth. Only a birth between a vampire and a human and wolf and a human." "Why are you just now telling us this?" Kevin asked. Aeryn licked his lips and sighed. "I didn't want you all to freak out. You can't exactly get a hybrid aborted or anything." "Why?" I asked. Aeryn shrugged and sighed. "I don't know." He answered. I looked at Adrianne's weak body and face. She was growing pale. I shook my head. "No. No. Baby." I whispered. She wasn't answering me. My eyes watered. "Baby." I whispered. Her eyes closed. "Fuck." Aeryn whispered. He lifted his sleeve and bit into his skin and let the blood fall onto Adrianne's lips. "What the hell are you doing?" I asked. Aeryn looked at me as he pushed his wrist against Adrianne's lips. "You don't want her dead. My blood can heal her." He said. I looked at her and then looked underneath her dress. I can see the baby sticking out but he wasn't crying. Fuck. "We need to get her home." Kevin said. "Right, with a baby sticking halfway out of her vagina." I snapped. He rolled his eyes. I reached inside of her and pulled the baby out. I stared at his small bloody pale figure. His eyes were closed. He was breathing. Aeryn looked at his half-brother and then to me. I looked down at him. He slowly opened his eyes. He had white pupils then they slowly turned black and then light green. Then to dark green as he looked up at me. "Is that him?" Asked the red headed girl. I looked up at her. Aeryn nodded. "Guys, this is my sister, Aries. Aries, this is our half-brother." He said. She smiled down at him. She got on her knees beside me and Aeryn. "He's beautiful." She whispered. Her eyes slowly went to Adrianne. "Is she dead?" She asked. I shook my head. "She better not be." Said Kevin. I looked back down at the baby. "He's gone?" I asked no one in particular. "He's gone." Aeryn replied. Adrianne's POV When I woke up, everything was bright. I rubbed my eyes and swallowed and sat up. I realized I was back in my cottage. In my bedroom. "Hey, don't move so fast." Said a voice. I looked over to Eric and smiled. "How do you feel?" He asked. I scratched my head and looked down at my stomach that was no longer big. I gulped. "Eric?" I asked. "Relax, honey, he's fine." He whispered. Relief washed over me. "It's a boy?" I asked with tears forming in my eyes. Eric nodded. "It's a boy. Its our boy." He whispered. I smiled and he slowly leaned over and kissed me. "Why do you taste different?" I asked. He shrugged and smiled, then kissed me again. And again. And again. "Where is he?" I asked against his lips. Eric stood up and went out of the room for a second. I didn't want to ask him where Todd was. I didn't really care. The only thing besides Eric that I cared about right now was my son. My son. I'm going to have to get used to having a son. It was definitely a change. A huge one. Eric came back in with a tiny pale baby in his hands. I almost cried at how beautiful he was as Eric put him into my arms. He was warm. Not too hot like a werewolf. Not too cold like a vampire. His pupils turned from green to white for a second, then black, then back to dark green. It truly scared me for a moment. I looked up at Eric as he shrugged. "That happens. I don't know why." He whispered. I rocked the baby back and forth and smiled at him. It was hard not to. "May I come in?" Asked a familiar voice. I turned to see Aeryn in the doorway. I smiled at him and invited him in. He walked in with a red haired girl right behind him. "He looks just like you, wolf." He said smiling. I rolled my eyes. "What's his name?" The red haired girl asked. I licked my lips and thought for a second. "Lucas." I whispered. "Beautiful." My mom whispered as she walked into the room. I looked up at her. Tears forming in my eyes. "Mommy?" I cried. I sounded like a little girl. Eric took the baby from my arms. My mother hugged me. I was about to ask her where she has been but I remembered that Todd said he compelled the wolf pack to stay away. "Are you okay?" She asked. I nodded. She looked at Eric and Lucas. Eric was doing a cute little voice as he was talking to Lucas. My mom turned to look at me. "Are you sure you're okay? I heard about everything baby. I wish I was there." "No mom. It's fine. It's fine. It's okay now. I'm justâ ¡..I'm so glad that you're here." I said. She smiled and hugged me tightly. "Me too, baby." She whispered. I never felt so close to my mom before now. I loved her more than I'd ever realize. She turned and grabbed Lucas in her arms. "God, he is so gorgeous." She cooed. Eric smiled a little and then came over to me. I watched as Aeryn and the red head went over to play with Lucas. He sat on the bed and looked at me. "Does your mom know about Lana?" I asked. Eric sighed and nodded. "Yeah she knows. She's pretty heartbroken about it." "I'm sorry Eric." I said. He smiled and leaned his forehead against mine. "I know. It's okay. I'll always love her. Just like I'll always love you." "I know you'll always love me but your sister just died and you don't seem to be phased by it at all." "I feel kind of numb about it truthfully." He said. I nodded. "Numb is good. Sort of." I whispered. He smiled and pressed his forehead against mine. "You're all I need." He said. I smiled. "You're all I need." "He's so beautiful, honey." My mom said handing him back to me. "Thanks mom." I said. She smiled. "I'll leave you alone for a little." She said and then turned and then left. Aeryn sighed and then smiled. "I'll wait outside with Addison." The red haired girl said. She left out of the room quietly. Aeryn nodded. "This was quite a day. Quite a day. My dad's dead. And I have another brother." "Yeah." I said. Aeryn looked into my eyes. "I guess I was wrong about wolves. You guys really do have meaning." He said. I smiled. "Same about vampires." I said. Aeryn looked down at Lucas. "That little guy is definitely going to change some lives." He said. I nodded. His eyes then went to Eric. "Sorry about your sister." He said. Eric nodded. "Thank you." Aeryn smiled. "I'll catch you all later." He said. "Hey Aeryn," I said. He turned slightly. "You're a good friend." I said. He smiled and nodded and then stalked out of the room. I licked my lips and looked down at Lucas. "So breast feeding is definitely out of the question." Eric whispered. I playfully pushed him with my shoulder and he kissed my forehead. "We'll have to get some blood for him." I said. He nodded. "I'm sure we can find some human. Get some blood. Shouldn't be too hard." "Right, like a human is going to offer to donate blood for a werewolf vampire hybrid." I said sarcastically. "They don't have to know what its for." "I heard vampires keep humans around for blood and sex. Maybe Aeryn has a human." I said. I watched as Lucas's eyes slowly closed. "Maybe." Eric whispered. We both watched little Lucas. We both envied the kid and he's only been here for a couple of hours. Lucas was going to be a good kid. I can see it now. He was beautiful and he was perfect. He was my son and I'm holding onto him. And. I'm. Never. Letting. Go. Chapter 15: Epilogue Author's note: Still thinking about rather or not I should make a sequel about the son Epilogue Adrianne's POV I grabbed my son, Kaiden in my arms and laid him in his bed. I kissed his forehead. "Mommy?" He asked. I looked down at him and brushed his hair out of his eyes. "Yeah?" I asked. He looked me in my eyes. "What happened to me today?" He asked. I sat down on the bed beside him and brushed his hair back. "You shifted for the first time, baby." I said. His eyes grew wide. "I did?" He asked. I nodded. "Sometimes when wolves reach a certain age, they shift. It can happen at anytime." "Evenâ ¦..school?" He asked. I nodded. "That's why your grandma homeschools you, Kaiden. Sometimes you won't be able to control your anger and we can't have humans knowing about our existence or about the existence of vampires. Okay? Can you keep it a secret?" I asked and brought my index finger to my lips. He did the same. I smiled and kissed his forehead. "Can I go out and run with you and daddy in the morning?" He asked. I smiled and nodded. "Of course, baby. Sweet dreams," I whispered. "Love you mommy." "Love you more." I whispered before kissing him again. I got up and closed the door as I walked out. Eric was standing in the doorway smirking at me. "Hey." He said. I smiled as he pulled me over to him and kissed me deeply. I curved my fingers into his soft brown hair. "You're so sexy." He whispered against my lips. I giggled and smiled. "Not soon. I'm going to be fat in a couple of weeks." I said. His hand rubbed my stomach. "So? You're still sexy." He kissed me again and again. "Hey, before this goes deeper, you should go check on Lucas. He's on the roof alone." He said. I sighed. Lucas was ten. And he was a good boy but he also had a bad case of anger. Worse than any of us. And it honestly scared me sometimes. "Okay, wait for me in the bedroom." I said. He smiled and nipped at my ear before disappearing at the other end of the hallway. I walked outside into the night air. Aeryn was walking around hand in hand with a woman named Angel. She was pretty. Even for a human. "Out a little late don't you think?" Aeryn joked. I rolled my eyes. "Your brother is on the roof. Got to go get him." I said. Aeryn nodded once. "Hi, Angel." I said. Angel smiled. "Hey, Adrianne. Having the baby soon?" She asked. I shrugged. "Not even fat yet." I said and she giggled lightly. I walked to the back of the house and climbed the tree. This little boy is making me climb a tree while I'm pregnant. I'm gonna kill him. But I did make it to the roof. Lucas's legs were hanging off the roof as he sat looking down at the ground. "Hey, you okay?" I asked. He turned and his eyes glowed bright white and then went back to green. "I'm fine." I shook my head and sat beside him. "No, you're not. You always come up here." I said. "I come up here when I think I'm gonna get mad. I just want to be alone." "Don't shut me out." I said. He looked at me and his eyes glowed white again. "I'm not trying to, mom." "Why can't I read your thoughts? Why are you blocking them from me?" I asked. Lucas's eyes went back to dark green. "I don't know." He answered. I bit my lip. "You honestly scare me sometimes, Lucas." "I don't mean to. I'm justâ ¡â ¡ with knowing everything my dad has done." He closed his eyes and shook his head. He was ten but had the mind of a twenty year old. "Your dad wasâ ¡â ¡." "An asshole? I heard you and Eric talking.." "Don't ever say that word." I said. Lucas stared at me. I tried to calm myself down. "Your dad did some bad things. Butâ ¡â ¡he loved you. He would have worshipped you, Lucas. Just like I do." Lucas licked his lips and stared down below us. "I heard about some of the stuff he's done and I'm glad he's dead." "Lucas! Your dadâ ¡â ¡he loved you." I said. He shook his head. "No. No he didn't. He couldn't have if he hurt you and the rest of my family." He said. His eyes glowed back to white. "I'm going to go hunt for a little." He said. His fangs protracted out of his gums and he dropped off of the roof and his feet made a soft thud as he landed down on the ground. He quickly disappeared through the woods. Lucas was just like a grown man. But he was ten year old. A ten year old grown man who is a werewolf, vampire hybrid and also carry the Carter bloodline which is the strongest bloodline there is. In the Carter bloodline, the blood is like magic. You have strong odd powers that comes in handy often. Lucas was stronger than all of the wolf pack and he worried me sometimes because I never knew what he would do. He gets angry so easily. I climbed the tree and got back down to the ground and went into the house. I turned off all the lights and went into my bedroom where Eric was waiting. He smiled at me. "Hey." I closed the door behind me. "He knows that Todd was a bad guy." I said. Eric's eyes pulled together. "I thought we agreed we wouldn't ever bring up that name again." "I know butâ ¡he knows his dad is bad. What if he falls into his footsteps?" I said sitting on the bed. Eric shook his head. "The kid scares the shit out of me but he's a good kid. He loves us all. We don't need to worry about him." "But I do. He's a hybrid. The only one left with the Carter bloodline." "I know. I know. Come here." He pulled me into his arms and kissed my finger that held a wedding ring. "He's our son. We will love him no matter what he is." Eric whispered in my hair. I nodded and kissed him. "I love you." I whispered. "I love you too." He whispered back and held me tighter. He laid back so that I was now laying on top of his chest. He twirled a piece of my hair around with his finger. My vision became blurry as I soon drifted to sleep. Immortal Love Will Always Be Dead(werewolves pov) Created from Booksie.com Generated: 2015-05-30 03:15:39	<urn:uuid:20662df2-2cff-467c-839e-c3b9bc4b7949>	CC-MAIN-2015-22	http://www.booksie.com/fantasy/novel/icebreaker/immortal-love-will-always-be-dead(werewolves-pov)/chapter/1/nohead/pdf/ver/8	2015-05-30T07:15:40Z	s3://commoncrawl/crawl-data/CC-MAIN-2015-22/segments/1432207930895.96/warc/CC-MAIN-20150521113210-00321-ip-10-180-206-219.ec2.internal.warc.gz	351,819,282	40,798	eng_Latn	eng_Latn	0.995356	eng_Latn	0.999957	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 282, 579, 4747, 7605, 11453, 16425, 16777, 21134, 24804, 28132, 31124, 35222, 37952, 38942, 41830, 44902, 47267, 49756, 53064, 55619, 59172, 63276, 67816, 69213, 72497, 76582, 80347, 82376, 84974, 87917, 91334, 93928, 96608, 99272, 101514, 104403, 107471, 107940, 110691, 113478, 115713, 118009, 120852, 123360, 125471, 127006, 129917, 132486, 135345, 137775, 141190, 143579, 145108, 148576, 149364, 152624, 155089, 158006, 160147, 162425, 164971, 165910, 166019 ]
IMPORTANT Landing Approach: Approach is left turn! Due to the special situation of the landing site, there are some modifications of normal procedure. Please fly the turn high and reduce height by flying some eights before final approach. Forming of thermals is possible during final. Please respect the rules of precedence! © Lütscher / Zeller, Gleitschirmfliegen www.palmaclub.com Welcome to the Paragliding Spot Puerto Naos! GENERAL INFORMATION Westside: The Westside is the best-known area for flying, where international competitions are also held. It is the dryer side and often in lee. The Westside is also known for good flying conditions and thermal developments, often lasting the whole day. The situation in lee requires special attention and meteorological knowledge. NB: Wind strengths may increase rapidly resulting in dangerous conditions! It’s always a good idea to talk with the local pilots or book the ParaGuide Service. Eastside: Dominated by the CTR of La Palma, the eastside is a good alternative with calmer eastern winds, especially in the morning before the sun is heats up. Well-known take-off is at the “Pico de las Nieves”. INFORMATION AND RULES Before your first flight, please sign the guestbook in the office of Palmaclub. You will also get latest information there. Paragliding in Spain requires a valid pilot licence and insurance; it is obligatory to fly with an approved emergency parachute and wearing a helmet. Please respect traffic rules during flight and landing! The international rules are also valid here: if you have the cliff on the right, you have right of way. The special conditions at the landing site in Puerto Naos require a change of the normal approach. The circuit should be flown high, reducing by flying 8s only before turning into the final approach. Consult graph. Before launching you should check the conditions at the landing site (eg. by walkie-talkie). Pay attention to the appearance of the sea: if the waves are big or you see white crests, do not launch, or land immediately if you are already in the air. Please take care of the launch and landing sites. Some take offs are in natural protected areas. Take your rubbish away with you, even cigarette stubs! Flying from, into and over the “Caldera de Taburiente” is strictly prohibited! In the natural reserve “Cumbre Vieja”, taking off is only allowed at the official launch sites! In order to not put our activities in danger, please respect those rules! You should pack your glider on the beach side of the promenade, leaving enough room for pedestrians (4mt at least). Start Nº 1: Puerto Naos W 17,902177 N 28,586762 - 240m. W-SW. Turbulences with S and Nord wind. Parking above take off. Driving down to the take-off and top landing are not allowed. Start Nº 2: Campanarios W 17,869102 N 28,580566 Private cars must be parked at the before dirt road starts. Walk ~30 mins from there. - 800-900 m. SW-NW Alternative landing site in Charco Verde. Start Nº 3: Jecedy W 17,883048 N 28,582477 - 650m. SW. W. Rarely used and might be overgrown. Start Nº 4: El Cisne (1500-er) W 17,848952 N 28,6165694 - 1300 m. W-NW. Alternative landing site in the soccer field of San Nicolas. Before starting assure good wind conditions in Puerto Naos. Start Nº 5: Fire Tower El Time W 17,925362 N 28,691611 - 1100m. NW. No experience with south and eastern winds. Landing site at the beach of Tazacorte. Attention, strong winds may blow out of the caldera. Start Nº 6: Puntagorde W 17,830593 N 28,7524074 - 1600m. WNW. Landing aside the Helicopter landing (W -17,994432; N 28,7799857). Flight must be authorized by the mayor. Attention: minimum glide ratio of 7+ without wind. Start Nº 7: Barlovento Costa W 17,793707 N 28,836596 Temporary closed - 250m. N-O. Landing „Fajana de Barlovento“ 10m, (W -17,788627 N 28,8430799), Attention, changing winds. Minimum glide ratio of 1:3 without wind. Start Nº 8: Cumbre San Andres y Sauces W 17,834105 N 28,7512347 - 2.140m. N – NE. Attention: forming of lower clouds is already in the early morning possible. Wind direction and intensity can change between the inversion layer off with low inclination. Landing site: Puente Espinola 10m (W -17,763525 N 28,811293). Glide ratio 1:5 without wind. Start Nº 9: Puntales W 17,743956 N 28,745871 - 430m. N, NE, E. Only top-landing possible. The former communicated landing site is not available until further notice. Always happy landing! www.palmaclub.com	<urn:uuid:dfd181a2-92f7-4034-9364-a4c1f3b118ff>	CC-MAIN-2021-25	https://www.idafe.com/Flyer_english_2017.pdf	2021-06-20T15:52:28+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-25/subset=warc/part-00012-e638c5dd-3c3d-4738-8d52-dc1e9f44de3a.c000.gz.parquet	738,301,547	1,153	eng_Latn	eng_Latn	0.992342	eng_Latn	0.992708	[ "eng_Latn", "eng_Latn" ]	false	docling	[ 386, 4472 ]
\| DATE \| JANUARY \| FEBRUARY \| MARCH \| APRIL \| MAY \| JUNE \| \|------\|---------\|----------\|-------\|-------\|-----\|------\| \| \| TIME \| METRE \| TIME \| METRE \| TIME\| METRE\| \| 1 \| 0659 \| 7.95 \| 0824 \| 8.01 \| 0730\| 7.99 \| \| \| 1931 \| 8.38 \| 2046 \| 8.35 \| 1949\| 8.27 \| \| 2 \| 0746 \| 8.01 \| 0906 \| 8.04 \| 0810\| 8.11 \| \| \| 2015 \| 8.43 \| 2126 \| 8.31 \| 2027\| 8.31 \| \| 3 \| 0832 \| 8.03 \| 0948 \| 8.02 \| 0848\| 8.18 \| \| \| 2059 \| 8.42 \| 2206 \| 8.21 \| 2104\| 8.28 \| \| 4 \| 0918 \| 8.01 \| 1031 \| 7.95 \| 0925\| 8.17 \| \| \| 2142 \| 8.36 \| 2246 \| 8.05 \| 2140\| 8.18 \| \| 5 \| 1005 \| 7.95 \| 1115 \| 7.84 \| 1003\| 8.11 \| \| \| 2227 \| 8.24 \| 2329 \| 7.85 \| 2216\| 8.03 \| \| 6 \| 1055 \| 7.85 \| ------\| ------\| 1041\| 7.99 \| \| \| 2314 \| 8.08 \| 1204 \| 7.70 \| 2253\| 7.83 \| \| 7 \| 1149 \| 7.74 \| 0016 \| 7.62 \| 1122\| 7.84 \| \| \| --------\| -------- \| 1259 \| 7.56 \| 2333\| 7.62 \| \| 8 \| 0005 \| 7.89 \| 0113 \| 7.41 \| ------\| ------\| \| \| 1249 \| 7.64 \| 1407 \| 7.45 \| 1208\| 7.67 \| \| 9 \| 0104 \| 7.69 \| 0227 \| 7.26 \| 0018\| 7.41 \| \| \| 1356 \| 7.56 \| 1525 \| 7.42 \| 1304\| 7.51 \| \| 10 \| 0213 \| 7.53 \| 0350 \| 7.20 \| 0122\| 7.23 \| \| \| 1509 \| 7.55 \| 1639 \| 7.48 \| 1422\| 7.40 \| \| 11 \| 0326 \| 7.43 \| 0503 \| 7.26 \| 0257\| 7.14 \| \| \| 1618 \| 7.60 \| 1738 \| 7.61 \| 1550\| 7.41 \| \| 12 \| 0435 \| 7.42 \| 0558 \| 7.38 \| 0428\| 7.20 \| \| \| 1717 \| 7.70 \| 1824 \| 7.75 \| 1701\| 7.52 \| \| 13 \| 0532 \| 7.47 \| 0641 \| 7.52 \| 0532\| 7.35 \| \| \| 1805 \| 7.82 \| 1901 \| 7.88 \| 1752\| 7.68 \| \| 14 \| 0618 \| 7.55 \| 0716 \| 7.65 \| 0616\| 7.54 \| \| \| 1845 \| 7.92 \| 1934 \| 7.99 \| 1832\| 7.83 \| \| 15 \| 0658 \| 7.62 \| 0748 \| 7.76 \| 0653\| 7.72 \| \| \| 1921 \| 8.01 \| 2004 \| 8.07 \| 1906\| 7.97 \| \| 16 \| 0733 \| 7.69 \| 0819 \| 7.85 \| 0725\| 7.88 \| \| \| 1954 \| 8.08 \| 2033 \| 8.12 \| 1937\| 8.08 \| Contd. Page -2 \| DATE \| JANUARY \| FEBRUARY \| MARCH \| APRIL \| MAY \| JUNE \| \|------\|---------\|----------\|-------\|-------\|-----\|------\| \| \| TIME \| METRE \| TIME \| METRE \| TIME\| METRE\| \| 17 \| 0805 \| 7.75 \| 0848 \| 7.92 \| 0756\| 8.02 \| \| \| 2025 \| 8.12 \| 2101 \| 8.13 \| 2007\| 8.15 \| \| 18 \| 0836 \| 7.78 \| 0918 \| 7.95 \| 0826\| 8.12 \| \| \| 2055 \| 8.13 \| 2130 \| 8.10 \| 2037\| 8.17 \| \| 19 \| 0906 \| 7.80 \| 0948 \| 7.95 \| 0856\| 8.17 \| \| \| 2123 \| 8.12 \| 2200 \| 8.04 \| 2106\| 8.14 \| \| 20 \| 0937 \| 7.80 \| 1023 \| 7.93 \| 0928\| 8.17 \| \| \| 2152 \| 8.08 \| 2234 \| 7.93 \| 2138\| 8.07 \| \| 21 \| 1009 \| 7.78 \| 1103 \| 7.86 \| 1003\| 8.13 \| \| \| 2223 \| 8.02 \| 2314 \| 7.78 \| 2214\| 7.95 \| \| 22 \| 1045 \| 7.75 \| 1153 \| 7.75 \| 1044\| 8.03 \| \| \| 2258 \| 7.92 \| ------\| ------\| 2256\| 7.79 \| \| 23 \| 1129 \| 7.70 \| 0005 \| 7.60 \| 1134\| 7.89 \| \| \| 2341 \| 7.78 \| 1301 \| 7.63 \| 2349\| 7.60 \| \| 24 \| ------- \| -------- \| 0119 \| 7.41 \| -----\| -----\| \| \| 1226 \| 7.63 \| 1439 \| 7.56 \| 1241\| 7.73 \| \| 25 \| 0037 \| 7.63 \| 0310 \| 7.32 \| 0110\| 7.41 \| \| \| 1341 \| 7.58 \| 1615 \| 7.63 \| 1420\| 7.62 \| \| 26 \| 0155 \| 7.49 \| 0445 \| 7.41 \| 0307\| 7.35 \| \| \| 1513 \| 7.60 \| 1727 \| 7.80 \| 1558\| 7.67 \| \| 27 \| 0331 \| 7.44 \| 0553 \| 7.60 \| 0440\| 7.49 \| \| \| 1634 \| 7.72 \| 1823 \| 8.00 \| 1711\| 7.83 \| \| 28 \| 0453 \| 7.51 \| 0645 \| 7.81 \| 0544\| 7.72 \| \| \| 1740 \| 7.90 \| 1908 \| 8.16 \| 1805\| 8.01 \| \| 29 \| 0558 \| 7.64 \| \| \| 0632\| 7.95 \| \| \| 1835 \| 8.08 \| \| \| 1849\| 8.16 \| \| 30 \| 0652 \| 7.79 \| \| \| 0713\| 8.14 \| \| \| 1922 \| 8.22 \| \| \| 1928\| 8.25 \| \| 31 \| 0740 \| 7.92 \| \| \| 0750\| 8.27 \| \| \| 2005 \| 8.32 \| \| \| 2004\| 8.28 \| NOTE: 1) ALL INCOMING AND OUTGOING VESSELS WILL NEED TO REACH FAIRWAY BUOY AND HIRAN POINT RESPECTIVELY ON OR BEFORE THE TIME SHOWN ABOVE. 2) THE PERMISSIBLE DRAUGHTS FOR P P JETTIES AND OTHER JETTIES (FACTORIES) WILL BE CONSIDERED AS PER THE DECLARED DRAUGHT FROM TIME TO TIME. 3) THE DECLARED DRAUGHTS MAY BE REDUCED OR INCREASED IF SITUATION COMPELS. M WALIULLAH COMMANDER BN HARBOUR MASTER 5/12/17 \| DATE \| JANUARY \| FEBRUARY \| MARCH \| APRIL \| MAY \| JUNE \| \|------\|---------\|----------\|-------\|-------\|-----\|------\| \| \| TIME \| METRE \| TIME \| METRE \| TIME\| METRE\| \| 1 \| 0018 \| 8.65 \| 0131 \| 8.76 \| 0039\| 8.58 \| \| \| 1226 \| 8.28 \| 1346 \| 8.42 \| 1256\| 8.43 \| \| 2 \| 0101 \| 8.79 \| 0207 \| 8.81 \| 0115\| 8.74 \| \| \| 1309 \| 8.37 \| 1424 \| 8.47 \| 1331\| 8.59 \| \| 3 \| 0139 \| 8.86 \| 0242 \| 8.78 \| 0148\| 8.80 \| \| \| 1350 \| 8.40 \| 1502 \| 8.46 \| 1405\| 8.67 \| \| 4 \| 0217 \| 8.87 \| 0320 \| 8.69 \| 0221\| 8.79 \| \| \| 1432 \| 8.39 \| 1543 \| 8.38 \| 1439\| 8.67 \| \| 5 \| 0256 \| 8.81 \| 0401 \| 8.52 \| 0256\| 8.69 \| \| \| 1517 \| 8.33 \| 1628 \| 8.25 \| 1515\| 8.59 \| \| 6 \| 0338 \| 8.69 \| 0446 \| 8.28 \| 0332\| 8.54 \| \| \| 1606 \| 8.23 \| 1720 \| 8.07 \| 1555\| 8.46 \| \| 7 \| 0426 \| 8.50 \| 0539 \| 8.01 \| 0412\| 8.32 \| \| \| 1702 \| 8.10 \| 1829 \| 7.88 \| 1639\| 8.27 \| \| 8 \| 0520 \| 8.27 \| 0649 \| 7.74 \| 0455\| 8.07 \| \| \| 1809 \| 7.96 \| 1950 \| 7.75 \| 1731\| 8.05 \| \| 9 \| 0630 \| 8.02 \| 0810 \| 7.54 \| 0544\| 7.79 \| \| \| 1928 \| 7.87 \| 2104 \| 7.69 \| 1841\| 7.82 \| \| 10 \| 0751 \| 7.83 \| 0925 \| 7.44 \| 0653\| 7.52 \| \| \| 2042 \| 7.85 \| 2213 \| 7.73 \| 2006\| 7.66 \| \| 11 \| 0903 \| 7.73 \| 1035 \| 7.47 \| 0834\| 7.36 \| \| \| 2149 \| 7.91 \| 2313 \| 7.86 \| 2125\| 7.60 \| \| 12 \| 1008 \| 7.71 \| 1132 \| 7.59 \| 1000\| 7.36 \| \| \| 2249 \| 8.03 \| 2359 \| 8.02 \| 2234\| 7.69 \| \| 13 \| 1105 \| 7.75 \| ------\| ------\| 1104\| 7.53 \| \| \| 2340 \| 8.17 \| 1215 \| 7.76 \| 2326\| 7.88 \| \| 14 \| 1154 \| 7.83 \| 0036 \| 8.17 \| 1148\| 7.77 \| \| \| ------- \| ------- \| 1249 \| 7.92 \| -----\| -----\| \| 15 \| 0022 \| 8.29 \| 0106 \| 8.31 \| 0005\| 8.09 \| \| \| 1234 \| 7.92 \| 1316 \| 8.08 \| 1222\| 8.02 \| \| 16 \| 0058 \| 8.39 \| 0130 \| 8.43 \| 0035\| 8.30 \| \| \| 1307 \| 8.00 \| 1338 \| 8.21 \| 1248\| 8.26 \| \| DATE \| JANUARY \| FEBRUARY \| MARCH \| APRIL \| MAY \| JUNE \| \|------\|---------\|----------\|-------\|-------\|-----\|------\| \| \| TIME \| METRE \| TIME \| METRE \| TIME\| METRE\| \| 17 \| 0128 \| 8.45 \| 0150 \| 8.54 \| 0100\| 8.48 \| \| \| 1334 \| 8.06 \| 1358 \| 8.34 \| 1310\| 8.46 \| \| 18 \| 0152 \| 8.50 \| 0211 \| 8.63 \| 0122\| 8.62 \| \| \| 1357 \| 8.11 \| 1423 \| 8.46 \| 1332\| 8.63 \| \| 19 \| 0213 \| 8.54 \| 0238 \| 8.68 \| 0145\| 8.72 \| \| \| 1420 \| 8.17 \| 1453 \| 8.53 \| 1358\| 8.75 \| \| 20 \| 0235 \| 8.57 \| 0309 \| 8.66 \| 0212\| 8.75 \| \| \| 1446 \| 8.23 \| 1528 \| 8.53 \| 1429\| 8.79 \| \| 21 \| 0303 \| 8.60 \| 0347 \| 8.56 \| 0245\| 8.70 \| \| \| 1518 \| 8.27 \| 1611 \| 8.43 \| 1506\| 8.74 \| \| 22 \| 0335 \| 8.58 \| 0431 \| 8.35 \| 0324\| 8.57 \| \| \| 1555 \| 8.28 \| 1701 \| 8.24 \| 1549\| 8.60 \| \| 23 \| 0414 \| 8.49 \| 0524 \| 8.06 \| 0410\| 8.34 \| \| \| 1639 \| 8.23 \| 1804 \| 7.98 \| 1640\| 8.36 \| \| 24 \| 0459 \| 8.32 \| 0631 \| 7.74 \| 0503\| 8.04 \| \| \| 1731 \| 8.10 \| 1942 \| 7.77 \| 1744\| 8.08 \| \| 25 \| 0554 \| 8.08 \| 0817 \| 7.52 \| 0613\| 7.71 \| \| \| 1837 \| 7.94 \| 2147 \| 7.82 \| 1928\| 7.84 \| \| 26 \| 0705 \| 7.82 \| 1017 \| 7.60 \| 0828\| 7.55 \| \| \| 2015 \| 7.83 \| 2304 \| 8.06 \| 2128\| 7.87 \| \| 27 \| 0841 \| 7.66 \| 1128 \| 7.88 \| 1012\| 7.73 \| \| \| 2204 \| 7.94 \| 2357 \| 8.35 \| 2243\| 8.10 \| \| 28 \| 1021 \| 7.70 \| ------\| ------\| 1115\| 8.06 \| \| \| 2318 \| 8.17 \| 1217 \| 8.18 \| 2336\| 8.37 \| \| 29 \| 1133 \| 7.89 \| ------\| ------\| 1200\| 8.38 \| \| \| ------- \| -------- \| ------\| ------\| 1250\| 8.93 \| \| 30 \| 0011 \| 8.43 \| ------\| ------\| 0018\| 8.59 \| \| \| 1225 \| 8.11 \| ------\| ------\| 1237\| 8.63 \| \| 31 \| 0054 \| 8.63 \| ------\| ------\| 0053\| 8.73 \| \| \| 1308 \| 8.30 \| ------\| ------\| 1310\| 8.79 \| NOTE: 1) THE DECLARED DRAUGHTS MAY BE REDUCED OR INCREASED IF SITUATION COMPELS. M WALIULLAH COMMANDER BN HARBOUR MASTER 5/12/17	<urn:uuid:a1e56808-d6db-44df-b9cb-a0309865dbae>	CC-MAIN-2018-09	http://mpa.portal.gov.bd/sites/default/files/files/mpa.portal.gov.bd/page/4431b16c_e0c9_4ed7_9276_d9d9fce99fc4/Anticipited%20permissible%20drughts.pdf	2018-02-21T06:49:49Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891813571.24/warc/CC-MAIN-20180221063956-20180221083956-00265.warc.gz	257,631,111	4,622	eng_Latn	eng_Latn	0.500814	eng_Latn	0.52074	[ "unknown", "eng_Latn", "unknown", "eng_Latn" ]	true	docling	[ 2083, 4441, 6508, 8593 ]
The Accidental Intentional Healthcare Tax Expenditure By Jeremy Scott — [email protected] Tax expenditures are under siege. If the more extreme rhetoric is to be believed, any and all tax benefits are on the chopping block to pay for a package that averts the fiscal cliff. Republicans are willing to raise $800 billion through some kind of deduction cap or other loophole closers. President Obama, of course, wants to raise rates just on the rich. Frantic lobbying is probably underway to save the deductions for home mortgage interest, charitable giving, and state and local income taxes. But the nation's largest tax expenditure seems relatively safe. The exclusion for employer-provided healthcare insurance would not be affected by either a rise in tax rates (favored by Democrats) or by any kind of deduction cap (favored by Republicans). After being discussed extensively in 2009 during the healthcare reform negotiations, employer-provided healthcare seems in little danger. That's disappointing to many economists, who have argued that the exclusion is inflationary, distorts the healthcare market, and is an accidental product of World War II wage controls. Joseph Thorndike disagrees with the latter assertion, pointing out the difference between a policy being an accident and simply having unintended consequences. He explores the history of the exclusion from its roots as a way around price controls to its place as a major benefit to union workers. While the exclusion might be inefficient, its central place in U.S. healthcare policy is no accident, he writes. Congress deliberately overruled the IRS and put the exclusion in the 1954 code, he points out. (For his article, see p. 1141.) One of the major problems with the GOP's deduction cap is that it wouldn't deal with the exclusion, writes Martin Sullivan. The exclusion is the largest tax expenditure, but it would not be affected by a deduction cap. That means that any deduction cap would be distortionary, favoring some tax benefits over others, he argues. He points out five major problems with a deduction cap and concludes that it would eventually turn into another alternative minimum tax. Because the various cap proposals would not be indexed to inflation, ® tax notes over time the cap would affect more and more taxpayers at lower income levels. That means Congress would ultimately be faced with having to patch the deduction cap, much like it must pass an AMT bill every year, Sullivan says. (For his analysis, see p. 1139.) Commentary All of Washington agrees that the U.S. corporate rate is too high. Everyone from the president to the chair of the Ways and Means Committee wants to lower the rate. The only question is how far (most reform plans target 25 percent) and how to pay for it. The latter is such an important point, however, that few actually expect a corporate rate reduction to happen soon. Robert Pozen and Lucas Goodman propose paying for a corporate rate reduction by limiting the deductibility of interest payments (p. 1207). That kind of change could pay for a reduction to 25 percent and would help to change the tax code's bias toward debt over equity financing, they write. Their plan would limit the deduction to 65 percent of a company's interest expense. They conclude that Congress will be hard-pressed to find a better option to fund a cut in the corporate rate. For some policymakers, just a cut in the corporate rate is insufficient — they would like to see wholesale reform of corporate and business taxes. Rep. Devin Nunes, R-Calif., has built on the socalled X-tax to propose the American Business Competitiveness Act, which would replace the corporate tax with a ''non-value-added consumption tax.'' George White looks at how the act would function and delves into the history of taxation (p. 1237). Nunes's proposed reform might create problems in the depreciation area, as well as with taxpayers using the accrual method, according to White. The Second Circuit recently affirmed the Tax Court's decision in Union Carbide, an important case for taxpayers analyzing research credit claims under section 41. Although the Tax Court disallowed Dow's claims, its analysis, which the circuit court affirmed, is very taxpayer friendly, according to John Dies, Jeremy Fingeret, and Scott Weese (p. 1225). Union Carbide provides a clear definition of the term ''uncertainty'' and discards the discovery tests standard, the authors write. The court's holding on the business component test is also protaxpayer, they find. They conclude that Dow's loss was a huge gain for taxpayers and that the appellate WEEK IN REVIEW holding reinforces that if a taxpayer can demonstrate that supplies were used and consumed in direct connection with a qualified business component, those supplies can be deducted even if they weren't initially purchased for a research-related purpose. The Supreme Court will soon hear arguments in PPL Corp., a key case that might provide a definition for an income tax, at least in the context of a British tax on windfall utility profits. The case has been subjected to considerable attention. Most analysis, however, has focused on substance over form, which is an incorrect characterization of the issue, writes Jacob Goldin (p. 1229). That glosses over the question whether the tax is actually an income tax, he says. Because the British tax is levied on average profits instead of total profits, it is very different from the conventional definition of an income tax, Goldin argues. He finds that the tax is not really an income tax at all and that its use of average profits is a significant distinction. That isn't surprising, given that the tax raises only $11 billion, writes Jeffrey Pennell (p. 1232). He discusses several possible futures for the estate tax, including that Democrats might be willing to consider repealing the tax in exchange for higher tax rates on wealthy taxpayers. If Congress does consider repealing the tax, it should implement zerobasis transfers, instead of carryover basis, Pennell writes. Under his proposal, any property that transfers at death would have a zero basis instead of its basis in the hands of the decedent. That would be a change from the rules that existed during the tax's one-year hiatus, but it is a more favorable alternative, he writes. The estate tax has become an overlooked aspect of the fiscal cliff discussions. That wasn't true in 2010, when Congress agreed to reinstate the tax with a much more generous exemption and lower rate than existed before the tax's brief expiration. During the 2010 negotiations, Obama's willingness to accept the GOP's demands on the estate tax caused some consternation among progressive economists and lawmakers. But during the latest debate over the extension of the 2001 and 2003 tax cuts, the estate tax has gone almost unmentioned. In a special report discussing F reorganizations, Jasper Cummings, Jr., argues that in attempting to defeat the liquidation-reincorporation tax shelters, the IRS has essentially repurposed F reorganizations into E reorganizations (p. 1193). Cummings analyzes how the repurposing of F reorganizations has harmed tax administration and discusses the probable fate of the 2004 proposed regulations. He argues that the new doctrine of F reorganizations creates too much electability for taxpayers. The taxation of income from Native American gambling creates numerous issues for practitioners and taxpayers. Robert Wood looks at how the IRS is dealing with the expansion of gambling income and how the Service treats Native Americans (p. 1241). He concludes that Native American tax questions are likely to consume much more of the IRS's resources. © Tax Analysts 2012. All rights reserved. Users are permitted to reproduce small portions of this work for purposes of criticism, comment, news reporting, teaching, scholarship, and research only. Any use of these materials shall contain this copyright notice. We provide our publications for informational purposes, and not as legal advice. Although we believe that our information is accurate, each user must exercise professional judgment, or involve a professional to provide such judgment, when using these materials and assumes the responsibility and risk of use. As an objective, nonpartisan publisher of tax information, analysis, and commentary, we use both our own and outside authors, and the views of such writers do not necessarily reﬂect our opinion on various topics.	<urn:uuid:5e47ce13-c32e-413b-b2c9-e89d01a41d83>	CC-MAIN-2018-26	http://woodllp.com/Media/Press/pdf/The_Accidental.pdf	2018-06-22T05:21:54Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267864354.27/warc/CC-MAIN-20180622045658-20180622065658-00266.warc.gz	366,076,340	1,698	eng_Latn	eng_Latn	0.999168	eng_Latn	0.999182	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 4623, 8507 ]
Why Did The Crisis of 2008 Happen? Nassim Nicholas Taleb DRAFT 3rd Version, October 2010 This paper —while a standalone invited essay for New Political Economy — synthesizes the various technical documents by the author as related to the financial crisis. It can also be used as a technical companion to The Black Swan. Summary of Causes: The interplay of the following five forces, all linked to the misperception, misunderstanding, and hiding of the risks of consequential low probability events (Black Swans). I-CAUSES 2) Asymmetric and flawed incentives that favor risk hiding in the tails, two flaws in the compensation methods, based on cosmetic earnings not truly risk-adjusted ones a) asymmetric payoff: upside, never downside (free option); b) flawed frequency: annual compensation for risks that blow-up every few years, with absence of claw-back provisions. 1) Increase in hidden risks of low probability events (tail risks) across all aspects of economic life, not just banking; while tail risks are not possible to price, neither mathematically nor empirically. The same nonlinearity came from the increase in debt, operational leverage, and the use of complex derivatives. a- This author has shown that it is impossible to measure the risks in the tails of the distribution i . The errors swell in proportion to the remoteness of the event. Small variations in input, smaller than any uncertainty we have in the estimation of parameters, assuming generously one has the right model, can underestimate the probability of events called of "12 sigma" (that is, 12 standard deviations) by close to a trillion times —a fact that has been (so far) strangely ignored by the finance and economics establishment. b- Exposures have been built in the "Fourth Quadrant" ii , where errors are both consequential and impossible to price and vulnerability to these errors is large. c- Fragility in the Fourth Quadrant can be reexpressed as concavity to errors, where losses from uncertain events vastly exceed possible profits from it, the equivalent of "short volatility". These exposures have been increasing geometrically. © Copyright 2010 by N. N. Taleb. a- Misunderstanding of elementary notion of probabilistic payoffs across economic life. The general public fails to notice that a manager "paid on profits" is not really "paid on profits" in the way it is presented and not compensated in the same way as the owner of a business given the absence of negative payment on losses (the fooled by randomness argument). States of the world in which there can be failure are ignored —"probabilistic blindness". This asymmetry is called the "manager option", or the "free option", as it behaves exactly like a call option on the company granted by the shareholders, for free or close to little compensation. Thanks to the bailout of 2008-2009 (TARP), banks used public funds to generate profits, and compensated themselves generously in the process, yet managed to convince the public and government that this compensation was justified since they brought profits to the public purse—hiding the fact that the public would have been the sole payer in the event of losses. b- Mismatch of bonus frequency. Less misunderstood by policymakers, a manager paid on an annual frequency does not have an incentive to maximize profits; his incentive is to extend the time to losses so he can accumulate bonuses before eventual "blowup" for which he does not have to repay previous compensation. This provides the incentive to make a series of asymmetric bets (high probability of small profits, small probability of large losses) below their probabilistic fair value iii . c- The agency problem is far more vicious in the tails, as it can explain the growing leftskewness (fragility) of corporations as they get larger (left-skewness is shown in Zeckhauser & Patel, 1999, rediscussed in argument on convexity). 3) Increased promotion of methods helping to hide tail risks. VaR and similar methods promoted tail risks. See my argument that information has harmful side effects as it does increase overconfidence and risk taking. a- I said that knowledge degrades very quickly in the tails of the distributions, making tail risks non-measurable (or, rather, impossible to estimate —"measure" conveys the wrong impression). Yet vendors have been promoting method of risk management called "Value at Risk", VaR, that just measures the risks in the tail! it is supposed to project the expected extreme loss in an institution's portfolio that can occur over a specific time frame at a specified level of confidence (Jorion,1997). Example: a standard daily VaR of $1 million at a 1% probability tells you that you have less than a 1% chance of losing $1 million or more on a given day. There are many modifications around VaR, "conditional VaR" 1 , equally exposed to errors in the tails. Although such definition of VaR is often presented as a "maximum" loss, it is technically not so in an open-ended exposure: since, conditional on losing more than $1 million, you may lose a lot more, say $5 million. So simply, VaR encourages risk-taking in the tails and the appearance of "low volatility". Note here that regulators made banks shift from hard heuristics (robust to model error) to such "scientific" measurements 2 . 1 Data shows that methods meant to improve the standard VaR, like "expected shortfall" or "conditional VaR" are equally defective with economic variables --past losses do not predict future losses. Stress testing is also suspicious because of the subjective nature of "reasonable stress" number --we tend to underestimate the magnitude of outliers. "Jumps" are not predictable from past jumps. 2 Joe Nocera, NYT, January 4, 2009, "In the late 1990s, as the use of derivatives was exploding, the Securities and Exchange Commission ruled that firms had to include a quantitative disclosure of market risks in their financial statements for the convenience of investors, and VaR became the main tool for doing so. Around the same time, an © Copyright 2010 by N. N. Taleb. Criticism has been countered with the argument that "we have nothing better"; ignoring of iatrogenic effects and mere phronetic common sense. b- Iatrogenics of measuments (harm done by the healer): these estimations presented as "measures" are known to increase risk taking. Numerous experiments provide evidence that professionals are significantly influenced by numbers that they know to be irrelevant to their decision, like writing down the last 4 digits of one's social security number before making a numerical estimate of potential market moves. German judges rolling dice before sentencing showed an increase of 50% in the length of the sentence when the dice show a high number, without being conscious of it. 3 c- Linguistic conflation: Calling these risk estimation "measures" create confusion in the mind of people, making them think that something in current existence (not yet to exist in the future) is being measured —these metrics are never presented as mere predictions with an abnormally huge error (as we saw, several orders of magnitude). 4) Increased role of tail events in economic life thanks to "complexification" by the internet and globalization, in addition to optimization of the systems. a- The logic of winner take all effects: The Black Swan provides a review of "fat tail effects" coming from the organization of systems; consider the island effect, how a continent will have more acute concentration effects as species concentration drop in larger areas. The increase in "winner-take-all" effects is evident across economic variables (which includes blowups). b- Optimization makes systems left-slewed, more prone to extreme losses —which can be seen in concavity effects under the perturbation of parameters. 5) Growing misunderstanding of tail risks Ironically while tail risks have increased, financial and economic theories that discount tail risks have been more vigorously promoted (while operators important international rule-making body, the Basel Committee on Banking Supervision, went even further to validate VaR by saying that firms and banks could rely on their own internal VaR calculations to set their capital requirements." 3 See English and Mussweiler, English Mussweiler and Strack, 20o6, LeBoeuf and Shafir, 2006. understood risks heuristically in the past 4 ), particularly after the crash of 1987, after the "Nobel" for makers of "portfolio theory". Note the outrageous fact that the entire economics establishment missed the rise in these risks, without incurring subsequent problems in credibility. Principal errors by the economics establishment that contribute to increasing fragility: a- Ignorance of "true" fat tail effects; or misunderstanding that fat tails lead to massive imprecision in the measurement of low probability events (such as the use of Poisson jumps by Merton, 1976 or the more general versions of subordinated processes —these models fit the past with precision on paper but are impossible to calibrate in practice and induce a false sense of confidence). Misunderstanding that true-fat-tails cancels the core of financial theory and econometric methods used in practice. b- Lack of awareness of the effect of parameter estimation on a model. Some models —actually almost all models — take parameters for granted when the process of parameter discovery in real-life leads to massive degradation of their results owing to convexity effects from such layer of uncertainty. c- Interpolation v/s Extrapolation. Misunderstanding of the "atypicality of events" —looking for past disturbances for guidance when we have obvious evidence of lack of precedence of such events. For instance, Rogoff and Reinhart (2010) look at past data without realizing that in fat tailed domains, one should extrapolate some properties from history, instead of interpolating or looking for naive similarities (see the metaphor of Lucretius's largest mountain in Taleb(20072010)). d- Optimization. It can be shown that optimization causes fragility when the payoff is concave under perturbation errors, i.e., in most cases. e- Economies of scale. There are fragilities coming from size, both for the institutions and causing externalities iv . 4 The key problem with finance theory has been supplanting embedded and time-derived heuristics, such as the interdicts against debt and forecasting, with models akin to "replacing a real hand with an artificial one". © Copyright 2010 by N. N. Taleb. II-RESPONSIBLE PARTIES 1) Government Officials of Both Administrations promoting blindness to tail risks and nonlinearities (e.g. Bernanke's pronouncement of "great moderation") and flawed tools in the hands of policymakers not making the distinction between different classes of randomness. 2) Bankers/Company executives: The individuals had an incentive to hide tail risks as a safe strategy to collect bonuses. 3) Risk vendors and professional associations: CFA, IAFE promotion of portfolio theory and Value-atrisk methods. 4) Business schools and the economics establishment: They kept promoting and teaching portfolio theory and inadequate risk measurement methods on grounds that "we need to give students something" (arguments used by medieval medicine) 5 . They still do 6 . 5) Regulators: Promoted quantitative risk methods (VaR) over heuristics, use of flawed risk metrics (AAA), and encouraged a certain class of risk taking. 6) Bank of Sweden Prize, a.k.a. "Nobel" in Economics: gave the Nobel stamp to empirically, mathematically, and scientifically invalid theories, such as portfolio theory (Markowitz and Sharpe), option pricing (Scholes and Merton), Engle's GARCH, Modigliani-Miller and many more. In general their scientific invalidity comes from the use of wrong models of uncertainty that provide exactly the opposite results to what an empirically and mathematically more rigorous model of uncertainty would do. Ethical considerations. Surprisingly the economics establishment should have been aware of the use the wrong tools and complete fiasco in the theories, but they kept pushing the warnings under the rug, or hiding their responses. There has been some diffusion of responsibility that is at the core of the system. This author has debated: Robert Engle, Myron Scholes, Robert Merton, and Stephen Ross, among others, without any hint of their willing to accept the very 5 It would be rare to find an airplane pilot who would accept using the map of Saudi Arabia when flying over the Himalayas on ground that "there is nothing else" – human intuitions know better. Yet once framed in financial terms, the reasoning reverses. 6 In early 2009 a Forbes journalist in the process of writing my profile spoke to NYU's Robert Engle who got the Bank of Sweden Prize ("Nobel") for methods that patently have never worked outside papers. He reported to me that Engle , since it is the government job to cover the losses beyond a certain point. This is the worst moral hazard argument that response was that academia was not responsible for tail risks played into the hands of the Too Big to Fail problem. notion of the risks they were creating with their Procrustean bed methods of approximation —prompting the following metaphor by this author: "they are cutting part of someone's brain and claiming that we have a human with 95% accuracy". The seemingly favorable reactions this author encountered were even more harmful, with the discrediting half-way "you may have a point but you go too far" that can be vastly more damaging to society that just regular attacks. III- SUGGESTED REMEDY: SYMMETRY IN REWARDS As we saw with banks, Toyota's problem, the BP oil spill, and other similar cases of blowups from underinsured small risks, an economic system with a severe agency problem builds a natural tendency to push and hide risks in the tails, even without help from the economics establishment. Risks keep growing where they can be seen the least; there is a need to break the moral hazard by making everyone accountable both chronologically and statistically. Hence the principle of symmetry in rewards: The captain goes down with the ship; all captains and all ships: making everyone involved in riskbearing accountable, no exception, not a single one — morally, legally, whatever can be done. That includes the "Nobel" committee (Bank of Sweden), the academic establishment, the rating agencies, forecasters, bank managers, etc 7 . Time to realize that capitalism is not about free options 8 . Note that organizations such as the CFA and the American Finance Association, vendors such as RiskMetrics, and finance departments in business schools, those that promoted tools that blew up society do not seem concerned at all into changing their methods or accepting their role. And they are currently, at the time of writing, still in the process of blowing up society. 7 Conversations of the author with the King of Sweden and members of the Swedish Academy resulted in the following astonishing observation: they do feel concerned, nor act as if they are in any way responsible for the destruction since, for them, "this is not the Nobel", just a bank of Sweden price. 8 Speculators using their own funds have been reviled, but unlike professors, New York Times journalists, and others, they (particularly those without the free option of society's bailout) bear directly the costs of their mistakes. © Copyright 2010 by N. N. Taleb. WHAT SHOULD WE DO? Preaching is not effective in the background of such natural resistance and absence of accountability. Legal recourse is needed — as illustrated by the long fight against the tobacco industry, which was "won" by lawsuits, not by scientific argument. Academia can be shielded from direct liability — academics can claim to be the generator of speculative thought; it would be hard to, say, make postmodern theorists accountable for their ideas on health and medicine. So it is those helping translate their ideas into practice who need to be made accountable: a theoretical biologist does not bear the same responsibility for harm as, say, the American Medical Association or a private doctor. The two parties that need to be brought to account: 1) those associations and vendors that put these techniques into the hands of practitioners, and, most of all, 2) the Bank of Sweden prize that gave (and still gives) the "Nobel Stamp" to these techniques. For the "Nobel" stamp gave these methods the credibility to spread and displace time-tested heuristics. REFERENCES Birte Englich and Thomas Mussweiler,2001, "Sentencing under Uncertainty: Anchoring Effects in the Courtroom," Journal of Applied Social Psychology, vol. 31, no. 7 92001), pp. 1535-1551 Birte Englich, Thomas Mussweiler, and Fritz Strack, 2006, "Playing Dice with Criminal Sentences: the Influence of Irrelevant Anchors on Experts' Judicial Decision Making," Personality and Social Psychology Bulletin, vol. 32, no 2 (Feb. 2006), pp. 188-200. Degeorge, François, Jayendu Patel, and Richard Zeckhauser, 1999, "Earnings Management to Exceed Thresholds." Journal of Business 72(1): 1–33. Derman, E. and Taleb, N.N. (2005) The Illusion of Dynamic Replication, Quantitative Finance, vol. 5, 4 Haug, E.G. and Taleb, N.N. ,2010, Option Traders Use Sophisticated Heuristics, Never the Black-ScholesMerton Equation, forthcoming, Journal of Economic Behavior and Organizations. Le Boeuf. R.A., and Shafir E. The Long and Short of It: Physical Anchoring Effects. J. Behav. Dec. Making, 19: 393–406 (2006) Makridakis, S., & Taleb, N., 2009, "Decision making and planning under low levels of predictability", International Journal of Forecasting Merton R. C. (1976). Option pricing when underlying stock returns are discontinuous. Journal of Financial Economics, 3, 125–144. Merton, R. C. (1992). Continuous-time finance (revised edition). Blackwell. Mussweiler, T., & Strack, F. (2000). Numeric judgments under uncertainty: The role of knowledge in anchoring. Journal of Experimental Social Psychology, 39, 495-518. Rogoff, K. and Reinhart C. 2010, This Time is Different, Eight Centuries of Financial Folly, Princeton University Press. Taleb N.N.and Pilpel, A. (2007)Epistemology and Risk Management, "Risk and Regulation", 13, Summer 2007 Taleb, N.N. (1997). Dynamic Hedging: Managing Vanilla and Exotic Options. New York: John Wiley & Sons. ISBN 0-471-15280-3. Taleb, N. N. (2004) "I problemi epistemologici del risk management " in: Daniele Pace (a cura di) "Economia del rischio. Antologia di scritti su rischio e decisione economica", Giuffrè, Milano Taleb, N. N. (2004) "On Skewness in Investment Choices." Greenwich Rountable Quarterly 2. Taleb, N. N. (2004) "Roots of Unfairness." Literary Research/Recherche littéraire. 21(41-42): 241-254.[57] Taleb, N. N. (2004) "These Extreme Exceptions of Commodity Derivatives." in Helyette German, Commodities and Commodity Derivatives. New York: Wiley. Taleb, N. N. (2004) Bleed or Blowup: What Does Empirical Psychology Tell Us About the Preference For Negative Skewness? , Journal of Behavioral Finance, 5 Taleb, N. N. (2005) "Fat Tails, Asymmetric Knowledge, and Decision making: Essay in Honor of Benoit Mandelbrot's 80th Birthday." Technical paper series, Willmott (March): 56-59. Taleb, N. N. (2008) Infinite Variance and the Problems of Practice, Complexity, 14(2). Taleb, N., and Tapiero, C. Too Big to Fail and the Fallacy of Large Institutions (forthcoming) Taleb, N., and Tapiero, C.,2010, The Risk Externalities of Too Big to Fail in press,Physica A Taleb, N.N. (2007) "Black Swan and Domains of Statistics", The American Statistician, August 2007, Vol. 61, No. 3 Taleb, N.N. (2009), Errors, Robustness, and the Fourth Quadrant, International Journal of Forecasting © Copyright 2010 by N. N. Taleb. i Taleb 2007a, Taleb and Pilpel, 2007, 2007/2010, 2009, 2010a,2010b ii Taleb, 2009 iii Taleb 2004, Taleb and Martin, 2007 iv Taleb (2010), Taleb and Tapiero(2010)	<urn:uuid:17ef3ef3-be35-47d2-843b-63923c3051c0>	CC-MAIN-2021-04	https://www.fooledbyrandomness.com/crisis.pdf	2021-01-22T11:34:55+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-04/subset=warc/part-00187-364a895c-5e5c-46bb-846e-75ec7de82b3b.c000.gz.parquet	776,626,731	4,503	eng_Latn	eng_Latn	0.869274	eng_Latn	0.993861	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3527, 8368, 13189, 17623, 20066 ]
Advite MONITOR Terms of Service These Terms of Service (the "Agreement") by and between Advite, Inc. and all its affiliates (together, "Company", "us", "we", and "our") and you, the individual or entity ("you", "your", and "User") governs your use of our website application, accessible at app.advite.ai, and all pages, templates, products, tools, information, protocols, software, and content located therein (the "Service"). PLEASE READ THIS AGREEMENT CAREFULLY. By using the Service, you agree to be bound by this Agreement. You must read, agree with and accept all of the terms and conditions contained or expressly referred to in this Agreement, before you may sign up or use the Service. You are advised to revisit the Agreement, and all its components, periodically to familiarize yourself with any changes to the terms and conditions therein. Communications By creating an Account (as defined below) on our Service, you agree to subscribe to newsletters, marketing or promotional materials and other information we may send. However, you may opt out of receiving any, or all, of these communications from us by following the unsubscribe link or by emailing at [email protected]. Purchases Standard Agreement If you wish to purchase any product or service made available through the Service ("Purchase"), you may be asked to supply certain information relevant to your Purchase including, without limitation, your credit card number, the expiration date of your credit card, your billing address, and your shipping information. You represent and warrant that: (i) you have the legal right to use any credit card(s) or other payment method(s) in connection with any Purchase; and that (ii) the information you supply to us is true, correct and complete. We may employ the use of third-party services for the purpose of facilitating payment and the completion of Purchases. By submitting your information, you grant us the right to provide the information to these third parties subject to our Privacy Policy. Fees Subscription Fees Some parts of the Service may be billed on a subscription basis ("Subscription(s)"), for which you may be obligated to pay a fee ("Subscription Fee(s)"). You will be billed the applicable Subscription Fee in advance on a recurring and periodic basis ("Billing Cycle"). Billing Cycles are set on a monthly basis, depending on the type of plan, and the corresponding Subscription Fee, you select when purchasing the corresponding part of the Service. You acknowledge that all of the required information and details regarding your Subscription and specifically the Subscription Fee were received and reviewed by you through our website, https://advite.ai. At the end of each Billing Cycle, your Subscription will automatically renew under the exact same conditions unless you cancel it or we cancel it. You may cancel your Subscription renewal either through your online account management page or by contacting our customer support team at [email protected]. Payment Method for Subscription Fees A valid payment method, including credit card, debit card, or PayPal, is required to process all fees mentioned herein unless otherwise permitted by the Company. You shall provide us with accurate and complete billing information including, as applicable, full name, address, state, zip code, telephone number, and valid payment method information. By submitting such payment information, you automatically authorize us to charge all fees outlined in this section incurred through your account to any such payment instruments. Should automatic billing fail to occur for any reason, we will issue an electronic invoice indicating that you must proceed manually, within a certain deadline date, with the full payment corresponding to the billing period as indicated on the invoice. Fee Changes We, in our sole discretion and at any time, may modify any of the fees mentioned herein (including but not limited to Subscription Fees) (any of which being a "Fee Change"). Any Fee Change will become effective at the end of the then-current Billing Cycle. We will provide you with a reasonable prior notice of any Fee Change to give you an opportunity to terminate your usage before such Fee Change becomes effective. Your continued use of the Service after a Fee Change comes into effect constitutes your agreement to pay the modified fee amount. Refunds Except when required by law, all fees mentioned herein are non-refundable. Unspent credit under $1,000 CAD can be refunded by issuing a request to [email protected] for cancellations made mid-billing cycle. Intellectual Property Company Content Any proprietary and intellectual property rights in and to the Services, including any content thereon, such as logos, videos, text, information, graphics, icons, images, as well as the selection, assembly and arrangement thereof and related materials, Company's trademarks, trade names, copyrightable materials, designs, "look and feel," all whether or not registered and/or capable of being registered ("Content"), are the property of Company and/or its licensors and are subject to copyright and other intellectual property rights under applicable laws. You acknowledge and agree that you have no right, license, or authorization with respect to the Services or any of the technology underlying the Services except as expressly set forth in this Agreement. Nothing in this Agreement gives you the right to use Content without the Company's prior written consent. If, through the intended use of the Services, at the sole and absolute discretion of the Company, you download or otherwise receive access to Content you acknowledge and agree that your use of the Content shall be in accordance with this Agreement and the applicable terms of use or user agreement of the licensor of the Company. Please familiarize yourself regularly with the terms of use or user agreements with the relevant licensors of the Company. Below is a non-exhaustive list of terms of use or user agreements of the relevant licensors of the Company: * https://www.reddit.com/r/reddit.com/wiki/api-terms/ * https://developer.x.com/en/developer-terms/agreement-and-policy * https://www.connectively.us/wp-content/uploads/2023/10/Connectively-Agreement-2023. 04.25.pdf Additionally, you agree and acknowledge that, in the event that you are required by this Agreement or any terms of use or user agreement of any relevant licensor of the Company, you shall abide by any attribution rights that may exist. You may not and you shall not permit any person, and/or any third party to: (a) modify, translate, reverse engineer, decompile, disassemble, or create derivative works based on the Services or Content except to the extent that enforcement is prohibited by applicable law notwithstanding a contractual provision to the contrary; (b) circumvent any user limits or other timing or use restrictions that are built into the Services; (c) remove any Content or other proprietary notices, labels, or marks from the Services; (d) frame or mirror any content forming part of the Services; or (e) access the Services in order to (i) build a competitive product or service or (ii) copy any ideas, features, functions or graphics of the Services. User Content Our Service may allow you to post, link, store, share and otherwise make available certain information, data, numbers, text, graphics, videos, or other material ("User Content"). You are responsible for User Content that you post on or through Service, including its legality, reliability, and appropriateness. By posting User Content on or through the Service, You represent and warrant that: (i) the User Content is yours (you own it) and/or you have the right to use it and the right to grant us the rights and license as provided in this Agreement, and (ii) that the posting of User Content on or through Service does not violate the privacy rights, publicity rights, copyrights, contract rights or any other rights of any person or entity. We reserve the right to terminate the account of anyone found to be infringing on a copyright. You retain any and all of your rights to any User Content you submit, post or display on or through Service and you are responsible for protecting those rights. We take no responsibility and assume no liability for User Content you or any third party posts on or through Service. However, by posting User Content and using the Service you grant us the right and license to use, modify, publicly perform, publicly display, reproduce, and distribute such User Content and the user behavior, transactions, interactions, habits, usage, and any other information that we may collect from time to time on and through Service (together with User Content, "User Data"), provided that it is reasonably anonymized at our sole and absolute discretion. For clarity, you acknowledge that the Company shall be permitted to use User Data for the purpose of training, improving, developing, and/or testing, in whole or in part, machine learning models, neural networks, generative models, predictive models, artificial intelligence algorithms, large-language model (each and together, an "AI Model"), and/or any prompts or instructions provided to any such AI Model, whether such AI Model is or has been developed by the Company or any third party, to improve or enhance the quality of the Services, or otherwise at our sole and absolute discretion. We have the right but not the obligation to monitor and edit all User Content provided by users. Prohibited Uses You may use Service only for lawful purposes and in accordance with the Agreement. You agree not to use the Service: * In any way that violates any applicable national or international law or regulation. * For the purpose of exploiting, harming, or attempting to exploit or harm minors in any way by exposing them to inappropriate content or otherwise. * To transmit, or procure the sending of, any advertising or promotional material, including any "junk mail", "chain letter," "spam," or any other similar solicitation. * To impersonate or attempt to impersonate us, our employee(s), another user, or any other person or entity. * In any way that infringes upon the rights of others, or in any way is illegal, threatening, fraudulent, or harmful, or in connection with any unlawful, illegal, fraudulent, or harmful purpose or activity. * To engage in any other conduct that restricts or inhibits anyone's use or enjoyment of Service, or which, as determined by us, may harm or offend us or users of the Service or expose them to liability. Additionally, you agree not to: * Use the Service in any manner that could disable, overburden, damage, or impair the Service or interfere with any other party's use of the Service, including their ability to engage in real time activities through Service. * Use any robot, spider, or other automatic device, process, or means to access the Service for any purpose, including monitoring or copying any of the material on the Service. * Use any manual process to monitor or copy any of the material on the Service or for any other unauthorized purpose without our prior written consent. * Use any device, software, or routine that interferes with the proper working of Service. * Introduce any viruses, trojan horses, worms, logic bombs, or other material which is malicious or technologically harmful. * Attempt to gain unauthorized access to, interfere with, damage, or disrupt any parts of the Service, the server on which the Service is stored, or any server, computer, or database connected to the Service. * Attack the Service via a denial-of-service attack or a distributed denial-of-service attack. * Take any action that may damage or falsify our rating. * * Otherwise attempt to interfere with the proper working of the Service. Analytics We monitor and analyze the use of our Service using third-party providers. Accounts When you create an account with us, you guarantee that you are above the age of 18, and that the information you provide us is accurate, complete, and current at all times. Inaccurate, incomplete, or obsolete information may result in the immediate termination of your account on the Service. You are responsible for maintaining the confidentiality of your account and password, including but not limited to the restriction of access to your computer and/or account. You agree to accept responsibility for any and all activities or actions that occur under your account and/or password, whether your password is with our Service or a third-party service. You must notify us immediately upon becoming aware of any breach of security or unauthorized use of your account. You may not use as a username the name of another person or entity or that is not lawfully available for use, a name or trademark that is subject to any rights of another person or entity other than you, without appropriate authorization. You may not use as a username any name that is offensive, vulgar or obscene. We reserve the right to refuse service, terminate accounts, remove or edit content, or cancel orders in our sole and absolute discretion. Error Reporting and Feedback You may provide us directly at [email protected] with information and feedback concerning errors, suggestions for improvements, ideas, problems, complaints, and other matters related to our Service ("Feedback"). You acknowledge and agree that: (i) you shall not retain, acquire or assert any intellectual property right or other right, title or interest in or to the Feedback; (ii) Company may have development ideas similar to the Feedback; (iii) Feedback does not contain confidential information or proprietary information from you or any third party; and (iv) Company is not under any obligation of confidentiality with respect to the Feedback. In the event the transfer of the ownership to the Feedback is not possible due to applicable mandatory laws, you grant Company and its affiliates an exclusive, transferable, irrevocable, free-of-charge, sub-licensable, unlimited and perpetual right to use (including copy, modify, create derivative works, publish, distribute and commercialize) Feedback in any manner and for any purpose. Links To Other Websites Our Service may contain links to third-party websites or services that are not owned or controlled by us. We have no control over, and assume no responsibility for the Content, privacy policies, or practices of any third party websites or services. We do not warrant the offerings of any of these entities/individuals or their websites. YOU ACKNOWLEDGE AND AGREE THAT WE SHALL NOT BE RESPONSIBLE OR LIABLE, DIRECTLY OR INDIRECTLY, FOR ANY DAMAGE OR LOSS CAUSED OR ALLEGED TO BE CAUSED BY OR IN CONNECTION WITH USE OF OR RELIANCE ON ANY SUCH CONTENT, GOODS OR SERVICES AVAILABLE ON OR THROUGH ANY SUCH THIRD PARTY WEBSITES OR SERVICES. WE STRONGLY ADVISE YOU TO READ THE TERMS OF SERVICE AND PRIVACY POLICIES OF ANY THIRD PARTY WEBSITES OR SERVICES THAT YOU VISIT. Important Disclaimers and Notices * NONE OF THE INFORMATION, SERVICE, OR MATERIALS OFFERED BY THE SERVICE CONSTITUTE, AND ARE NOT INTENDED TO CONSTITUTE, BUSINESS ADVICE, FINANCIAL ADVICE, OR ANY ADVICE OF ANY KIND AND YOU SHOULD NOT ACT OR REFRAIN FROM ACTING BASED ON ANY INFORMATION, SERVICE, OR MATERIALS PROVIDED IN THE SERVICE. ALL CONTENT ON THE SERVICE IS INFORMATION OF A GENERAL NATURE AND DOES NOT ADDRESS THE UNIQUE CIRCUMSTANCES OF ANY PARTICULAR USER. YOU ARE STRONGLY URGED TO CONSULT WITH YOUR OWN ADVISORS AS TO ALL QUESTIONS YOU MAY HAVE. * You assume all risks and all costs associated with your use of the Service, including, without limitation, any internet access fees, banking fees, transaction fees, back-up expenses, costs incurred for the user of your device and peripherals, and any damage to any equipment, software, information or data. * You are responsible for configuring your own information technology, computer programs and platform in order to access the Service. You should use your own virus protection software. * The Government of Canada prohibits Canadian companies from engaging in all or certain commercial activities with certain sanctioned countries (each a "Canadian Sanctioned Country") and certain individuals, organizations or entities, including without limitation certain specially designated nationals (each a "Canadian SDN") listed in the Consolidated Canadian Autonomous Sanctions List (accessible via this link: https://www.international.gc.ca/world-monde/international_relations-relations_internation ales/sanctions/consolidated-consolide.aspx?lang=eng#dataset-filter). If you use the Service, you expressly represent that you are not located in a Canadian Sanctioned Country and are not listed as a Canadian SDN. If we determine that the Service is being used by prohibited persons, it will take any and all actions to terminate your access to the Service. Disclaimer Of Warranty THESE SERVICES ARE PROVIDED BY US ON AN "AS IS" AND "AS AVAILABLE" BASIS. WE MAKE NO REPRESENTATIONS OR WARRANTIES OF ANY KIND, EXPRESS OR IMPLIED, AS TO THE OPERATION OF THEIR SERVICES, OR THE INFORMATION, CONTENT OR MATERIALS INCLUDED THEREIN. YOU EXPRESSLY AGREE THAT YOUR USE OF THESE SERVICES, THEIR CONTENT, AND ANY SERVICES OR ITEMS OBTAINED FROM US IS AT YOUR SOLE RISK. NEITHER THE COMPANY NOR ANY PERSON ASSOCIATED WITH THE COMPANY MAKES ANY WARRANTY OR REPRESENTATION WITH RESPECT TO THE COMPLETENESS, SECURITY, RELIABILITY, QUALITY, ACCURACY, OR AVAILABILITY OF THE SERVICES. WITHOUT LIMITING THE FOREGOING, NEITHER THE COMPANY NOR ANYONE ASSOCIATED WITH THE COMPANY REPRESENTS OR WARRANTS THAT THE SERVICES, THEIR CONTENT, OR ANY SERVICES OR ITEMS OBTAINED THROUGH THE SERVICES WILL BE ACCURATE, RELIABLE, ERROR-FREE, OR UNINTERRUPTED, THAT DEFECTS WILL BE CORRECTED, THAT THE SERVICES OR THE SERVER THAT MAKES IT AVAILABLE ARE FREE OF VIRUSES OR OTHER HARMFUL COMPONENTS OR THAT THE SERVICES OR ANY SERVICES OR ITEMS OBTAINED THROUGH THE SERVICES WILL OTHERWISE MEET YOUR NEEDS OR EXPECTATIONS. WE HEREBY DISCLAIM ALL WARRANTIES OF ANY KIND, WHETHER EXPRESS OR IMPLIED, STATUTORY, OR OTHERWISE, INCLUDING BUT NOT LIMITED TO ANY WARRANTIES OF MERCHANTABILITY, NON-INFRINGEMENT, AND FITNESS FOR PARTICULAR PURPOSE. THE FOREGOING DOES NOT AFFECT ANY WARRANTIES WHICH CANNOT BE EXCLUDED OR LIMITED UNDER APPLICABLE LAW. Limitation Of Liability EXCEPT AS PROHIBITED BY LAW, YOU WILL HOLD US AND OUR OFFICERS, DIRECTORS, EMPLOYEES, AND AGENTS HARMLESS FOR ANY INDIRECT, PUNITIVE, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGE, HOWEVER IT ARISES (INCLUDING ATTORNEYS' FEES AND ALL RELATED COSTS AND EXPENSES OF LITIGATION AND ARBITRATION, OR AT TRIAL OR ON APPEAL, IF ANY, WHETHER OR NOT LITIGATION OR ARBITRATION IS INSTITUTED), WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE, OR OTHER TORTIOUS ACTION, OR ARISING OUT OF OR IN CONNECTION WITH THIS AGREEMENT, INCLUDING WITHOUT LIMITATION ANY CLAIM FOR PERSONAL INJURY OR PROPERTY DAMAGE, ARISING FROM THIS AGREEMENT AND ANY VIOLATION BY YOU OF ANY FEDERAL, PROVINCIAL, STATE, OR LOCAL LAWS, STATUTES, RULES, OR REGULATIONS, EVEN IF WE HAVE BEEN PREVIOUSLY ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. EXCEPT AS PROHIBITED BY LAW, IF THERE IS LIABILITY FOUND ON THE PART OF THE COMPANY, IT WILL BE LIMITED TO THE AMOUNT PAID FOR THE PRODUCTS AND/OR SERVICES DURING THE 30 DAYS PRIOR TO THE NOTICE OF CLAIM, AND UNDER NO CIRCUMSTANCES WILL THERE BE CONSEQUENTIAL OR PUNITIVE DAMAGES. SOME JURISDICTIONS DO NOT ALLOW THE EXCLUSION OR LIMITATION OF PUNITIVE, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, SO THE PRIOR LIMITATION OR EXCLUSION MAY NOT APPLY TO YOU. Indemnification You agree to indemnify, defend, and hold harmless Advite, Inc., its affiliates, officers, directors, employees, agents, licensors, and suppliers from and against any and all claims, liabilities, damages, losses, costs, expenses, or fees (including reasonable attorneys' fees) that such parties may incur as a result of or arising from your (or anyone using your account) violation of these Terms of Service or any applicable law, regulation, or the rights of any third party. Advite, Inc. reserves the right, at its own expense, to assume the exclusive defense and control of any matter otherwise subject to indemnification by you, and you agree to cooperate with Advite, Inc.'s defense of these claims. Release of Advite, Inc. Accordingly, you expressly agree that you and all users assume all risks in connection with their respective access and use of the Service and all parts thereof; and, you expressly release Advite, Inc., its directors, officers, employees, and agents (the "Releasees") from, and hold them harmless from and against, any and all liability, claims, causes of action, losses, expenses, or damages (whether arising in law or equity, including but not limited to special, consequential, indirect, punitive, and exemplary damages, and including but not limited to economic loss, business disruption, and/or attorney's fees) arising from or in any way related to the Service or any part thereof. You expressly waive all such claims against the Releasees. Termination We may terminate or suspend your account and bar access to the Service immediately, without prior notice or liability, under our sole discretion, for any reason whatsoever and without limitation, including but not limited to a breach of the Agreement. If you wish to terminate your account, you may simply discontinue using the Service. All provisions of the Agreement which by their nature should survive termination shall survive termination, including, without limitation, ownership provisions, warranty disclaimers, indemnity and limitations of liability. Changes To Service We reserve the right to withdraw or amend our Service and any part thereof, and any service or material we provide via our Service, in our sole discretion without notice. We will not be liable if for any reason all or any part of our Service is unavailable at any time or for any period. From time to time, we may restrict access to some parts of our Service, or the entire our Service, to users, including registered users. Amendments We may amend this Agreement, without notice to you, at any time by posting the amended terms on or within the Services. It is your responsibility to review this Agreement periodically. Your continued use of the Service following the posting of a revised Agreement means that you accept and agree to the changes. You are expected to check this page frequently so you are aware of any changes, as they are binding on you. By continuing to access or use our Service after any revisions become effective, you agree to be bound by the revised terms. If you do not agree to the new terms, you are no longer authorized to use Service. Waiver And Severability No waiver by us of any term or condition set forth in the Agreement shall be deemed a further or continuing waiver of such term or condition or a waiver of any other term or condition, and any failure of us to assert a right or provision under the Agreement shall not constitute a waiver of such right or provision. If any provision of the Agreement is held by a court or other tribunal of competent jurisdiction to be invalid, illegal, or unenforceable for any reason, such provision shall be eliminated or limited to the minimum extent such that the remaining provisions of the Agreement will continue in full force and effect. Assignment Neither party may assign any of its rights or obligations hereunder, whether by operation of law or otherwise, without the prior written consent of the other party (not to be unreasonably withheld). Notwithstanding the foregoing, we may assign this Agreement in its entirety, without your consent, to an affiliate or in connection with a merger, acquisition, corporate reorganization, or sale of all or substantially all its business, shares, or assets. Any attempt by a party to assign its rights or obligations under this Agreement in breach of this section shall be void and of no effect. Subject to the foregoing, this Agreement shall bind and inure to the benefit of the parties, their respective successors, and permitted assigns. Acknowledgement BY USING SERVICE OR OTHER SERVICES PROVIDED BY US, YOU ACKNOWLEDGE THAT YOU HAVE READ THIS AGREEMENT AND AGREE TO BE BOUND BY THEM. Independent Legal Advice You acknowledge and confirm that prior to executing this Agreement, Advite, Inc. requested that you obtain independent legal advice with respect to the rights, obligations, disclaimers, and notices herein. You confirm and agree that: (1) you have executed this Agreement under their own volition and without any duress whatsoever from Advite, Inc. or any other person or entity; and (2) if you did not obtain independent legal advice prior to executing this Agreement, you will not in any proceeding relating to the enforcement of rights and obligations under this Agreement raise that as a defense or otherwise. Force Majeure Neither party shall be responsible for its failure to perform its obligations under this Agreement to the extent due to unforeseen circumstances or causes beyond its control, including but not limited to acts of God, wars, terrorism, riots, embargoes, acts of civil or military authorities, fires, floods, accidents, or strikes, epidemics, computer, telecommunications, Internet service provider or hosting facility failures or delays involving hardware, software or power systems not within a party's possession or reasonable control, provided that such party gives the other party prompt written notice of the failure to perform and the reason therefore and uses its reasonable efforts to limit the resulting delay in its performance. Governing Law This Agreement shall be governed and construed in accordance with the laws of Ontario, and/or the federal laws of Canada as applicable therein, without regard to its conflict of law provisions.	<urn:uuid:c5e432e2-0554-42ef-8277-3fdf3bbd1e70>	CC-MAIN-2025-08	https://advite.ai/tos.pdf	2025-02-14T23:18:57+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-08/subset=warc/part-00026-b184e832-acd1-425a-bab7-895830f2748a.c000.gz.parquet	58,549,811	5,271	eng_Latn	eng_Latn	0.943274	eng_Latn	0.985725	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2019, 4392, 7098, 10604, 12237, 14896, 17256, 19678, 22195, 24421, 25998 ]
Biological Performance of Electrospun Polymer Fibres Ivan Joseph Hall Barrientos 1, Graeme R. MacKenzie 1, Clive G. Wilson 1, Dimitrios A. Lamprou 2,* and Paul Coats 1,* 1 Strathclyde Institute of Pharmacy and Biomedical Sciences (SIPBS), University of Strathclyde, Glasgow G4 0RE, UK; [email protected] (I.J.H.B.); [email protected] (G.R.M.); [email protected] (C.G.W) 2 School of Pharmacy, Queen’s University Belfast, Belfast BT9 7BL, UK * Correspondence: [email protected] (D.A.L.); [email protected] (P.C.); Tel.: +44-(0)28-9097-2617 (D.A.L.); +44-(0)141-548-5790 (P.C.) Received: 30 November 2018; Accepted: 22 January 2019; Published: 24 January 2019 Abstract: The evaluation of biological responses to polymeric scaffolds are important, given that the ideal scaffold should be biocompatible, biodegradable, promote cell adhesion and aid cell proliferation. The primary goal of this research was to measure the biological responses of cells against various polymeric and collagen electrospun scaffolds (polycaprolactone (PCL) and polylactic acid (PLA) polymers: PCL–drug, PCL–collagen–drug, PLA–drug and PLA–collagen–drug); cell proliferation was measured with a cell adhesion assay and cell viability using 5-bromo-2′-deoxyuridine (BrdU) and resazurin assays. The results demonstrated that there is a distinct lack of growth of cells against any irgasan (IRG) loaded scaffolds and far greater adhesion of cells against levofloxacin (LEVO) loaded scaffolds. Fourteen-day studies revealed a significant increase in cell growth after a 7-day period. The addition of collagen in the formulations did not promote greater cell adhesion. Cell viability studies revealed the levels of IRG used in scaffolds were toxic to cells, with the concentration used 475 times higher than the EC$_{50}$ value for IRG. It was concluded that the negatively charged carboxylic acid group found in LEVO is attracting positively charged fibronectin, which in turn is attracting the cell to adhere to the adsorbed proteins on the surface of the scaffold. Overall, the biological studies examined in this paper are valuable as preliminary data for potential further studies into more complex aspects of cell behaviour with polymeric scaffolds. Keywords: electrospinning; aligned fibrous scaffolds; cell biology; nanofibers 1. Introduction The challenge facing surgeons using mesh scaffolds in tissue engineering applications are two-fold: first, controlling the way the fibres being used physically transform and symbiotically interact with the host body’s physiological function; and more importantly, minimising or negating complications such as chronic infections, development of adhesions, chronic pain and mesh rupture. Drug-loaded oriented scaffolds can be created using a number of processes, including electrospinning, a fibre production method utilising electric force against polymeric solutions. However, despite the various characterisation methods one can perform on these scaffolds, there is a requirement to understand and measure fundamental biological responses. In particular, ideal scaffolds for tissue engineering should be biocompatible, biodegradable, promote cell adhesion and proliferation and have no detrimental effect on cell bioenergetics [1]. Materials such as polycaprolactone (PCL), polylactic acid (PLA) and collagen have achieved biocompatible and biodegradable requirements [2]. However, measuring the effect of any biopolymer on cell adhesion, cell proliferation and cell metabolic activity remains the crucial aspect in determining biocompatibility. Another important biological requirement is assisting... the suppression of potential bacterial infections at the site of surgical/scaffold implant. Controlling any bacterial infection is a vital pre-requisite to any potential cell growth, given that the cell/tissue viability in the presence of bacteria such as Staphylococcus aureus or Escherichia (E.) coli will be profoundly compromised [3]. Staphylococcus (S.) aureus is a gram-positive bacterium that is commonly found in nasal passages, skin and mucous membranes [4]. This is a major cause of infection of wounds (in particular nosocomial bloodstream infections), especially in surgical procedures that involve medical device implants [5]. Currently, within hernia mesh repair, 68% of infection complications are attributed to the S. aureus infections; any infections related to hernia repair will increase the recurrence rates of hernia, meaning that inhibiting the growth of this bacterium will give the patient a better chance of recovery [6]. E. coli is another bacterium that can have detrimental effects on the recovery of wounds—it is the most common pathogen found in the hernia sac [7]. This bacterium tends to develop in fluid collections at the site of mesh implant. If this is found at the site of implant, typically drainage of the bacterial fluid and a course of antibiotics are administered (e.g., ceftriaxone and ampicillin) [8]. However, if both S. aureus and E. coli can be controlled without further administration of antibiotics (which would in turn reduce the possibility of antibiotic resistance), invasive drainage procedures or overall removal of hernia mesh can be avoided – this increases the chance of patient recovery and a better chance of tissue re-growth at a cellular level. The proliferation of cells related to the healing of wounds is also important within a hernia repair context. Typically, wound healing can be divided into four main steps: (1) haemostasis (0–7 h); (2) inflammation (1–3 days); (3) proliferation (4–21 days); and (4) remodelling (21 days–1 year) [9]. The proliferation period is arguably one of the most important phases given that there is a focus on restoring the tissue network; this can be easily disrupted through any potential infection. Another important aspect of the proliferation stage is the formation of the extracellular matrix (ECM); proper formation of the ECM will help with cell adhesion and regulate growth, movement and differentiation of the cells growing within it. If electrospun scaffolds can mimic the ECM successfully, they may help promote cell adhesion, growth, movement and differentiation [10]. Tissue engineered scaffolds have been used in a number of different clinical applications; in particular, there are a range of applications that are currently being applied within the field of dentistry [11]. Other clinical applications include cardiac tissue engineering (e.g., culturing cells onto a biomaterial scaffold in-vitro and then implanting tissue onto cardiac surface [12]), nerve regeneration for the treatment of stroke (e.g., nanomaterials have been used as a biomimetic in order to induce neuronal growth and guide brain regeneration [13]) and the treatment of pulmonary diseases (e.g., porous scaffolds that mimic alveolar units to allow for greater cell adhesion for lung tissue regeneration [14]). Studies involving the testing of cellular response against electrospun scaffolds have been have been well reported in the literature: testing cell migration of breast cancer cells (MDA-MB-231) against PCL scaffolds [15], rat periodontal ligament cells against poly(lactic-co-glycolic acid; PLGA) scaffolds [16], human umbilical vein endothelial cell (HUVEC) against PCL–collagen scaffolds [17] and human mesenchymal stems cells against PLA scaffolds [18]. In particular, some of these studies showed evidence that cells typically form confluent monolayers on electrospun scaffolds; fibre orientation affects cell alignment and cells prefer to grow on aligned fibres (e.g., cells showed greater attachment to specifically aligned fibres in comparison to randomly oriented scaffolds) [19]. Though the studies mentioned successfully demonstrated a range of cellular behaviours on electrospun scaffolds, there is a dearth of research that focuses on the cellular response in the presence of drug-loaded electrospun scaffolds. Therefore, the primary goal of this study was to measure the biological responses of cells against a number of scaffolds (PCL–drug, PCL–collagen–drug, PLA–drug and PLA–collagen–drug variations); cell proliferation was measured with a cell adhesion assay, with subsequent fluorescent and scanning electron microscopy (SEM) imaging and cell viability using resazurin and 5-bromo-2′-deoxyuridine (BrdU) assays. The cell viability assays were chosen specifically (in particular the resazurin assay) for quick determination of cell viability. Other assays, such as the MTT (3-(4,5-Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide) assay, have been used [20]; however, the use of DMSO in this assay has the potential to begin to degrade the polymeric samples. The results in this paper amplify the importance of a number of factors described in previous reports [21,22], such as the importance of hydrophobicity/hydrophilicity of the scaffolds, drug release rates, drug concentrations and fibre morphology. 2. Materials and Methods 2.1. Materials PCL with a mean molecular weight of 80 kD, PLA with a mixed molecular weight, irgasan (IRG, variation of Triclosan, >97%), levofloxacin (LEVO, >98%), solvents used for the electrospinning consisting of chloroform (anhydrous, containing amylene as stabilizers, >99%) and N,N-dimethylformamide (DMF, anhydrous 99.8%) and collagen from calf skin (Bornstein and Traub Type I) were all obtained from Sigma Aldrich (Poole, UK). 2.2. Electrospinning of Polymeric Scaffolds The polymer test specimens were fabricated for each polymeric solution using a custom in-house electrospinning apparatus, which consisted of a syringe pump (Harvard Apparatus PHD 2000 infusion, Cambridge, UK) and two 30 kV high-voltage power supplies (Alpha III series, Brandenburg, UK). The polymer solution was loaded into a glass syringe and fed through tubing with a metal needle tip attached at the end. The needle was clamped into place to allow a high-voltage supply to run through it, which allowed an electric field to be created between the needle and the target plate. The syringe was clamped to a pump, which determined the specific injection flow rate of the polymeric solutions. For each of the three solutions (e.g., unloaded, irgasan-loaded and levofloxacin-loaded), 3 varying flow rates of 0.5, 1 and 1.5 mL·h$^{-1}$ were applied across varying voltages of 2 kV–5 kV (needle) and 10 kV–18 kV (target plate) [21]. The variation in flow rate and applied voltages were to correct any problems that occurred during fabrication, i.e., ‘spitting’ of the solution at the target plate, or any potential beading (which was examined through SEM). The fabrication of this solution was electrospun onto a target that was covered with aluminium foil, in order for the final material to be removed and used for further characterisation. The final yield of electrospun polymers resulted in thin, flexible sheets of material. 2.3. Microscopic Characterisation The morphology and diameter of individual fibres spun from the PCL solution were determined from scanning electron micrographs of each sample (TM-1000®, Hitachi, Ltd., Maidenhead, UK). The samples were mounted on an aluminium plate with conductive tape. Images of fibres were taken at various locations of each electrospun PCL scaffold in order to determine the overall uniformity of fibres. Prior to imaging, the samples were sputter coated with gold for 30 s using a Leica EM ACE200® vacuum coater, the process being repeated four times in order to increase the conductivity of the samples. The samples were imaged in secondary electron mode at 5 kV. 2.4. Cell Adhesion and Proliferation Rat aortic smooth muscle cells (RAOSMCs) were explanted from 12-week-old male Sprague-Dawley rats. Aortic rings (5 mm) were placed in T25 flasks in media (10% fetal calf serum (FCS); 50:50 Waymouth and F12; 1% penicillin/streptomycin). The medium was changed every 72 h and growth was monitored using a light microscope until cells reached ~70% confluency (Passage 0). Cells were then split into T75 flasks and allowed to grow to ~70% confluency (Passage 1). Cells were then again split into six well plates, 24 well plates or 96 well plates for further analysis. Cell adhesion was monitored in 24-well plate dishes with cells seeded directly onto electrospun scaffolds. Square electrospun scaffolds (1 cm × 1 cm) were sterilized using short-wave UV irradiation. Three samples were used per group, plus 1 control (scaffold containing no drug or collagen) and repeated on 2 more well plates. Scaffolds were then pre-wet with media and placed in tissue culture plates. Cells (at the previously mentioned density) in a volume of 100 µL were seeded directly onto each scaffold, incubated at 37 °C for 4 h in order for the cells to adhere to the surface. Each well was then filled with 2 mL of growth medium. Initially, the RAOSMCs were left for 3 days to judge the adhesion of cells on the scaffold surface, and then RAOSMCs were tested for proliferation within 14 days of seeding. In this case, media was replaced every 3 days, and scaffolds were removed at 3, 7 and 14 days in order to image cells on the scaffold (using fluorescent microscopy). Adhesion and proliferation were determined through the staining of dead cells using propidium iodide (PI), a red-fluorescent nuclear and chromosome counterstain. This process involved lifting the scaffolds from the wells, washing them with PBS buffer and fixing the cells using 5% paraformaldehyde. Samples were then placed in 1 mL of PBS buffer, and 10 µL of PI solution was added and left in dark storage for approximately 30 min. Samples were then placed on a coverslip, then subsequently imaged on a Nikon Eclipse E600 Epifluorescent Upright Microscope (Nikon, New York, NY, USA), at wavelengths of 495 nm (FITC) and 532 nm (TRITC). Cells were then counted using ImageJ software (Version 1.52, National Institutes of Health, Wisconsin, WI, USA). Images were converted to greyscale; the image threshold was altered to display a black and white image highlighting the cell nuclei. A watershed function was then applied to separate cells that were grouped close together, and a particle analyser was run at a measurement of minimum 100–120 pixels and a circularity range of 0.00–1.00. 2.5. Cell Viability Assay In order to measure the cell viability against the levels of drug used in the electrospun scaffolds, a resazurin assay was performed. Cells (RAOSMCs) were grown in 1% FCS, 10% FCS, 1% addition of IRG or addition of 0.5% addition of LEVO, at a density of $3 \times 10^4$ cells/cm$^2$ (in 24-well plates) for 3 days. The resazurin reagent was then added to each well, incubated at 37 °C for 4 h, then subsequently tested for fluorescence using a fluorometer at 560Ex nm and 590Em nm. Ranges of drug concentrations (IRG = 1%, 0.1%, 0.01%, LEVO = 1%, 0.5%, 0.1%) were then tested against the growth of cells (RAOSMCs). 2.6. Cell Proliferation Assay A 5-bromo-2′-deoxyuridine (BrdU) assay was used to test the proliferation of cells (Sigma Aldrich, Poole, UK). Cells were grown at a density of $3.6 \times 10^4$ cells/100 µL (in 96-well plates) for 3 days. Cell proliferation was assessed based on 5-bromo-2′-deoxyuridine (BrdU) incorporation followed by ELISA according to the manufacturer’s protocol. BrdU solutions were added to the well to achieve 1 nM final concentration and incubated for 6 h. Cells were then washed, fixed and denatured at 37 °C for 30 min. Following successive washings with PBS, cellular BrdU uptake was detected by colorimetric ELISA (450 nm) using anti-BrdU antibody. Data were normalized to the protein concentration of the corresponding sample. 2.7. Statistical Analysis All experiments were performed in triplicate with calculation of means and standard deviations. Two-way analysis of variance (ANOVA) was used for multiple comparisons along with Tukey’s multiple comparing tests, followed by a T-test to access statistical significance for paired comparisons. Significance was acknowledged for $p$ values lower than 0.05. 3. Results 3.1. Cell Adhesion and Proliferation The uniformity of fibres is shown through an SEM image in Figure 1. Initial 3-day studies of RAOSMC growth against all PCL and PLA variations can be seen in Figures 2 and 3. The fluorescent images in Figure 2 indicate there was no adhesion of cells on the PCL or PCL–collagen scaffolds, and there appeared to be presence of a bacterial infection (bacteria not identified). ![Figure 1](image1.png) Figure 1. SEM image of polycaprolactone (PCL)–Collagen–levofloxacin (LEVO) fibres at 20 μm scale. ![Figure 2](image2.png) Figure 2. Fluorescent images of cell adhesion assay for rat aortic smooth muscle cells (RAOSMCs) after 3 days (A) PCL (B) PCL–irgasan (IRG) (C) PCL–LEVO (D) PCL–collagen (E) PCL–collagen–IRG (F) PCL–collagen–LEVO. RAOSMC adhesion was found to be minimal within both PCL–IRG and PCL–collagen–IRG samples, with a cell density of approximately 1600 cells/cm$^2$ and 500 cells/cm$^2$. PCL–LEVO, however, showed a cell adhesion density of approximately 14,000 cells/cm$^2$ and 7500 cells/cm$^2$ for PCL–collagen–LEVO. Figure 3 indicates that there was no apparent cell adhesion of RAOSMCs against the PLA, PLA–collagen and PLA–collagen–IRG scaffolds, with only a bacterial infection appearing in each case. There was no cell adhesion measured for the PLA–IRG scaffold; however, no bacterial infection was observed. Cell adhesion was observed for PLA–LEVO and PLA–collagen–LEVO scaffolds, with a cell count of approximately 11,000 cells/cm$^2$ and 2000 cells/cm$^2$, respectively. ![Fluorescent images of cell adhesion assay for RAOSMCs after 3 days](image) Figure 3. Fluorescent images of cell adhesion assay for RAOSMCs after 3 days (A) polylactic acid (PLA) (B) PLA–IRG (C) PLA–LEVO (D) PLA–collagen (E) PLA–collagen–IRG (F) PLA–collagen–LEVO. A 14-day study was conducted on PCL–LEVO and PLA–LEVO combinations due to the highest measurement of proliferative cells in the previous 3-day study. The results from this 14-day study can be seen in Figures 4 and 5. PCL–LEVO showed a cell count across 3, 7 and 14 days of 6800, 140,000 and 98,000 cells/cm$^2$. PCL–collagen–LEVO scaffold had a cell count across 3, 7 and 14 days of 1500, 180,000 and 130,000 cells/cm$^2$. Similar to the results of the 3-day study with PCL–LEVO/PCL–collagen–LEVO, greater proliferation was measured against the PLA–LEVO and PLA–collagen–LEVO scaffolds; therefore, the 14-day study was tested against the scaffolds. PLA–LEVO scaffolds showed an average cell count of 7800, 128,000 and 119,000 cells/cm$^2$ at 3, 7 and 14 days. PLA–collagen–LEVO scaffolds showed an average cell count of 12,800 and 168,000 after 3 and 7 days, respectively, and at 14 days was devoid of cells (a bacterial infection was observed). Figure 4. Fluorescent images of cell proliferation of RAOSMCs (A) PCL–LEVO after 3 days (B) PCL–LEVO after 7 days (C) PCL–LEVO after 14 days (D) PCL–collagen–LEVO after 3 days (E) PCL–collagen–LEVO after 7 days (F) PCL–collagen–LEVO after 14 days. Figure 5. Fluorescent images of cell proliferation of RAOSMCs (A) PLA–LEVO after 3 days (B) PLA–LEVO after 7 days (C) PLA–LEVO after 14 days (D) PLA–collagen–LEVO after 3 days (E) PLA–collagen–LEVO after 7 days (F) PLA–collagen–LEVO after 14 days. An SEM image was also taken (Figure 6) that shows how the cells initially adhered within the fibres after 3 days with subsequent proliferation after 14 days. ![SEM images of adhered RAOSMC in polymer fibres](image) Figure 6. SEM images of adhered RAOSMC in polymer fibres (A) 40 μm image at 3 days (B) 120 μm image at 14 days. ### 3.2. Cell Viability Data relating to the absorbance of resorufin from the resazurin assay can be seen in Figure 7. Following the addition of 10% FCS to cells, metabolic activity increased by $24.82 \pm 9.2\%$ when compared with quiesced cells in 0.1% FCS. The effect of 1% IRG had a detrimental effect on metabolic activity, reducing it by $89.23 \pm 0.48\%$ below background activity (0.1% FCS). The effect of LEVO was less harsh when compared with IRG, with an observed increase of $4.35 \pm 7.89\%$. IRG reduced activity by $91.37 \pm 0.61\%$ against 10% FCS. LEVO reduced metabolic activity against 10% FCS by $16.39 \pm 5.41\%$. ![Absorbance data with standard error bars](image) Figure 7. Absorbance data with standard error bars ($n = 3$) for resazurin assay against BG (background) 10% fetal calf serum (FCS), 1% IRG and 0.5% LEVO concentrations. BG, IRG (1%), LEVO (0.5) vs. 10% FCS * $p < 0.05$. BrdU data is shown in Figure 8A,B. In comparison with the background, a high cell proliferation was observed with the addition of 10% FCS. For the range of IRG concentrations, cell proliferation increased for 0.01% and 0.1% concentrations and decreased in proliferation for 1% concentrations. LEVO concentrations generally showed a higher proliferation compared with the background, with cell proliferation reducing as the concentration increased from 0.1% to 1%. Figure 8. Absorbance data with standard error bars (n = 3) for 5-bromo-2′-deoxyuridine (BrdU) assay against (A) background, 10% FCS, 0.01% IRG, 0.1% IRG, 1% IRG. BG, IRG (0.001%), IRG (0.1%), IRG (1%) vs. 10% FCS * p < 0.05. (B) background, 10% FCS, 0.1% LEVO, 0.5% LEVO and 1% LEVO concentrations. BG, LEVO (0.1%), LEVO (0.5%), LEVO (1%) vs. 10% FCS * p < 0.05. 4. Discussion Understanding the behaviour of smooth muscle cell (SMC) growth against scaffolds is important, given the importance of SMCs within the development of tissue re-growth. Initial 3-day studies of RAOSMCs against a number of PLA scaffold combinations proved insightful in determining which scaffold/drug exhibited greatest efficacy in allowing cells to adhere. Bacterial infections were only observed in the scaffolds that did not contain any antibacterial drug embedded within the polymeric fibres. The source of the bacterial contamination was likely due to the tissue isolation procedure. from the animals. Of course, any infection within the culture model is undesirable. However, in this case what is noteworthy is contamination was prevented in all cases by the antibiotic combinations. With respect to translational relevance, this is a potential verification of the potential value of this antibiotic/polymer combination as a candidate for use in a surgical/clinical scenario of mesh implant procedure where infection is highly possible. Typically, bacterial cells have been shown to invade endothelial and smooth muscle cells in particular [23]. The addition of IRG across both PCL and PLA samples proved detrimental to RAOSMCs adhesion. This may be largely due to the high hydrophobicity of IRG in combination with two types of polymers that are generally hydrophobic in nature—hydrophobicity typically hinders cell adhesion and proliferation [24]. There appeared to be a greater adherence of cells on LEVO-loaded scaffolds that did not contain type I collagen; in the case of the PCL–LEVO and PCL–collagen–LEVO samples, both have the same hydrophilic characteristics. However, the difference in cell adhesions cannot be attributed to this. It is more likely the cells were interacting as a consequence of the variance in fibre diameters for the two scaffolds, or the release of levofloxacin inhibiting bacteria may have affected cell adhesion. Concerning the cell attachment against fibre diameter, it should be the case that scaffolds (in particular PCL scaffolds) with smaller diameters (such as PCL–collagen–LEVO, with an average fibre diameter of 1.5 μm) would have better attachment of cells due to the increase in specific surface area [25]. However, this was not the case. Thus, the decrease in cell attachment for the PCL–collagen–LEVO scaffold may be due to factors that include drug release rate (there is a higher release percentage of drug from the PCL–LEVO scaffolds compared with the PCL–collagen–LEVO scaffold (as demonstrated in previous studies [22]), and an increase in bacterial resistance may help with cell adhesion), or simply that the number of cells seeded onto the scaffolds were lower. PLA–LEVO and PLA–collagen–LEVO scaffolds showed a lower cell adhesion count. This lower cell adhesion may have been attributed to the high hydrophobicity (water contact angle ~108° for PLA–LEVO and ~132° water contact angle for PLA–collagen–LEVO; these data sets were published in previous works [21]) and smaller fibre diameter for the PLA–collagen–LEVO. Although a smaller fibre diameter could encourage cell attachment, having fibres that range between 100 and 300 nm (of which there are some measured in the PLA–collagen–LEVO scaffold) will not have a significant impact in the promotion of cell adhesion [17]. One explanation that the RAOSMCs are adhering and proliferating across the LEVO-loaded scaffolds (for both PCL and PLA) may be due to the varying surface charges. It has been shown in several studies that the most suitable conditions for cell adhesion and proliferation occur when there is presence of negative ions associated with the surface treatment or drug of interest [26]. In particular, a carboxylic (−COOH) functional group is found predominately in the levofloxacin compound; this functional group has a negative charge, with hydrophilic properties, and interacts almost exclusively with fibronectin [27]. This interaction with fibronectin (which is typically found within the extra cellular matrix of cultured cells) is important, because if the fibronectin protein is adsorbed onto the scaffold surface, this allows for the anchoring of fibronectin to the cell [28]—in this case allowing the RAOSMC to adhere to the scaffold surface. Cell adhesion within the fibrous scaffolds can be seen in Figure 6. The structure of the cell took shape according to the fibrous network it was surrounded by, extending in multiple directions according to whatever direction a fibre was oriented. This was due to cells and nuclei becoming elongated in order to adapt to the fibre structure, with the cell contracting in order to accommodate within the fibrous network of the electrospun scaffolds [29]. A high confluence of cell proliferation can be seen in Figure 6B, suggesting that initial success in cell adhesion allowed the smooth muscle to proliferate over 14 days. Examining the cell proliferation of RAOSMCs over 14 days was useful in demonstrating the efficacy of the scaffolds against cell growth. We have demonstrated that cells had a higher level of proliferation and confluence at 7 days (across PCL and PLA scaffolds), followed by a decrease in proliferation at 14 days for most scaffolds (Figures 3 and 4). This decrease may be explained due to the inhibition that is typically experienced when cell proliferation is at a high confluence [30]. This particular cell line (RAOSMCs) also stops growing, and cells enter a senescence phase upon reaching confluency [31]. Despite a reduced number of cell adhesions observed in scaffolds containing collagen, this did not affect cell proliferation from 7 to 14 days. There is a possibility of the hydrophobic bands (from collagen fibrils) being drawn to the surface of the fibres; therefore, it may be the case that any cell–collagen interactions occurring may have been delayed due to hydrophobic forces [21]. We also observed that smooth muscle cells were growing in ‘lines’ on the PCL–collagen–LEVO scaffold. This may be due to the fibre orientation of the sample, as fibres can be oriented in one direction simply by stretching the scaffold in one direction. It may be the case that the samples were stretched during the setup process (samples had to be removed from their aluminium backings, with PCL–collagen–LEVO demonstrating high adhesion to the aluminium). However, this is an important factor as cells will typically elongate and grow along a particular direction of aligned fibres [32]. Cell viability studies were useful in determining whether the levels of drug loaded into the scaffolds had any potential toxic or inhibitory effects on the growth of RAOSMCs. It was clear from the results that the concentration of IRG used (1%) was detrimental to cell growth and viability. IRG has an EC$_{50}$ value of approximately 0.0012 mg/mL [33]. Given that the 1% concentration used in the resazurin assay was 0.57 mg/mL (475 times higher than the EC$_{50}$ value), the reason for poor cell adhesion and proliferation on IRG-loaded scaffolds was due to this high concentration. The BrdU assays were useful in demonstrating the varying IRG concentrations directly against the proliferation of smooth muscle cells—with 0.1% and 0.01% concentrations showing a more favourable response compared to the 1% IRG. It should also be noted that IRG has a mode of action where the drug can break through membranes and demonstrate inhibitory effects, such as blocking of lipid biosynthesis [34], which may be another plausible explanation as to why there was poor cell adhesion and proliferation. We observed that the concentration of LEVO (0.5%) used in the initial resazurin study had no measurable effect on cell metabolic activity when compared with controls. At this stage, it would be safe to judge that the concentration of LEVO used was not detrimental to the growth and proliferation of RAOSMCs. Further evidence of this was shown in the BrdU results, indicating that an increase in concentration (to 1%) of LEVO decreased the proliferation of cells and that a decrease in concentration (to 0.1%) permitted cell proliferation. This may be linked to the quoted EC$_{50}$ value of 0.0074 mg/mL [35]—0.1% of LEVO used was 0.024 mg/mL, which is closer to the EC$_{90}$ value. 5. Conclusions Examining the cellular behaviour against polymeric scaffolds has proven extremely useful in determining whether they have potential use for further development within the tissue-engineering field. One of the main goals set out in this research was concerning how smooth muscle cells proliferate/are compatible against the various scaffolds, and a number of important outcomes can be taken from the results and discussion. Firstly, the use of irgasan within the polymeric scaffolds proved to be detrimental to the adhesion and proliferation of cells. This was due to the concentration of IRG used being far greater than the EC$_{50}$ value quoted in various publications, which meant that it was toxic to the cells growing in culture. Secondly, levofloxacin-loaded scaffolds showed the greatest number of cell adhesions and subsequent proliferation over 14 days. This could be explained by the hydrophilic nature of the drug (cells have a preference to grow in hydrophilic conditions); however, a very high hydrophobicity of the PLA–collagen–LEVO scaffold was reported in our previous studies. A more plausible explanation may be that the negatively carboxylic acid group found in LEVO was attracting positively charged fibronectins, which in turn were attracting the cell to adhere to the adsorbed proteins on the surface of the scaffold. Overall, the biological studies examined are useful as preliminary data for potential further studies into more complex aspects of cell behaviour: for example, understanding the behaviour of fibroblasts against electrospun scaffolds will help in understanding potential scar formation at the site of insertion (e.g., by reducing scar tissue formation will help prevent mesh adhesion) and in measuring inflammatory factors such as transforming growth factor beta 1 (TGF-β1) and interleukin 6 (IL-6). 6. Study Perspective and Future Directions This present study forms the first part of a planned program of work that may lead to the first human clinical trials of a bio-compatible novel drug eluting polymer for mesh implant surgery. In this study we have identified a number of important observations using in-vitro cell studies combined with key drugs–polymer combinations. Our next stage will progress and develop this work to in-vivo studies where the focus will be tissue integration and a systems biology assessment of our drug eluting polymer mesh implants. Author Contributions: I.J.H.B. and G.R.M carried out the laboratory work; C.G.W., P.C. and D.A.L. supervised the work; I.J.H.B. wrote the manuscript; all authors read and approved the manuscript before submission. Funding: This work was funded by the UK Engineering and Physical Sciences Research Council (EPSRC) Doctoral Training Centre in Medical Devices, University of Strathclyde (EPSRC Grant Ref. EP/F50036X/1). Conflicts of Interest: The authors would like to declare that we have no competing interests. References 1. Sivashankari, P.R.; Prabaharan, M. Prospects of chitosan-based scaffolds for growth factor release in tissue engineering. Int. J. Biol. Macromol. 2016, 93, 1382–1389. [CrossRef] [PubMed] 2. Mark, J.E. Polymer Data Handbook; Oxford University Press: Oxford, UK, 1999; p. 1012. 3. Wang, M.; Coffer, J.L.; Dorraj, K.; Hartman, P.S.; Loni, A.; Canham, L.T. Sustained antibacterial activity from triclosan-loaded nanostructured mesoporous silicon. Mol. Pharm. 2010, 7, 2232–2239. [CrossRef] [PubMed] 4. Lowy, F. Staphylococcus aureus infections. N. Engl. J. Med. 1998, 339, 520–532. [CrossRef] [PubMed] 5. Steinberg, J.P.; Clark, C.C.; Hackman, B.O. Nosocomial and community-acquired Staphylococcus aureus bacteremias from 1980 to 1993: Impact of intravascular devices and methicillin resistance. Clin. Infect. Dis. 1996, 23, 255–259. [CrossRef] [PubMed] 6. Iannitti, D.A.; Hope, W.W.; Norton, H.J.; Lincourt, A.E.; Millikan, K.; Fenoglio, M.E.; Moskowitz, M. Technique and Outcomes of Abdominal Incisional Hernia Repair Using a Synthetic Composite Mesh: A Report of 455 Cases. J. Am. Coll. Surg. 2008, 206, 83–88. [CrossRef] [PubMed] 7. Yang, L.; Wang, H.; Liang, X.; Chen, T.; Chen, W.; Song, Y.; Wang, J. Bacteria in hernia sac: An important risk fact for surgical site infection after incarcerated hernia repair. Hernia 2015, 19, 279–283. [CrossRef] [PubMed] 8. Aguilar, B.; Chapital, A.B.; Madura, J.A.; Harold, K.L. Conservative management of mesh-site infection in hernia repair surgery—A case series. J. Laparoendosc. Adv. Surg. Tech. A 2010, 20, 249–252. [CrossRef] 9. Reinke, J.M.; Sorg, H. Wound repair and regeneration. Eur. Surg. Res. 2012, 49, 35–43. [CrossRef] 10. Barker, T.H. The role of ECM proteins and protein fragments in guiding cell behaviour in regenerative medicine. Biomaterials 2011, 32, 4211–4214. [CrossRef] 11. Chieruzzi, M.; Pagano, S.; Moretti, S.; Pinna, R.; Milia, E.; Torre, L.; Eramo, S. Nanomaterials for tissue engineering in dentistry. Nanomaterials 2016, 6, 134. [CrossRef] 12. Christman, R.J.; Lee, K.L. Biomaterials for the treatment of myocardial infarction. J. Am. Coll. Cardiol. 2006, 48, 907–913. [CrossRef] 13. Zhang, T.J.; Webster, L. Nanotechnology and nanomaterials: Promises for improved tissue regeneration. Nano Today 2009, 4, 66–80. [CrossRef] 14. Andrade, C.F.; Wong, A.P.; Waddell, T.K.; Keshavjee, S.; Liu, M. Cell-based tissue engineering for lung regeneration. Am. J. Physiol. Lung Cell. Mol. Physiol. 2007, 292, 510–518. [CrossRef] [PubMed] 15. Nelson, M.T.; Short, A.; Cole, S.L.; Gross, A.C.; Winter, J.; Eubank, T.D.; Lannutti, J.J. Preferential, enhanced breast cancer cell migration on biomimetic electrospun nanofiber ‘cell highways. BMC Cancer 2014, 14, 825. [CrossRef] [PubMed] 16. Shang, S.; Yang, F.; Cheng, X.; Walboomers, X.F.; Jansen, J.A. The effect of electrospun fibre alignment on the behaviour of rat periodontal ligament cells. Eur. Cells Mater. 2010, 19, 180–192. [CrossRef] 17. Whited, B.M.; Rylander, M.N. The influence of electrospun scaffold topography on endothelial cell morphology, alignment, and adhesion in response to fluid flow. Biotechnol. Bioeng. 2014, 111, 184–195. [CrossRef] [PubMed] 18. McCullen, S.D.; Stevens, D.R.; Roberts, W.A.; Clarke, L.I.; Bernacki, S.H.; Gorga, R.E.; Loboa, E.G. Characterization of electrospun nanocomposite scaffolds and biocompatibility with adipose-derived human mesenchymal stem cells. Int. J. Nanomed. 2007, 2, 253–263. 19. Liu, C.; Zhu, C.; Li, J.; Zhou, P.; Chen, M.; Yang, H.; Li, B. The effect of the fibre orientation of electrospun scaffolds on the matrix production of rabbit annulus fibrosus-derived stem cells. Bone Res. 2015, 3, 15012. [CrossRef] 20. Pagano, S.; Chieruzzi, M.; Balloni, S.; Lombardo, G.; Torre, L.; Bodo, M.; Cianetti, S.; Marinucci, L. Biological, thermal and mechanical characterization of modified glass ionomer cements: The role of nanohydroxyapatite, ciprofloxacin and zinc l-carnosine. Mater. Sci. Eng. C 2019, 94, 76–85. [CrossRef] 21. Barrientos, I.J.H.; Paladino, E.; Brozio, S.; Passarelli, M.K.; Moug, S.; Black, R.A.; Wilson, C.G.; Lamprou, D.A. Fabrication and characterisation of drug-loaded electrospun polymeric nanofibers for controlled release in hernia repair. Int. J. Pharm. 2016, 517, 329–337. [CrossRef] 22. Barrientos, I.J.H.; Paladino, E.; Szabó, P.; Brozio, S.; Hall, PJ.; Oseghale, C.I.; Passarelli, M.K.; Moug, S.J.; Black, R.A.; Wilson, C.G.; et al. Electrospun collagen-based nanofibres: A sustainable material for improved antibiotic utilisation in tissue engineering applications. Int. J. Pharm. 2017, 531, 67–79. [CrossRef] [PubMed] 23. Kozarov, E. Bacterial invasion of vascular cell types: Vascular infectology and atherogenesis. Future Cardiol. 2012, 8, 123–138. [CrossRef] [PubMed] 24. He, M.; Xue, J.; Geng, H.; Gu, H.; Chen, D.; Shi, R.; Zhang, L. Fibrous guided tissue regeneration membrane loaded with anti-inflammatory agent prepared by coaxial electrospinning for the purpose of controlled release. Appl. Surf. Sci. 2015, 335, 121–129. [CrossRef] 25. Chen, M.; Patra, P.K.; Warner, S.B.; Bhowmick, S. Role of Fiber Diameter in Adhesion and Proliferation of NIH 3T3 Fibroblast on Electrospun Polycaprolactone Scaffolds. Tissue Eng. 2007, 13, 579–587. [CrossRef] [PubMed] 26. Ishikawa, J.; Tsuji, H.; Sato, H.; Gotoh, Y. Ion implantation of negative ions for cell growth manipulation and nervous system repair. Surf. Coat. Technol. 2007, 201, 8083–8090. [CrossRef] 27. Schmidt, D.R.; Waldeck, H.; Kao, W.J. Protein Adsorption to Biomaterials. In Biological Interactions on Materials Surfaces; Puleo, D.A., Bizios, R., Eds.; Springer: New York, NY, USA, 2009; pp. 1–18. 28. Ruoslahti, E. Fibronectin in cell adhesion and invasion. Cancer Metastasis Rev. 1984, 3, 43–51. [CrossRef] [PubMed] 29. Qin, S.; Ricotta, V.; Simon, M.; Clark, R.A.F.; Rafailovich, M.H. Continual cell deformation induced via attachment to oriented fibres enhances fibroblast cell migration. PLoS ONE 2015, 10, e0119094. 30. Chen, Z.G.; Wang, P.W.; Wei, B.; Mo, X.M.; Cui, F.Z. Electrospun collagen-chitosan nanofiber: A biomimetic extracellular matrix for endothelial cell and smooth muscle cell. Acta Biomater. 2010, 6, 372–382. [CrossRef] 31. Masuda, T.; Ohmi, K.; Yamaguchi, H.; Hasegawa, K.; Sugiyama, T.; Matsuda, Y.; Iino, M.; Nonomura, Y. Growing and differentiating characterization of aortic smooth muscle cell line, p53LMAC01 obtained from p53 knock out mice. Mol. Cell. Biochem. 1999, 190, 99–104. [CrossRef] 32. Gnavi, S.; Fornasari, B.E.; Tonda-Turo, C.; Laurano, R.; Zanetti, M.; Ciardelli, G.; Geuna, S. The effect of electrospun gelatin fibres alignment on schwann cell and axon behaviour and organization in the perspective of artificial nerve design. Int. J. Mol. Sci. 2015, 16, 12925–12942. [CrossRef] 33. Jalvandi, J.; White, M.; Truong, Y.B.; Gao, Y.; Padhye, R.; Kyratzis, IL. Release and antimicrobial activity of levofloxacin from composite mats of poly(e-caprolactone) and mesoporous silica nanoparticles fabricated by core-shell electrospinning. J. Mater. Sci. 2015, 50, 7967–7974. [CrossRef] 34. von der Ohe, P.C.; Schmitt-Jansen, M.; Slobodnik, J.; Brack, W. Triclosan—the forgotten priority substance? Environ. Sci. Pollut. Res. 2012, 19, 585–591. [CrossRef] [PubMed] 35. Robinson, A.A.; Belden, J.B.; Lydy, M.J. Toxicity of fluoroquinolone antibiotics to aquatic organisms. Environ. Toxicol. Chem. 2005, 24, 423–430. [CrossRef] [PubMed]	517ba206-9649-4fda-a16f-34b3d9ffc336	CC-MAIN-2020-50	https://strathprints.strath.ac.uk/66806/1/Barrientos_etal_Materials_2019_Biological_performance_of_electrospun_polymer_fibres.pdf	2020-12-01T00:11:38+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-50/subset=warc/part-00114-8431e8c9-c763-4c27-b286-ba1dd7e2631e.c000.gz.parquet	510,974,517	10,472	eng_Latn	eng_Latn	0.889571	eng_Latn	0.979421	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 3672, 8376, 12250, 16101, 16897, 18880, 19378, 20924, 22068, 26875, 31609, 36043, 40454 ]
Theory of Change: Sustainable organizations are better able to deliver improved programs and positive outcomes for clients. Sectors that collectively advocate, innovate and collaborate are resilient in the face of economic, political and other environmental changes and can guide solutions. Program Goal: Build and sustain the capacity of Polk Bros. Foundation grantees, and the sectors within which they work, to thrive, meet goals and serve clients effectively. All proposals submitted to the Foundation should adhere to one of the following strategies: STRATEGY A Organizational Development (Proposals by Invitation Only) Target Population: Polk Bros. Foundation grantees that are seeking to build capacity in one of four key areas: * Financial planning and management * Marketing and communication * Technology improvements * Strategic restructuring and mergers Components * Defines an organizational need or issue based on internal and external research * Partners with an outside expert to develop a plan that addresses the issue or facilitates the implementation of an existing action plan * Identifies anticipated project outcomes and timing * Demonstrates buy-in and sustained commitment for the project from the board and staff Evaluation Criteria * A written action plan to address the identified need with benchmarks for progress and a timeline for implementation or the actualization of a plan that demonstrates progress toward resolving the issue * Demonstration of improved processes that will lead to greater reach, impact, or efficiency * Development and application of a clear method for evaluation and use of data to inform continued improvement STRATEGY B Strengthening Sectors Target Population: Polk Bros. Foundation grantees and the sectors in which they work Components * Organizes and coordinates the provision of technical assistance and advocacy training within a sector * Works collaboratively with an engaged cohort of service providers to effectively define and address needs or issues that can be most effectively addressed * Develops a clear action plan with participant input that includes benchmarks for progress, defined organization and sector goals, and anticipated outcomes and timing * Offers opportunities for cumulative learning to promote effective systems integration and improvement * Advocates to advance effective policies and practices Evaluation Criteria * Demonstrated progress toward resolving specific sector issues * Documentation of learning that will lead to greater reach, impact, or efficiency for participating organizations and the sector * Description, number and length of activities * Number of staff from participating organizations, including number who attended multiple sessions (meetings to create action plans, learning opportunities, etc.), and total number of organizations * Collection, assessment and dissemination of evaluation data that informs ongoing sector development	<urn:uuid:74a56cc7-da05-49ec-9696-3984567e8071>	CC-MAIN-2018-13	http://www.polkbrosfdn.org/pdf/EnhancedCapacity.pdf	2018-03-21T20:09:32Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257647692.51/warc/CC-MAIN-20180321195830-20180321215830-00532.warc.gz	467,809,051	515	eng_Latn	eng_Latn	0.988609	eng_Latn	0.988609	[ "eng_Latn" ]	false	rolmOCR	[ 2961 ]
Introduction This customer satisfaction survey was conducted by Consumer Direct Care Network Colorado (CDCN) under contractual obligation with the Colorado Department of Health Care Policy & Financing (HCPF). Home and Community Based waiver Medicaid clients receiving Consumer Directed Attendant Support Services (CDASS) in Colorado were surveyed regarding their satisfaction with the services provided by their Financial Management Services Agency (FMSA). This report 1 is specific to PCG Public Partnerships (PPL), but summarized survey results for all three FMSAs are included on page one for comparison. Methodology CDASS service recipients were asked through mail survey to rate services provided by their FMSA. Survey questions were developed jointly by HCPF and CDCN staff. Questions focused on key components of the FMSA's responsibilities toward customer service, web‐based systems functionality and accessibility, and employer and payroll functions. The back page of the survey allowed for open‐ ended comments. Prior to survey mailing each FMSA supplied a mailing list of their current CDASS clients to CDCN in an Excel spreadsheet. Using those lists, CDCN mailed surveys to 3,537 CDASS clients on April 28, 2020. Survey recipients were asked to return completed surveys by June 3, 2020 in an included postage‐paid envelope. Data entry and analysis of returned surveys was conducted by Quality Improvement department staff at the CDCN headquarters in Missoula, Montana. Comments were data entered as close to the hand written text as possible, and include the respondent's spelling, punctuation and use of abbreviations and symbols. Client name and contact information was removed or redacted from comments. A numeric five point Likert rating scale was used on each survey satisfaction question, with 5 being best or most satisfied, and 1 being worst or least satisfied. A N/A or "Not Applicable" choice was provided for each question, allowing the respondent to opt out if that question did not apply to them. Satisfaction ratings for each question are expressed as a common arithmetic average. An overall satisfaction rating ‐ the weighted average for all questions is also presented. Results Summary All FMSAs 1This report is intended for review by HCPF only, and is not for public distribution unless authorized by HCPF. All returned surveys are being submitted to HCPF. The electronic data entry spreadsheet file is available to HCPF upon request. June 17, 2020 Page 1 of a Blank Survey (for reference) June 17, 2020 PCG Public Partnerships (PPL) 2020 Client Satisfaction Survey Report Page 2 of a Blank Survey (for reference) June 17, 2020 PCG Public Partnership (PPL) 2020 Client Satisfaction Survey Report PCG Public Partnership (PPL) Survey Results * N = total number of responses for the question June 17, 2020 Written Comments PPL LLC. IS NOT THE COMPNAY THEY REPRESENTED THEMSELVES TO BE! VERY DISSAPPOINTED Change to the time sheet data entry in July 2019 exponentially increased the time it takes family member providers to enter time sheet data. Elimination of time sheet templates resulted in time sheets for each pay Period requiring individual entries for each activity. Family member providers now have to make individual entries for each time period they are administering medications, checking vitals, making bed, etc. End result is time sheets averaging 95 individual time entries, most for 15 minutes or less, for each Pay Period. Bring Back Timesheet Templates!! A person I'm trying to hire has called several times to the open enrollment over the phone and still have not received a call back. They have been rude to me. They have insisted that someone else needed to be my authorized representative just because I used a communication device to talk on the phone. They complained that I talked too slowly for them. I have explained their attitude was discriminative but they haven't changed. They should be shut down because of the ways they treat people with disabilities. In my particular situation, the filling out of the time sheet is often difficult do to my changing needs. My attendant is having to do more for me since my husband was killed 18 months ago. He has to do my banking, phone, pay my bills, Handles Emails, going to post office, etc, etc. He has taken F.L.M.A from his 2nd job to lessen bringing home the virus by doing this he has not only lost pay, but jepardized losing his medical Ins. At preasent we are going through very unique circumstances (like everyone) my attendant (son) is with me 24/7 through this lock down. He even works with my doctor's on video chats I have been very pleased with the services I have received from Public Partnerships over the years. They have always answered My Questions, and helped with any concerns I may have had. The new online time sheet process is terrible + difficult for those who live with the client. I feel the attendants need more training as differant ones give differant answers to the same question. I'm NOT WITH THIS COMPANY ANY MORE. Paychecks have been late more than once. Time sheets have been submitted on time. I am dissappointed in the phone acess to our FMS provider. Sometimes we have to call back a week later because of no reply. There does not seem to be easy email access either. When we do make contact with PPL Staff they are always courteous, knowledgable and helpful. I also thought that due to the coronavirus there might be help from PPL regarding protection with masks, gloves + gowns/booties etc + where we can access these supplies. All experiences have been positive. has been an exceptional help. Thank you! Because I have both waivers there have been some difficulties with wrong service codes input for faxed timesheets. But every service rep I have contacted has been exceptionally helpful. (I would recommend a global fix). Thank you all for your good website, good forms, good problem – solving. Thank you for all you do! As a new administrative representative, I have appreciated the support & assistance! June 17, 2020 2020 Client Satisfaction Survey Report Written Comments We had more problems/set backs and the longest waiting periods every. No direction when bringing on new attendants. WAY TO LONG of a process. MISTAKE AFTER MISTAKE on behalf of Pub Part. Resolutions are timely + cost us money/time and getting people ON BOARDED. The only person who has ever helped, been able to resolve matters or get things is Supervisor . If it was not for her we would have changed companies! She needs to be applauded & paid better to compensate for everything she has had to fix! I was late to enroll in beginning. So I wasn't sure what I was to recieve. Never recieved any proper training, just called in for training, I must say your people on the phone were most curtious, easy to talk to and understand. Overall their training was excellent and proved to be all I and attendant needed to learn well. Thank you The services + ratings of PPL can best be described as erratic – depending on whoever answers my calls + their own training & competence. Usually, however, the people in your offices are mostly very pleasant, just unable to understand my questions or unable to answer them. Fortunately, being pleasant goes a long way for me. The paper work enrollment process is difficult. It is often Ambiguous what sections need to be filled by each individual. If there are problems with the paper work i am not notified, and have to call in during my working hours to get help that is often limited or confusing. Ive had e‐paperwork with other agencies work in a much smoother fashion. I think electronic paper work would ease the process because i am disabled and have trouble filling it out independtly. These difficult processes have negativly impaceted my work and school performance. Most inportently it has delayed vital income for my employees during this crucial time. And if employees can't be paid they will be significantly impacted and it will make a difficult to retain quality employees. This add additional barriers to the barriers that already exist with my significant disablity. Towards the end of us needing service in Feb + March + April – it seemed your computer program could no longer do simple math. It was a real mess and made staying within the budget difficult if not impossible. And some man refused to help me at all. But the women I talked to at least tried to help. They Never Answer the phone! As Far as Q#3; we get passed around or talked over or hung up on. Issues w/ payroll over and under payment happen Frequently. The Right hand doesn't know what the left hand is doing, very disorganized It is Quite Stressful NEVER ANSWER THE PHONE NEVER CALL BACK! Serve is great My caregiver is great and takes good care of me I am very satisfied with my FMS provider Services are excellent and my caregiver is excellent she is loving & caring Please fix your auto voice mail system. It is almost always wrong. Otherwise I am quite satisfied. carry – on! 5‐6‐2020 FMS WE THANK YOU FOR YOUR VERY GOOD SERVICE. EVERY THING IS DURING FINE. VERY NICE OK. YOU ARE VERY profesonel AND KIND. LET US ALL STATED SAFE. THANK YOU EXCELLENT JOB – GREAT CUSTOMER SERVICE HELPFUL – ONTIME. June 17, 2020 Written Comments We have an employee who somehow got taken off direct deposit. When called she was told her info on bank was on file & unsure why this has happened for mos. now. Still not fixed. Also switching AR's was a nightmare for employees w/ payroll. Plus no heads up about it. Overall, grateful for program. Thx – Very difficult to resolve issues. It takes multiple calls back and forth to get anything done. – Worse yet is when we return a call from Public Partnership. The message will say to contact Public Partnerships but doesn't indicate what is the reason for the call. When we return the call the agent ask what the call is regarding. We can't answer that because we have no idea. We've had multiple occasions when this has happened. The agent can't resolve anything because neither of us know why Public Partnerships contacted us. Maybe you could assign issues Case Numbers. Then when Public Partnerships calls and leaves a messg with a case number we can call back and reference that number – New time card are very very akkward!! – Should be able to see all of the paycheck info broken out. Gross Net and all deductions. That's just standard!!! Extremly thankful for the Program. Always Profesional and answer all and any questions! It is sometimes difficult for those of us who are not computer savy to get signed up or recieve training on line. Had a rocky start with time sheets, but I think we got the hang of it. I hope. I've Called Customer Service So many times I'll have to invite them all over for a meal (lol) Everyone I've talked to has been very helpful and very patient. The check in and out times requirement is enormously frustrating. In reality accounting for every function of every minute is impossible especially when service type times overlap. The pervious methed, though a bit cumbersome, was much better. Also, forcing the requirement of going online to enter times is unfair to persons in rural areas with limited or no access to dependable internet service as well as clients and employees with limited or no computer skills. There should be an exemption from this mandate upon request. I've spoken with other PPL clients who are as equally frustrated with both issues listed above. – Customer Sve can be rude more often than not – Website is (to pay my attendents) unrielable, duplicates entries etc – Customer Service people do not have the same answer for Questions... "Roll the dice" to get a straight answer or that a different C.S. person would does give you something totally different – Why haven't I changed? Because @ least I know this nightmare If something work don't change it. If there is extra monies available, think about paying the providers sick leave, Adm Leave, or vacation as this always helps to keep good people interested in staying with the clients being serviced. Also, giving them health insurance at a much lower rate. Awards to help build positive attitudes. Team Building Insentives I can not understand some of the forien workers That answer the Phone! A paste copy option on website June 17, 2020 Written Comments TIMESHEET PROBLEM WE USED TIMESHEETS THAT WERE MAILED TO US – WHEN THE NEW STSTEM OF TIME IN – OUT. WE WERE SENT THE WRONG TIME SHEETS. THIS CREATED A CONSTANT PROBLEM FOR MONTHS. IT WAS FINALLY RESOLVED BY SOMEONE OTHER THAN THE STAFF AT CUSTOMER SERVICE. THIS PROBLEM SHOULD HAVE BEEN RECOGNIZED & RESOLVED MONTHS EARLIER. MY ONLY REAL CONCERN IS W/ C.S.V. NO ONE ANSWERS, CALL BACK HAVE BEEN AS MANY AS 10 DAYS, AND MATERIALS I REQUESTED HAVE NEVER BEEN FORWARDED (5 YRS) I'D LOVE TO HAVE SOMEONE, WITH TRUE UNDERSTANDING OF OPERATIONS, TO CALL ME. I'L LIKE TO PUT TO BED. Tks 'Excellent' 'Keep it up' PPL should upload Background Checks for the Clients ASAP. PPL did NOT catch 4 of 7 attendants background FAILURES for very bad crimes and misdeameanors. Each of them was horrible for me. And I wasted 250 hours of training! And tremendous stress for me. PPL should have computer‐fillable forms that reduces work to fill out paperwork. PPL should have computer‐screen‐readable forms that are compatible with allowing the computer to read aloud the text on the screen. PPL is NOT ACCESSIBLE because of the last 2 points. For the 1st two points, I should sue PPL! And if PPL failed on multiple attendants' background checks, this was NOT a one‐off mistake. The questions asked don't correspond to the problems with PPL enrollment and use formats. Since switching from ACESS, the problems have been constant, the lack of training and receipt of information appalling, and the time I've spent on the phone or waiting for a call back excessive. Problem #1 – No contact about errors made on paper timesheets, even though no training or instruction was provided. Attendants were just not paid, even when PPL's outdated scanning equipment didn't work, or procedures were changed w/o informing me. I spent hours on the phone dealing with old timesheet format until I was told there was a new paper t.s. I should be using. Problem #2 – Switch to Better Online. My attendants lack the technology, or in 1 case, the ability, to input online. No training offered or available to me to assist other than many more hours on the phone with customer service. Problem #3 – Direct deposits often late* even when t.s. are approved + submitted on time. * This has improved recently. I invite you to give me a call for more! Website continues listing "Medicaid not Eligible" and "pending" when I know Medicaid is active. This usually corrects a few days after timesheets are approved. However, such a notice when it is not accurate is extremely distressing I havent called for a while, but when I did most of the time no answer. I left emails and call back numbers but rarly got a call back. I had to keep calling until someone answered. Lately it has gotten better. I have had some return my call. Most could not answer my question to my satisfaction. However I did have a man take my call who was very polite and knowlegeable and answered all my questions perfect and to were I could understand the answer. I do not have his name at the moment. I wanted you to know that there is one employee there that I was very satisfied with. Services A great I'm satisfied Nothing to add! June 17, 2020 PCG Public Partnerships (PPL) 2020 Client Satisfaction Survey Report Written Comments The template timesheet were much easier and faster as most of my attendants work the same hours every day. Sometimes the mailed checks are a little slow to attendants. The last few new employee packets have taken quite a while to be reviewed and approved. Sometimes I have a hard time contacting my PPL advisor. I will leave messages but not hear back. It use to be easy to contact her. Maybe her case load is too large. Having issues using portal. Called several times trying to get help. Overpaid employees due to wrong submitting on PPL side. Problems with website not having accurate information. Frustrating! Thank you for doing a great job so I don't have to spend extra time with administration. Hi! Everyone that I ever talk with about ANYTHING! they have been great! My answers are always answered in a timely manner and easily understood. All of your guys and gals that you have are great! I do so appreciate you all. You have made my life easier and less worry filled. Thank you for all that you do! Never able to reach a customer service agent by phone. I prefer to stay with P.P.L All questions ans. are for my satisfaction for PPL I have been with PPL for 10 yrs and they the best. Always respectful, courteous, and helpful. Please keep up the good service. Received call from PPL that care provider who had been working for me for 7 mo. was no longer able to for Medicaid d/t background check (that was performed when provider was hired 7 mo ago) The problem was brought to PPL's attention by a "state audit." I was told by PPL that it was their mistake in not catching the infraction at the time of hire. This mistake caused me many problems & was very stressful to the provider & the client. I am surprised PPL is still an FMS choice for CDASS after overlooking many issues I am now changing FMS providers. Put a rate change paperwork in told it was received but it was never input. Called a 2nd time and spoke to a supervisor, told again it was done only to find out it wasn't. A 3rd time I asked for a Supervisor, got + she took care of it. Poor communication. Not happy at all. Time 4 CARE APP Not working correctly. Not opening properly. I am really upset! I have a new attendant who started in March. I am home bound, have no computer and my employee doesn't either. So – we fax in time sheets. Her 1st time sheet in March she never got payed. The 2nd one she never got payed and the one for the 16th April – she called twice and finally got that one a couple of days ago. The same things applies to my worker – there are a couple sheets she never got payed for. It's awful because they won't work if they don't get paid! Service is Great! I really don't care for new formate for enteries or processing them. There are times I have to go back and forth just to get on web site! NEED MORE THAN ONE PHONE NUMBER FOR CONTACT OR MIGHT GIVE OPTIONS FOR THE REASON OF THE PHONE CALL SO WAIT TIME NOT SO LONG. TIME SHEETS NOT ALWAYS READ RIGHT. FOR INSTANCE 6:30AM TO 8:00AM DOES NOT ADD UP TO 1 ¼ HRS AS WE WERE PAID! WHO OR HOW THESE ARE READ NEEDS IMROVEMENT. WAS NOT TOLD CORRECTLY HOW TO FILL OUT NEW TIME SHEETS IN THE BEGINNING & WE WERE THE ONE WHO PIAD FOR THE ERROR AS WE DIDN'T GET PAID FULLY! June 17, 2020 PCG Public Partnerships (PPL) 2020 Client Satisfaction Survey Report Written Comments The client lives in our household. We are all relatives who care for the client. The purposed tracking of employees is ludicrous for us. We live here. There should be some sort of exception to this tracking thing for family members. None of us feel comfortable with it. Talk about "big brother'! Person recieving paper checks have to wait until almost time to put in for the next pay period. HAD A STROKE – DEC 2009. HER LEFT SIDE WAS AFFECTED. SHE HAD THERAPY BUT WAS IN A WHEEL CHAIR FROM THEN ON. HER CASE MANAGER CONNECTED US WITH CDASS (PPL) FOR IN HOME CARE. CASE MANAGER WAS . WE USED PPL (CDASS) FOR YEARS. WE ALWAYS HAD EXCELLENT SERVICE. PASSED AWAY APRIL 04‐2020. THANK YOU VERY MUCH FOR ALL YOUR HELP. WE WOULD RECOMEND THIS SERVICE TO ANYONE WHO NEEDS IT. Everything with you is so much easier then when I was Agape. You all make things easy to understand. So happy that I heard about you. Thank you all so much Have messed up 2 employees time sheet every pay day since November 1st, 2019! Hard for AR to get through to people. Employee called on Wednesday to start a track on her paycheck & was told that she would have answers today & when she called, they only confirmed they knew her check was deposited but hadn't even began the tracking as to where it was deposited! Told her they would call her in a week! Timecards were due again today so it's likely she'll get this new pay periods time sheet before last pay periods! Won't give her a new check until they figure out their error! Not right when I can't pay these people! THANK YOU! PCG Public Partnerships Your computer system is LOUSY! It takes much longer to fill out timesheets than it used to! After 20‐30 minutes, your system erases everything & we have to start over ‐ OFTEN! When we call for help because once in a while the system will not work with our Safari browser, we're told to change our system rather than PCG making necessary changes. We get calls and letters without clear instructions but when we call to ask questions no one answers. Recently, I received the letter about background checks. When I called the phone # listed, I tried 9x and couldn't get your system to recognize the last 4 digits of my social security number so I never did get through to a person to ask questions! We appreciate CDASS for our client but are extremely frustrated by your systems! Thank you for very professional, polite, great servise. I have not tried to call for assistance with online submissions, but the available "help" on the web site of PPL is lacking. They should have a FAQ section with helpful answers to common questions. Good Job! Keep up the good work. I would just like a little more knowledge and training on the way the cost to you is calculated, also how to make sure I do not go over budget, and what back‐up plans, fluctuations, or reserves are avaiable. My employee didn't get paid for period 1/1‐/2020‐1/15/2020. My time sheet was faxed 5 times I was told it was not received or it couldn't be read. I was told to fax it again. I was also told that after 24 days it couldn't be paid. Finally they sent a check for 3 days, the 13th, 14th, & 15th. Your service has been excellent. I have always gotten return calls promptly and always got great service. The attendants are nice and seem to understand anytime there is a problem or confusion. June 17, 2020 Page 10 Written Comments I will take a moment to thank the program CDASS, PPl, especially my casemanger : I've never had better care or service within any program ever; the program is so efficient that my caretaker goes beyond her job to care for me; I feel safe, healthy despite medical issues, the program putting the responsibilities in the hands of the client has kept me on top of all things needed: hours and services received. I love the transparency and my questions have always been answered, my case manage is the best, kind, caring with occasional checks, calls just to make sure all is well, always returning my calls within 24 hours and I just could not be happier with the program or my case manager Thank you for your part. The staff is always courteous and helpful. A few times a year (1x month) the website is slow or down while submitting and/or approving timesheets. I have enjoyed worked with the PPL team. My Account has been messed up Since last June and have been trying to resolve and catch up on payment to client service. May is coming to an end and I find they are always pending and then the client loses out. Payment is to slow getting to client after submissions of payment Through the pandemic people dont respond or call Back Very dissatisfy to me I get different answers to my questions ea time I call. So after being on hold for a long time I ask my questions & dont understand why their answers are different than last person, so will ask for supervisor. Then Im back on hold & sometimes get disconnected & have to start over back on hold. Then I just ask for a Supervisor next time, they have to know why so I have to explain again. Its always a long ordeal to call & I can't trust what they are telling me. Train them better! They all should have same answers to my questions. Often the questions I have cannot be answered by CS reps. They are limited in their help. Often I need to speak to a supervisor. Within the last 2 months PPL said I did not have Medicaid and ACM/CDASS said I had Medicaid but PPL refused to contact CDASS so I had to shuttle information back & forth.* (FYI I did not lose Medicaid). I will no longer recommend PPL. To resolve the issue. I have had CDASS over 3 years. Customer service has got to be more knowledgeable and more friendly. Very rude staff. Wanted to hire a new attendant care provider who was working through PPL already. Imagin my shock when I was sent a letter stating "Recently, it was reported to us that a individual seeking to become an attendant for a CDASS member had not passed a portion of their background check but was made "good to‐go" in PPL's system. After immediately reviewing our records, we were able to determine that this individual had inadvertently been approved to delver services due to a manual entry error! Shock!! Your company is dealing with the most vulnerable of individuals who are susceptible to abuse, and this was a manual entry error?? Obviously check and balances are not a part of your companies philosophy. I wonder how many times this has happened. Are there rapist, child molesters or worse working with individuals who are unable to communicate what is happening to them. The nonchalant answer "entry error" discusses me. However your company did offer to run background checks on all my other attendant care providers. How about running background checks on ALL non family member attendant providers. Or is the cost to high and the clients are just open for abuse? This is NOT acceptable – And I will use this letter as exhibit A when someone is abused because of a manual entry error! June 17, 2020 Page 11 Written Comments I filled out a rate change form correctly, but it was incorrectly entered into the CDASS payroll system. This took 3 months to correct, and was corrected only by submitting a change form (3rd try). Need better data entry performance. They are unprofessional, checks are always late, and it's almost impossible to get on the phone with. Often there are time sheet issues and when my employee call the support line sometimes they are helped and sometimes I have to call when it really has nothing to do with me. The website just isn't that great. The amount of things I have to call for on behalf of the employee is too much. They should be able to get their questions answered. As a quadraplegic (sp) there are times, due to my breathing ability, I have to have my attendants convey the info 4 me. PPL customer service is very accommodating & at the same time they verify the identity of the individual I am asking to convey the info for me. – every time The extra layer of security I love – Thank You – I am very happy for your help – My health is not to good – so I got alot stuff to fix (hip) (knee) and Toe work. Getting around pretty good. My caregiver is my daughter and she does a good job Thank you Some staff members do not answer timesheet information when they are asked about it. On 4/30 I faxed 3 timesheets I called in on 5/1 Timesheet info said it received 3 timesheets 2 on 4/3 to be verified hours the other is said was received on 5/1 for 37 hours ‐ I talked to and he said he had no time sheets but after I told him the timesheet info on phone had time sheets then he said he had 1 for 37 hours and not the other 2. He said to call back 5/4 Last pay period 1st half of April everything was fine – I shouldn't have to call in every pay period to check on my employees timesheets When you contact PPL sometimes they just [illegible] call/contact you back. We have always received a high level of service and the providers have been so helpful and always courteous. We are extremely happy. Thank You! To much material that had already gone over with me by my case worker. Packets to long or to much to understand very complex. Not sure why my case worker asked for this I was told it would be to help with PPL & increase there paying my workers on time and to generally help with the PPL which remains difficult to deal with. This program was directed at my case worker rather then PPL I would appreciate feed Back or confirmation that paperwork is received and/or approved by PPL when sending applications, raises, change of address, etc. Would just like to say thank for all your services and help through these trying times. Thank you June 17, 2020 Page 12 Written Comments CDASS Program has been very beneficial for me. The only major problem I have had is, getting/keeping in touch with my Case Manager ( @ Public Partnerships of Colorado). I do not use computer "mail" very well and would really appreciate if either verbal phone calls or "old fashioned" paper mail documents could be used – to answer my requests, and, give paper documents for hours available each month. These are not "complaints", but a very important request in help with keeping track of hours available at beginning of contract year. I do receive monthly documents, but I dont understand how it gets subtracted each month. Any assistance would be greatly appreciated. Someone to walk me thru would be best. Customer Service personnel are very helpful, but questions for Case Manager do not get approached in a timely or personal manner. Hi, I was pleased to see that the timesheet portion of the web‐site was updated. Kudos! It is not perfect but it is much better. There are two serious bugs that really need to be fixed. 1) The total number of hours at the bottom of the input page does not get updated after a current entry is edited. It becomes current when a new entry is made. 2) The button to delete an entry has disappeared. Feel free to contact me if you need anything. Just want to say "Thank You" for providing these paid services for these family members who choose to take care of their own family, as opposed to utilizing a Nursing Home. We are pleased to have this service as we take care of our Mother in this time of need. We appreciate all the services you provide and I have had all my questions answered and taken care of by your staff. Thank You The website seems to have issues accepting timesheets many times. This company should not be part of CDASS. They can't answer questions admit they aren't trained & response is non‐existent or lagging. Horrible Service I have had issues with PPL several times this past year. Unusually slow response times & sometimes nonsensical answers. I've had 3 occasions to request a Supervisor contact me in the past 6 mos. I would consider a change but at this point I know what to expect & try to work around it. In all fairness, part of the problems were caused by our case manager disappearing & no contact from the agency for months. We have a new case manager so hoping things improve this year. Thanks! I am tired of asking PPL to listen to my concerns or issues working with them. If it truly matters to you to fix the issues then I ask you call me They provide very good customer service & the people are always very courteous & helpful. Thank‐you for all your help. was friendly when she did my retraining for time sheets (when I went over). June 17, 2020 Page 13 Written Comments My caregivers are getting paid on time however they are having difficulty getting direct deposit set up. Three caregivers have had the same issue. Entering time for timesheet is too time consuming. 1) We have never wanted to change from ppl. 2) This new time punching that is coming is outrageous. I am in my home & will have to punch in 3 times a day & then set a time/alarm clock, so that I punch out on time for the amount that is allotted to us. This is going to dominate me for the rest of life. Haven't we had enough to do? I can't steal from the budget. If I go over during the year, then at the end of our fiscal period I will just get a little check or no check. I don't know why that burden has to be put onto those of us who are married. 3) You also forced us into that FEA program. Now my soc. Security statements show "no income" for years. Therefore, I will be getting less Soc. Ser for the rest of my life after I file. How fair is that? I don't know why you have to penalize us for being morally married which is not popular now a days & make everything more difficult & time consuming as we age. The email are 90% in Returning email. However they are very good at explaining it. That everything runs smoothly and that we understand the problem and get it right. The going over the budget is still and little hard, but the guy I Talked with explain it. So I have to be careful when I add the hours. I was on first month with changing their rate pre‐hour. I'm still not understanding it and will still keep trying. My case worker do out this month for home visit. I'm really happy at the with PPI and am glad to have the help I get. The only problem is time sheet that once it goes in you getting finished it will sit for days to get the approval and paid. I can count on the checks on 7th or 22nd of each month it just seems to sit in the. They are excellent! I haven't had to deal with customer service for at least a year. I don't like the new time sheet that requires specific times and categories. It's really hard when it's a live in caregiver. Also we've had a lot more errors with the system being unresponsive. Also my attendants time doesn't always match the time I can see. For example it will say she has 80 hrs on her account but when it's submitted to me it says she only has 79 hrs, so it's not giving her all her time that shes worked and it's confusing. We didn't start having this issue till the time sheet submission changed. Need more training on online time sheets. PPL messes up on employe's time every time (checks). We get different answers everytime we talk to someone. This process is very frustrating We are in‐home attendants to our member and with EVV, we have been notified that we won't have to do the instant time recordings in a letter from our case manager. The letter was written by Colorado Medicaid and said our FMS would be in touch on what to do. After a week of hearing nothing else, I called our FMS and told the person I wanted guidance on how to fill out the forms from the letter and I had questions about our change in the EVV in July. The person said they knew nothing and couldn't answer my questions. She assured me that my FMS would get in touch when state Medicaid had trained them. This leaves me scratching my head. Once we got finally enrolled with this FMS, everything worked very well except for the above‐mentioned issue. June 17, 2020 Page 14 Written Comments We are extraordinarily disappointed with PPL as our FMS. From the very beginning mistakes have been made. Getting them corrected has been a nightmare. We are changing to a different FMS ASAP! To say that PPL had done a poor job would be an understatement. One of my attendant submitted W4 and DOC paperwork weeks ago and it has still pot (sic) been properly processed. This costs him $800 every month! This is unexcusable. We are changing to a different FMS. 1) Our training was done by Accent Intermediary Services and was excellent. From our experience with other aspect of PPL I do not think they would be as good. 2) PPL has not been very helpful or timely in processing employment packets. They do not notify you if there is a mistake unless you contact them. Sometimes the person you talk to is not aware of what phase of approval the paperwork is in and has even told us that they have not received it when in fact they have. It is usually the case that a ''Start Date" is delayed by a whole time period. At least twice when we have faxed in "Change of Rate" forms for 3 employees only the top or first one gets approved and we have to repeat the process for the other 2. When you fax them anything you don't recieve an acknowledment even though I have a report of a fax being sent to them from my machine they will tell me that they did not recieve it. It would be great if there was a way to know that the paperwork was recieved and being processed. We are so grateful for the CDASS program! It has made such a difference in our lives that dad can stay home and care for him so I can work and know he is well cared for. Thank you! I do not like your phone system. The first level can not help someone who's been in CDASS for 18 years. I am a client for 18 years and an Authorized Representaive for 7 years. I am always the one who calls PPL because if I have an employee call they get told to call me. I think you should have assigned Case Managers or teams so that we as members have someone who knows about our cases and the different aspects of them. I get different answers from supervisors because they are seeing over to many states at the call center. I have gotten to the point that I only except answers from one person. I would like PPL to help provide local references for competent CNA help in Lake and Summit counties, in Colorado. Great Job! Keep it up. Your people are very nice but never have the authority to fix things that are wrong on your system. It takes Day or weeks for some "unknown" or "uncontactable" person(s) to actually fix things which I think is stupid The new time sheets are HORRIBLE!!! Liked the way it used to be, was a lot easier for sure!! Please go back to the way it was years ago. Issues: Late notification ‐ When there is a problem they notify my at the last minute. When they need any kind of document and there is a deadline, they notify me last minute. And also they can't answer me when I asked why is this needed at the last minute they can't answer that. So I specifically asked if they can contact me at least a month prior to the expiration date. Their response is we'll try our best. Sometimes you get several different responses for the same question from the customer service rep Theres alot of changes going on which makes it difficult for someone with disabilities to keep up with and many people on disability dont have technology or money to maintain the cost of web internet. June 17, 2020 Page 15 Written Comments #2 – Do not have computer skills so have to have help. #4 – Talked to 3 or 4 people and finally found someone to help – our workers are great and we have very little turn over so sometimes we need extra help – one person we tried to get never was accepted and she was soooo good. After two years we are submitting her again. #4 – during the transition one worker, who does not do computer never was paid for 2 months work ‐‐‐‐‐‐‐‐‐‐‐ and yes we talked to several of your staff. Not complaining – just listing facts. We are very thankful for this program and the help we get for our very handicapped granddaughter. 1. Non verbal Autistic 2. grandmal seizured – twice she was addmitted to the hospital – these are getting better 3. Huntingtons, which will only get worse 4. incontinent There are many issues with contacting my issue is you never get a person when you get a callback its to tell you you have the privilege of sitting on hold. I have figured out most things on my own through trial and error. I am not looking forward to the mess when electronic verification starts since its 5/28 and I have not received my instruction yet. I have 2 clients and they will get the same rating Would not recommend PPL. There are so many fluctuations in the knowledge of agents when you to call in for assistance. When encouraged to email; many times there is no reply. I have had mostly single mothers as my son's caregivers and it is horrible that most times they need to wait a whole week for their paycheck. The paycheck for the second half of the month (15th‐30th) is not deposited in their accts until their rents are already due! This creates an unnessary burden and caregivers are hard to find – Thank you Thank you for your support or any question. We really appreciate the EVV website for our employee's. Keep up the good work! I thank ya alls very much. Don't know where I would be without you and my Aides. Ya alls rock. And I refer you often. Thank ya much again. The most challenging part of the program is having to submit the timesheets online. The paper & fax was much easier for us. There are times we can't get to a computer. Or the internet is down. It would be great to be able to have the option to do online of fax! Thank you Have Problems – enrollment taking as long as up to 1 month to complete. The CDASS website needs to be updated in the area where we print out the forms for new employees including W‐2 and Homeland Security forms. Also the current address in which to send these forms needs to be updated. Thanks Thank you Thank you Very concerned about the up coming new EVV reporting – I do not know how to use smart phone to approve time sheets – attendants understand and have smart phone – I use a land line – I am hopeful that I will still be able to view + improve time sheets using my computer Very happy with all services and greatful for the Program. It has made me healthier & happier and more secure about Myself. I thank all individuals involved they helpful and knowledgeable, and they care! Thank You! June 17, 2020 Page 16 PCG Public Partnerships (PPL) 2020 Client Satisfaction Survey Report Written Comments Staff has always been very courteous, professional, and helpful. Training and training resources were well done and well delivered. Website and online resources are intuitive and easy to use. CADASS coordinators is great. – How ever CDASS needs to coordinate w/ healthcare agencies to leverage care takers. Family cannot be the only option. It's HARD finding staff. I have to go to Craigslist, Facebook etc. Need more coloboration w/ health care agencies. It's a 2‐way relationship that helps both sides. PPC used to provide help to find new employees they no longer do this but instead have provided an outdated list of former employees. It will be helpful if P.P.C. can provide more assistance than they currently do for the future. Everything is "cool and groovy". PPL is great. June 17, 2020 Page 17 Written Comments The survey response rate was 18.4% with 561 surveys returned out of a total of 3,051 mailed. June 17, 2020 Page 18	<urn:uuid:476c8be2-142c-4a4f-98e6-f152dcb03ba2>	CC-MAIN-2021-21	https://consumerdirectco.com/wp-content/uploads/2020/07/HCPF_CDASS-2020-Survey-Report-PPL-2020-06-17-Final-1.pdf	2021-05-18T19:39:56+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-21/subset=warc/part-00172-2bb1ba05-1421-4b90-a3f4-bbc46b4a29a5.c000.gz.parquet	181,881,652	16,856	eng_Latn	eng_Latn	0.896961	eng_Latn	0.999427	[ "eng_Latn", "unknown", "dan_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2497, 2554, 2682, 2861, 6113, 9333, 12422, 15635, 18980, 22447, 26087, 28800, 31578, 35029, 38529, 41634, 42536, 42671 ]
AMA Journal of Ethics ® December 2016, Volume 18, Number 12: 1232-1240 IMAGES OF HEALING AND LEARNING Blythe A. Corbett, PhD Autism, Art, and Accessibility to Theater Abstract Art has the ability to entertain and educate about many vital aspects of the human experience. Recently, innovative endeavors are providing greater accessibility to theatrical productions for people with autism spectrum disorder (ASD), prompting ethical questions about how accommodations to provide access to art and culture should be made, and for whom. This article uses an attributional model of stigma to explain potential differences in knowledge, attitudes, and behavior toward people with mental illness. This social cognitive model also provides clues about how to spur social change through translational education, familiarization, and advocacy to permit greater access to art for people with disabilities. I regard the theater as the greatest of all art forms, the most immediate way in which a human being can share with another the sense of what it is to be a human being. Thornton Wilder [1] Autism Autism (currently referred to as autism spectrum disorder, or ASD, and used interchangeably here) is characterized by significant difficulty with reciprocal social communication; narrow, repetitive, or stereotyped thoughts and behavior; and atypical sensitivity to sensory stimuli [2]. A number of brain regions have been consistently implicated in the neuropathology of ASD, including those involved in emotion processing (e.g., amygdala, hippocampus), social cognition and theory of mind (e.g., medial prefrontal cortex, cingulate cortex, temporal parietal junction), face processing (e.g., fusiform network), and executive functioning [3-8]. The neuropsychological challenges impact many areas of an affected person's life, impeding his or her ability to engage in many social, community, and cultural events. The overall prevalence of ASD, based on data collected from the Autism and Developmental Disabilities Monitoring Network sites [9], rose approximately 223 percent between 2002 and 2010 and in 2012 was estimated to be 1 in 68 children eight years of age (1 in 42 boys, 1 in 189 girls) [10]. Approximately thirty-two percent of these children have co-occurring intellectual disability (IQ < 70), 24.5 percent fall in the borderline range (IQ = 71-85), and 43.9 percent have cognitive abilities in the average or above-average range [10]. There is no doubt that autism is a significant public health concern with significant costs to the affected individuals, their families, and their communities [11]. In the United States, it is estimated that the lifetime cost per person with ASD is $1.4 million and, for those with co-occurring intellectual disability, $2.4 million [12]. In tandem with the significant increase in prevalence over the last several decades, there has been an evolution in how autism is understood, detected, and treated [13]. This once rare and mysterious condition is now broadly familiar to the public because of the dissemination of scientific information on and the familiarity of autism in the media and news. Despite the increasing prevalence and public awareness of autism, many parents of children with autism still struggle with the fact that their children are unable to engage in cultural and recreational activities. In particular, the hyper- and hyposensitivity to a variety of visual, auditory, and tactile stimuli can limit the ability of a child with ASD to partake in social activities [14]. For example, children with ASD often have difficulty attending movies due to the crowds, flickering lights, darkness, and loud noise. According to a recent report, children with ASD participate less frequently in community-based events than those without ASD due to a combination of social and physical barriers and fewer supports [15]. Moreover, attendance at events is often limited by their affordability and accessibility. However, efforts by people outside of traditional therapeutic settings are providing new opportunities for people with ASD and their families to engage with an essential part of human culture: the arts. As described below, people with autism and their families are finding acceptance and access through participation in theater. In the process they are helping to remove the barrier of stigma and embracing their right to engage in and with the community. The Value of Art and Theater for People with ASD William Bennett The arts are an essential element of education, just like reading, writing, and arithmetic.... Music, dance, painting, and theater are all keys that unlock profound human understanding and accomplishment. [16] There is much to be gained from seeing, hearing, and experiencing art in a variety of forms. Many people with ASD excel in art and use it as a way to express themselves and share their unique perspective on the world [17, 18]. Some propose that the arts have the potential to nurture talent, reduce stigma, and provide a platform for others to see the "ability" in disability [19]. Art also provides an opportunity for persons with mental illness, such as schizophrenia, to build new identities and community [20]. Theatrical performances—dynamic, engaging, and narrative—have the rare ability to entertain and educate about many vital aspects of the human experience. Attending plays and musicals may provide an opportunity for people with autism and other disabilities to stimulate their imagination, observe social communication, and experience storytelling in an entertaining and live context [21]. Should not such potential benefits be shared by all, even those whom some would argue may not fully appreciate the depth or breadth of the narrative? New and innovative endeavors by groups such as the Autism Theatre Initiative [22] and the Theatre Development Fund [23] have created "autism-friendly" performances of Broadway and off-Broadway shows to give people with autism unprecedented access to these forms of theater [21]. Accommodations such as brighter lighting, reduced sound, and preparatory story guides help make the experience less intense and stressful—and therefore more relaxed and pleasurable—for the audience. These initiatives have received rave reviews. After experiencing the supportive and slightly modified show, theatergoers with autism look forward to subsequent sensory-friendly productions with great anticipation, and some have transitioned to traditional theatrical performances [21]. Some theater-based programs use theatrical techniques as a form of treatment for children with ASD [24-26]. For example, studies we have conducted have shown that SENSE Theatre ® , a theatrical intervention program in which youth with ASD learn a variety of acting techniques with peer actors who model communication and behavioral skills, contributes to significant changes in participants' social competence, communication, cognition, and interaction skills [27-30]. Whether people with autism are onstage or in the audience, published and anecdotal reports [21, 28] suggest that the theater provides a distinctive setting where they may thrive. The supportive context, active role-playing, and dynamic learning environment of the theater foster the development of key social skills that children with autism most need to learn. Challenges to Making Theater Accessible to People with ASD Man is unique not because he does science, and he is unique not because he does art, but because science and art equally are expressions of his marvellous plasticity of mind. Jacob Bronowski [31] To what extent is society responsible for making art equally available to all? In particular, should theater be accessible to all people with disabilities, including those with autism? To what extent should accommodations be made and for whom? According to Article 30 of the United Nations Convention on the Rights of the Child, participation in the arts is a right, not a privilege [32]. It is the right of all children to engage in their communities and participate in cultural, artistic, and recreational activities in accessible formats. While access to arts is a right, many people have difficulty engaging in cultural and artistic events due to perceived barriers—namely, stigma. The vast majority (90 percent) of parents of children with ASD think that persons with autism are stigmatized, and stigma plays a significant role in predicting how difficult life is for the parents [33]. In addition to stigmatizing peer and adult attitudes, limitations of services (e.g., availability of support), systems (e.g., affordability), and policies (e.g., environmental arrangements) contribute to reduced access to community participation [15]. Unfortunately, stigmatization of people with mental illness is long-standing. The term stigma originates from the Greek practice of branding slaves who had escaped with a mark called a sigma [34]. Subsequently, the term was extended to refer to any mark for perceived conditions deviating from social norms [35]. According to Thornicroft and colleagues [36], stigma contains three primary elements: lack of knowledge (ignorance), negative attitudes (prejudice), and negative behavior (discrimination). Advanced by Corrigan, attribution theory provides a compelling social cognitive framework for understanding stigma [37]. Attribution theory is a classic model that helps explain how and why people attribute meaning to everyday events. In this model, causal attributions are based on the perceived locus of control (e.g., internal or external source), stability of the cause (e.g., extent to which change is possible), and controllability (e.g., the amount of influence a person has over an event to bring about change) [38]. For example, if others believe a person's behavior is (internally) caused and unchanged by interventions (stable) and that the person lacks motivation to change (limited control), then they might be less sympathetic to the person. It can also explain how the public selectively includes or excludes people from aspects of society, because the public may make attributions about the cause of the difference. Applied to mental health stigma, the model explains relationships between people's knowledge of, and their emotional reactions (e.g., fear, pity) and behavioral responses (e.g., helping, punishing) to, persons with mental health conditions [37]. In contrast to physical stigmas, most mentalbehavioral conditions are perceived as onset-controllable (having a preventable cause) and unstable or reversible, contributing to the negative perceptions that the diagnosed person is somehow responsible for their condition. Consequently, research has shown that mental-behavioral (e.g., drug abuse) stigmas evoke less sympathy and helping behavior than physically based (e.g., blindness, cancer) stigmas [39]. Therefore, one explanation for the perceived difference in access granted to people with ASD is the public judgments that are made about people with different disabilities. For example, survey respondents more frequently expressed fear and distrust of, and social distancing from, people with schizophrenia than people with bipolar disorder or autism [40]. Ostensibly, some view people with schizophrenia as being more to blame for their condition, less responsive to treatment, and more helpless. In another survey in which respondents were asked about mental disorders using positive and negative stereotypes, autism was associated with high intelligence and creativity, and schizophrenia was associated with danger [41]. The attribution model has far-reaching implications not only for explaining stigma but also for explaining how to bring about societal change by increasing knowledge of, and changing emotional reactions and behavioral responses to, persons with mental illness [37]. Familiarity with a condition like autism matters because knowledge of the disorder can decrease discriminatory behavior [42] and reduce social distancing. Moreover, survey respondents who were asked about individuals with a condition rather than simply about a disorder tended to be less negative and more compassionate [40]. These findings suggest that strategies that raise the visibility of individuals and not just disorders will be important for changing attitudes and behaviors. Efforts and programs that increase public awareness, education, and broader acceptance may alleviate the challenge of raising a child with autism [20]. These strategies can also be applied to other mental and physical disabilities. In this way, a translational approach that highlights similarities between disorders (e.g., between ASD and schizophrenia) rather than differences may be helpful in reducing social distancing. Since perceptions are inherently more negative for some disabilities, visibility alone will likely not suffice in garnering public acceptance of a given disorder. Advocacy is another way to challenge the attributions the public makes about people with mental and physical disabilities. Caregivers of persons with autism have been extraordinarily resourceful, relentless, and creative in their advocating for the best interest of family members on the autism spectrum. These parental passions have contributed to the formation of several productive educational and funding organizations, including the National Alliance for Autism Research and Cure Autism Now, which merged to form Autism Speaks in 2005 [43]. Familial and professional caregivers of persons with disabilities and mental illness can embrace the power of advocacy and educate the public and media on mental health, which is a core mission of the National Alliance for Mental Illness [44]. In addition to public announcement campaigns and lobbying efforts, education on mental illness can be meaningfully conveyed through exposure, shared experiences, and artistic expression via attending theater. In this way, art can be seen as a form of advocacy, a way to experience other perspectives. Conclusion As we contemplate ethical considerations of accessibility of theater for people with ASD, perhaps the more important question is why is such access exceptional? Inclusion for people with disabilities in arts and culture is not simply a matter of access, but a right. The theater is providing a welcome and supportive context in which people with autism and their families are finding greater access and acceptance. It has the potential to unlock understanding of the human experience for children with autism as well as the larger community. Through translational education that allows people to view a mental illness such as autism as merely difference and not deviance, social change is possible. As children with autism gain greater access to theater, with opportunities for reciprocal social communication, the community gains greater awareness of autism, thereby reducing the barrier of stigma. References 1. Thornton Wilder, the art of fiction no. 16 [transcript]. Paris Review. 1956;15. http://www.theparisreview.org/interviews/4887/the-art-of-fiction-no-16thornton-wilder. Accessed October 27, 2016. 2. American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders. 5th ed. Arlington, VA: American Psychiatric Publishing; 2013. 3. Adolphs R, Sears L, Piven J. Abnormal processing of social information from faces in autism. J Cogn Neurosci. 2001;13(2):232-240. 5. Edmiston EK, Merkle K, Corbett BA. Neural and cortisol responses during play with human and computer partners in children with autism. Soc Cogn Affect Neurosci. 2015:10(8):1074-1083. 4. Baron-Cohen S, Ring HA, Wheelwright S, et al. Social intelligence in the normal and autistic brain: an fMRI study. Eur J Neurosci. 1999;11(6):1891-1898. 6. Schultz RT, Gauthier I, Klin A, et al. Abnormal ventral temporal cortical activity during face discrimination among individuals with autism and Asperger syndrome. Arch Gen Psychiatry. 2000;57(4):331-340. 8. Solomon M, Yoon JH, Ragland JD, et al. The development of the neural substrates of cognitive control in adolescents with autism spectrum disorders. Biol Psychiatry. 2014;76(5):412-421. 7. Cascio CJ, Foss-Feig JH, Heacock J, et al. Affective neural response to restricted interests in autism spectrum disorders. J Child Psychol Psychiatry. 2014;55(2):162-171. 9. Centers for Disease Control and Prevention. Research: Autism and Developmental Disabilities Monitoring (ADDM) Network. 10. Christensen DL, Baio J, Braun KV, et al. Prevalence and characteristics of autism spectrum disorder among children aged 8 years—Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2012. MMWR Surveill Summ. 2016;65(3):1-23. http://www.cdc.gov/ncbddd/autism/research.html. Accessed October 31, 2016. 11. Horlin C, Falkmer M, Parsons R, Albrecht MA, Falkmer T. The cost of autism spectrum disorders. PLOS One. 2014;9(9):e106552. http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0106552. Accessed October 25, 2016. 13. Dawson G, Bernier R. A quarter century of progress on the early detection and treatment of autism spectrum disorder. Dev Psychopathol. 2013;25(4)(pt 2):1455-1472. 12. Buescher AV, Cidav Z, Knapp M, Mandell DS. Costs of autism spectrum disorders in the United Kingdom and the United States. JAMA Pediatr. 2014;168(8):721728. 14. Little LM, Ausderau K, Sideris J, Baranek GT. Activity participation and sensory features among children with autism spectrum disorders. J Autism Dev Disord. 2015;45(9):2981-2990. 16. Bennett WJ. First Lessons: A Report on Elementary Education in America Washington, DC: US Department of Education; 1986:35. 15. Egilson ST, Jakobsdóttir G, Ólafsson K, Leósdóttir T. Community participation and environment of children with and without autism spectrum disorder: parent perspectives [published online ahead of print June 22, 2016]. Scand J Occup Ther. doi:10.1080/11038128.2016.1198419. . 17. Mullin J. Drawing autism: showcasing the artistic talents of people with autism. AMA J Ethics. 2015;17(4):359-361. 18. Svoboda DJ, Hosseini K, Schneider N, Casanova E, Aitch K. Artwork by people with autism. AMA J Ethics. 2015;17(4):362-368. 20. Howells V, Zelnik T. Making art: a qualitative study of personal and group transformation in a community arts studio. Psychiatr Rehabil J. 2009;32(3):215222. 19. Lamb J. Creating change: using the arts to help stop the stigma of mental illness and foster social integration. J Holist Nurs. 2009;27(1):57-65. 21. Viswanathan V. Making theater autism-friendly. Atlantic. April 6, 2015. Accessed September 13, 2016. http://www.theatlantic.com/health/archive/2015/04/making-theater-autismfriendly/388348/. Accessed October 31, 2016. 22. Theatre Development Fund. Autism Theatre Initiative: making theatre accessible to individuals with autism. https://www.tdf.org/nyc/40/Autism-TheatreInitiative. Accessed September 13, 2016. 24. Corbett BA, Gunther JR, Comins D, et al. Brief report: theatre as therapy for children with autism spectrum disorder. J Autism Dev Disord. 2011;41(4):505-511. 23. Theatre Development Fund website. https://www.tdf.org. Accessed September 13, 2016. 25. Guli LA, Semrud-Clikeman M, Lerner MD, Britton N. Social Competence Intervention Program (SCIP): a pilot study of a creative drama program for youth with social difficulties. Arts Psychother. 2013;40(1):37-44. 26. Lerner MD, Mikami AY, Levine K. Socio-dramatic affective-relational intervention for adolescents with asperger syndrome and high functioning autism: pilot study. Autism. 2011;15(1):21-42. 27. Corbett BA, Blain SD, Ioannou S, Balser M. Changes in anxiety following a randomized control trial of a theatre-based intervention for youth with autism spectrum disorder [published online ahead of print May 5, 2016]. Autism. doi:10.1177/1362361316643623. 28. Corbett BA, Key AP, Qualls L, et al. Improvement in social competence using a randomized trial of a theatre intervention for children with autism spectrum disorder. J Autism Dev Disord. 2016;46(2):658-672. 29. Corbett BA, Qualls LR, Valencia B, Fecteau SM, Swain DM. Peer-mediated theatrical engagement for improving reciprocal social interaction in autism spectrum disorder. Front Pediatr. 2014;2:110. http://journal.frontiersin.org/article/10.3389/fped.2014.00110/full. Accessed October 31, 2016. 30. Corbett BA, Swain DM, Coke C, et al. Improvement in social deficits in autism spectrum disorders using a theatre-based, peer-mediated intervention. Autism Res. 2014;7(1):4-16. 31. Bronowski J. The Ascent of Man. Boston, MA: Little, Brown; 1973:11. 33. Kinnear SH, Link BG, Ballan MS, Fischbach RL. Understanding the experience of stigma for parents of children with autism spectrum disorder and the role stigma plays in families' lives. J Autism Dev Disord. 2016;46(3):942-953. 32. United Nations. Convention on the Rights of Persons with Disabilities. http://www.un.org/disabilities/convention/conventionfull/shtml. Accessed September 13, 2016. 34. Funk CE. Therapy Hangs a Table. New York, NY: Harper & Row; 1950. 36. Thornicroft G, Rose D, Kassam A, Sartorius N. Stigma: ignorance, predjudice or discrimination? Brit J Psychiatry. 2007;190(3):192-193. 35. Jones EE, Farina A, Hastorf AH, Markus H, Miller DT, Scott RA. Social Stigma. San Francisco, CA: Freeman; 1984. 37. Corrigan PW. Mental health stigma as social attribution: implications for research methods and attitude change. Clin Psychol Sci Pract. 2000;7(1):48-67. 38. Weiner B. Attribution theory and attributional therapy: some theoretical observations and suggestions. Brit J Clin Psychol. 1988;27(pt 1):99-104. 39. Weiner B, Perry RP, Magnusson J. An attributional analysis of reactions to 40. Durand-Zaleski I, Scott J, Rouillon F, Leboyer M. A first national survey of stigmas. J Pers Soc Psychol. 1988;55(5):738-748. knowledge, attitudes and behaviours towards schizophrenia, bipolar disorders BMC Psychiatry and autism in France. . 2012;12:128. Accessed October 31, 2016. http://bmcpsychiatry.biomedcentral.com/articles/10.1186/1471-244X-12-128. 41. Jensen CM, Martens CS, Nikolajsen ND, et al. What do the general population know, believe and feel about individuals with autism and schizophrenia: results from a comparative survey in Denmark. Autism. 2016;20(4):496-508. 42. Corrigan P, Markowitz FE, Watson A, Rowan D, Kubiak MA. An attribution model of public discrimination towards persons with mental illness. J Health Soc Behav. 2003;44(2):162-179. 43. Silverman C, Brosco JP. Understanding autism: parents and pediatricians in historical perspective. Arch Pediatr Adolesc Med. 2007;161(4):392-398. 44. Flynn LM. The stigma of mental illness. New Dir Ment Health Serv. 1987;34:53-60. Blythe A. Corbett, PhD, is an associate professor in the Department of Psychiatry and Behavioral Science at Vanderbilt University in Nashville, Tennessee, and an investigator with the Vanderbilt Kennedy Center and the Center for Cognitive Medicine. Dr. Corbett is also the director of the Kennedy Center's Social Emotional Neuroscience Endocrinology (SENSE) Lab, a translational research program focused on reciprocal social functioning and stress responsivity of children with autism spectrum disorder. Related in the AMA Journal of Ethics Artwork by People with Autism,April 2015 Art Therapy for Children Who Have Survived Disaster,September 2010 Drawing Autism: Showcasing the Artistic Talents of People with Autism,April 2015 A Life of One's Own: Challenges in the Transition from Childhood to Adulthood with The Spectrum of Autism—From Neuronal Connections to Behavioral Expression Autism Spectrum Disorder,April 2015, November 2010 We Got Your Back: Patient Advocacy Through Art, January 2016 The viewpoints expressed in this article are those of the author(s) and do not necessarily reflect the views and policies of the AMA. Copyright 2016 American Medical Association. All rights reserved. ISSN 2376-6980	<urn:uuid:6a15aa79-3f2f-4f9a-8cfe-ee70ba123443>	CC-MAIN-2020-40	https://journalofethics.ama-assn.org/sites/journalofethics.ama-assn.org/files/2018-06/imhl1-1612.pdf	2020-09-22T10:11:25+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2020-40/subset=warc/part-00278-50bb8e61-7c5b-4d2c-bd34-dad6ca92b697.c000.gz.parquet	465,095,863	5,260	eng_Latn	eng_Latn	0.910179	eng_Latn	0.988359	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2331, 5479, 8757, 12960, 14965, 17385, 20078, 22745, 23971 ]
I. Called to Order II. Prayer III. Pledge IV. Public Hearing ................................................................. 7:00 p.m. Notice is hereby given that the Board of Commissioners of Perquimans County (the “County”), pursuant to NCGS Section 158-7.1, will hold a public hearing at a special meeting of the Board beginning at 7:00 p.m. on Monday, April 25, 2011, at the Perquimans County Courthouse Annex, 110 North Church Street, Hertford, North Carolina, in the Second Floor Courtroom, on a proposal to provide certain economic development incentives to Atlantic Wind, LLC, a private entity (the “Company”). The County proposes to appropriate and spend from the County’s general fund amounts to make certain annual cash grants to the Company, for a term of up to 30 years in the case of personal property and up to 15 years in the case of real property, in varying amounts of between 5.91% and 70.88% of the real and personal property taxes the Company pays directly or indirectly to the County. The purpose of these grants would be to encourage the Company to construct and operate a wind energy facility that would generate electricity and that would be located on a multi-acre site in Perquimans County and Pasquotank County (the “Facility”). The cash grants described above would be (i) conditioned on the Company’s paying the applicable real property and personal property taxes for the particular year; and (ii) subject to partial recapture via a refund payment, if the Company does not invest at least $240 million in the County on or before December 31, 2015, or if the development of the Facility does not result in the creation of an average, over a defined four-year period, of at least eight new full-time jobs at the Facility. The Company’s construction and operation of the Facility would further the economic interests of the County in numerous ways, including through the following specific benefits: (a) by creating a construction project at the Facility that would last approximately nine months which, in addition to creating employment at the Facility, would likely result in greater revenues to local businesses; (b) by offering a number of full time jobs at the completed Facility with an average wage greater than the median wage in the County; (c) by enhancing the County’s property tax base and increasing the County’s property tax revenues; and (d) by supporting the diversification of the County’s economy and locating in the County a portion of the first commercial scale wind energy facility in North Carolina. In addition to holding the public hearing, at this special meeting the Board of Commissioners of the County may approve the making of the cash grants as described above and may approve and enter into an economic development agreement with Atlantic Wind, LLC. V. Approval of Agenda .......................................................... Action Required VI. New Business A. Economic Development Incentives to Atlantic Wind, LLC ............. Action Required B. Establish Building Inspection Fees for Wind Turbines .................. Action Required VII. Adjournment VIII. Recess in Commissioners’ Room for Budget Work Session FOR INFORMATION ONLY: ➢ N.C. Northeast Economic Developers Letter Regarding Golden Leaf Foundation ➢ NC 20 Resolution ➢ Invitation to Holiday Island Property Owners Association’s Third Annual National Day of Prayer ➢ Resolution: Opposing Senate Bill 183 – Orange County ➢ Resolution: Opposing Senate Bill 462 & House Bill 574 IV. A Public Hearing is being held to receive citizen’s comments concerning a proposal to provide certain economic development incentives to Atlantic Wind, LLC, a private entity (the “Company”). The County proposes to appropriate and spend from the County’s general fund amounts to make certain annual cash grants to the Company, for a term of up to 30 years in the case of personal property and up to 15 years in the case of real property, in varying amounts of between 5.91% and 70.88% of the real and personal property taxes the Company pays directly or indirectly to the County. The purpose of these grants would be to encourage the Company to construct and operate a wind energy facility that would generate electricity and that would be located on a multi-acre site in Perquimans County and Pasquotank County (the “Facility”). The cash grants described above would be (i) conditioned on the Company’s paying the applicable real property and personal property taxes for the particular year, and (ii) subject to partial recapture via a refund payment, if the Company does not invest at least $240 million in the County on or before December 31, 2015, or if the development of the Facility does not result in the creation of an average, over a defined four-year period, of at least eight new full-time jobs at the Facility. The Company’s construction and operation of the Facility would further the economic interests of the County in numerous ways, including through the following specific benefits: (a) by creating a construction project at the Facility that would last approximately nine months which, in addition to creating employment at the Facility, would likely result in greater revenues to local businesses; (b) by offering a number of full time jobs at the completed Facility with an average wage greater than the median wage in the County; (c) by enhancing the County’s property tax base and increasing the County’s property tax revenues; and (d) by supporting the diversification of the County’s economy and locating in the County a portion of the first commercial scale wind energy facility in North Carolina. In addition to holding the public hearing, at this special meeting the Board of Commissioners of the County may approve the making of the cash grants as described above and may approve and enter into an economic development agreement with Atlantic Wind, LLC. VI.A. Enclosure. The Public Hearing was held earlier in the meeting. The Board will need to take action on the enclosed “Draft” Incentive Agreement. VI.B. If the Board approves to proceed with the above proposal, they will need to establish a Building Inspection Fee for the Wind Turbines. It is being proposed to be $150 per turbine. VII. The Board will adjourn the Special Called Meeting and take a short break to move to the Commissioners’ Room to hold a Budget Work Session. VIII. The Board will hold a Budget Work Session.	<urn:uuid:bc17c23a-4608-46ef-93f1-78637d265764>	CC-MAIN-2023-50	https://perquimanscountync.gov/board-of-commissioners?download=112:monday-april-25-2011-700-pm-public-hearing-a-special-called-meeting&start=800	2023-12-01T22:57:56+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00126-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	517,714,589	1,310	eng_Latn	eng_Latn	0.991206	eng_Latn	0.99329	[ "eng_Latn", "eng_Latn" ]	false	docling	[ 3517, 6440 ]
An Infrastructure for Delivering Geospatial Data from Heterogeneous Data Sources to the Field Leslie Miller Department of Computer Science 227 Atanasoff Hall Iowa State University Ames, IA 50011-1041 Phone: 515-294-4377 Email: [email protected] www.statlab.iastate.edu/dg Project Overview We present 4 posters that present the full range of our interdisciplinary Digital Government research program. The first poster describes a conceptual framework for accessing, using and collecting geospatial information in mobile data collection environments. The next 3 posters discuss specific components of this research, including interoperable digital geospatial libraries, wearable computing technologies for field data collection, and middleware to support adaptive exchange and analysis of geospatial data between the field computing and repository environments. In the final poster, testbed environments will be used to illustrate research principles in federal statistics applications. Poster Details A key feature of any environment designed to give field workers access to geospatial data is the infrastructure used to connect the field devices to the data sources. The infrastructure must be very flexible in its ability to obtain data. At the same time, it must be capable of minimizing the amount of data flowing through the network. To do this, we have chosen to make use of object-oriented views implemented as mobile agents. The views provide an excellent basis for deriving the data for the user's request and the mobile agent aspect creates a great deal of flexibility in the location for integrating or analyzing data. The implementation of our view agent infrastructure model makes use of wrappers, mediation, and XML. The wrappers are used for encapsulating the data sources and the mobile field devices. As is generally the case, the wrappers allow the details associated with the heterogeneity of the data source (or device) to be localized. The result is that within the boundaries of the wrappers, the mobile view agents work in a relatively homogeneous environment of manipulating XML encoded data. The internal infrastructure environment is also populated with a set of computation servers. Each computation server has a local object-oriented data warehouse equipped with a set of tools designed to work with geospatial data. Since the prospect of query reuse is likely for a field worker, we store the final and intermediate results in the data warehouse, allowing the warehouse to act as an active cache. The combination of these tools gives us a dynamic, adaptable infrastructure for handling geospatial data in field applications.	<urn:uuid:4dca26ae-e4fe-4022-8461-d680edfd298e>	CC-MAIN-2023-14	https://www.diggov.org/library/library/dgo2001/DGOMAC/MEDIA/MILLER.PDF	2023-03-23T11:05:43+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-14/subset=warc/part-00166-39c03058-7d78-443d-9984-102329513e3d.c000.gz.parquet	817,247,451	509	eng_Latn	eng_Latn	0.991811	eng_Latn	0.994522	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2550, 2679 ]
Evaluation of a Human Fab Anti-Idiotypic Anti-Daratumumab to Resolve Pan Reactions in Pre-Transfusion Testing due to Monoclonal Anti-CD38 Therapy A. Reggiani¹, E. Muenger², S. Baumann², C. Blanc², S. Lejon Crottet³, D. Cretier³, M. Castellano³, S. Waldvogel Abramowski³, E. Guignet¹ ¹ Bio-Rad Laboratories, DiaMed GmbH, Cressier, CH ² Interregional Blood Transfusion SRK Ltd, Berne, CH ³ Hôpitaux Universitaires de Genève, Geneva, CH Introduction Monoclonal antibody therapies are used to treat a variety of pathologic conditions, including solid and hematologic cancers. Daratumumab, a monoclonal anti-CD38 antibody, has been used for several years and has been shown to be efficient for the treatment of multiple myeloma patients. This monoclonal antibody specifically targets the antigen CD38, which is overexpressed on multiple myeloma cells. However, CD38 is also expressed at various degrees on red blood cells. When a patient is treated with daratumumab, pan reactions are observed in antibody screening using the Indirect Antiglobulin Test (IAT), which may mask underlying clinically significant antibodies. Several solutions have been developed, such as soluble recombinant proteins or treating the reagent red blood cells with dithiothreitol or trypsin, but they present limitations in the detection of some red cell alloantibodies. Objective The objective of this study was to confirm, in two different immunohematology laboratories, the efficacy of a new candidate in neutralizing daratumumab interferences in pretransfusion testing. Another objective was to demonstrate that this candidate has no impact on the detection of underlying red cell antibodies. Methods The neutralizing solution was provided ready-to-use. The daratumumab relative concentration in patient samples was estimated by antibody titration. To assess the neutralization efficiency, 50 daratumumab samples (25 samples per site) were titrated and neutralized, starting with 10% v/v of neutralizing solution and then with an increasing concentration if the neutralization was not achieved at 10% (i.e., 20%, and then 30% v/v of neutralizing solution). No preincubation was required (Table 1). Thereafter, 40 samples (20 samples per site) were prepared to contain a weak alloantibody (titer equal to or smaller than 4 against single dose cell) and daratumumab at a known titer. Specificities were selected to represent a broad spectrum of clinically significant antibodies (Table 2). These positive samples were tested using the same neutralization protocol, starting with 10% and so on if needed (Figure 1). Respective dilution controls using a titration buffer at 10%, 20%, or 30% were used at each step to validate the neutralization tests. Results At both sites, daratumumab titers ranged between 8 and 16,000. Overall, 74% of the samples (37/50) were neutralized using 10% of anti-daratumumab, 92% (46/50) with 20%, and 100% with 30% (Table 1). All underlying clinically significant alloantibodies were detected after the efficient neutralization of daratumumab (Table 2). Of 40 positive samples, 38 (95%) were neutralized with 10% and 2 required 20% of anti-daratumumab, but it did not affect the detection of weak underlying antibodies (Table 2). This ready-to-use anti-daratumumab did not impact the turnaround time as there was no pre-incubation required. Conclusion This human Fab anti-idiotypic anti-daratumumab demonstrated very efficient neutralization, while allowing the detection of weak underlying red cell antibodies. Using a 10% concentration, the neutralization was successful in 83% of samples (75/90), and gradual increase achieved a complete neutralization. This user-friendly reagent could become a new candidate for daratumumab neutralization in pre-transfusion testing. Visit us at bio-rad.com	cb1accf3-3f2a-442a-a758-59cac6e0e9c9	CC-MAIN-2024-51	https://backend.ih-area.bio-rad.com/system/files/ISBT%202024%20Poster%20-%20Evaluation%20of%20a%20Human%20Fab.pdf	2024-12-03T13:58:48+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00062-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet	108,785,649	915	eng_Latn	eng_Latn	0.982534	eng_Latn	0.982534	[ "eng_Latn" ]	true	docling	[ 3812 ]
Magistrates: Thomas Goddard Donald Eli Dix, Jr. Gary Chapman Billy Sipes Steve Wardrip Trey Webb Meade County Judge/Executive Troy D. Kok Job Notice Meade County Fiscal Court is hiring for the following full-time position. Full time Paramedic To request an application please email: [email protected] or visit the office of the Meade County Judge/Executive, 516 Hillcrest Drive, Brandenburg, KY 40108. For more information, please call the Meade County Judge/Executive's Office at 270-422-3967. To be considered applications will need to be returned by no later than 4:00 PM on Wednesday, October 18 th , 2023. In house applicants will be given first consideration. Applicants will be subject to drug testing and background check. Meade County Fiscal Court is an Equal Opportunity Employer. Treasurer Tammy Graham 516 HILLCREST DRIVE Brandenburg, KY 40108 (270)422-3967 Fax (270)422-3262	<urn:uuid:81899a4b-cf99-4f44-8289-b6500cdd4501>	CC-MAIN-2023-50	https://meadeky.com/wp-content/uploads/2023/10/Job-Notice-Full-Time-Paramedic-Meade-County-Fiscal-Court.pdf	2023-11-29T21:25:04+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00027-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	453,997,507	224	eng_Latn	eng_Latn	0.964447	eng_Latn	0.964447	[ "eng_Latn" ]	false	rolmOCR	[ 907 ]
PRAYING FOR AVOCADO TOAST SERIES: TEACH US TO PRAY Matthew 6:11 What an amazing thing it is to gather together and declare the beauty, wonder, and power of our Lord Jesus Christ. If we have not yet met, my name is Dan, and I am one of the pastors here at Peninsula Bible Church. As we get started this morning, I wonder, and I want you to think for a moment, about the most COVID thing you have done over the last 18 months. Something that you did this last year that you would never have dreamed of doing before, and yet you found yourself doing it during the pandemic. I thought we could take a little informal survey here. So, by a show of hands, let us know if you have done any of these things during COVID. For those of you watching online, feel free to comment in the chat. How many of you have done "'business on the top, pajamas on the bottom" during a Zoom call? How many of you have "worked from home" while at the beach? How many of you have started making sourdough at home? There are a number of COVID things that we have done related to church as well. So let's really pull back the curtain here. How many of you have watched church from bed or are watching church from now? One last one—and I might be going out on a limb here: Have any of you used avocado toast for your communion bread? Full transparency: I have not done this, but I have wanted to. Maybe some day. If you have, I'm guessing you are a Millennial. Us Millennials have a thing for avocado toast. I totally get it. I love myself a good piece of avocado toast. Throw a little goat cheese on there with a poached egg and some paprika—oh, so good! Catalog No. 20210829 Matthew 6:11 Third Message Dan Westman August 29, 2021 Millenials get a bad wrap when it comes to avocado toast, though. It's long been noted that more millennial would own homes if they saved more for a down payment instead of spending their money on things like avocado toast. Just for kicks, I did the math. Assuming that you pay $18 for your avocado toast, as you probably will at your favorite boujee brunch place, you would have to forgo 33,000 orders of avocado toast to put down a down payment for a modest home here in Palo Alto. That's a lot of avocado toast. So, what does this have to do with The Lord's Prayer? We are in the third week of our four-week deep dive into the most famous prayer ever prayed. This is the prayer that Jesus gives to his disciples when they ask him to teach them to pray. It is a prayer that is meant to shape not only our prayer life but our whole life. It is a prayer that teaches us how to think about God, ourselves, and how to relate to God and our world. The line that we will look at today is, Give us this day our daily bread. Give us this day our daily bread. This is the prayer where we ask God for avocado toast. Or is it? What exactly does Jesus mean when he teaches us to pray for our daily bread? We are going to unpack these deep and powerful words together this morning. Before we do, let's stand together and pray The Lord's Prayer. As a reminder, as a church, we are trying to pray this prayer every day throughout this series. Each Sunday, we will do this together during worship. Pray with me: Our Father, who art in heaven, Hallowed be thy name. Thy kingdom come. Thy will be done, On earth as it is in heaven. Give us this day our daily bread. Forgive us our trespasses, As we forgive those who trespass against us. Lead us not into temptation, But deliver us from evil. For thine is the kingdom, The power, and the glory, For ever and ever. Amen. The starting point: Ask God The Lord's Prayer comes from Matthew 6 and Luke 11. The two prayers are very similar. Matthew's is a little bit longer, and it is the version that we are looking at together. If you have been looking in your Bibles, you may have noticed that the ending of The Lord's Prayer isn't actually in the text. The traditional ending that we have been praying together—"For thine is the kingdom, the power and the glory, for ever and ever. Amen."—is not part of the prayer that Jesus gave to his disciples. It does show up in some manuscripts that come much later, and it became incorporated into church tradition. The theology of these words is excellent, but they didn't come from Jesus. I think they are great words to pray, and I pray them when I pray this prayer, but that's why you won't find them in your Bible. The words we are looking at today are found in Matthew 6:11. Matthew 6:11: Give us this day our daily bread. Seven words in English. Eight words in Greek. Yet, these words help us define our relationship with God. These words help keep God in his proper place as the giver of bread and all that is good, and they keep us in our proper place as those who depend on God and bring our requests to him. Let's think about what Jesus means when he teaches us to ask God for our daily bread. Some have understood this simply to mean bread. We are to ask God for bread. This view becomes problematic for those on the Keto diet because you can't eat bread on the Keto diet. I experimented with Keto for about a year a few years back, and my prayers usually went more like this: God, don't let me look at, or worse, smell, that heavenly looking bread because if I do, I am seriously going to want it in my belly! But I don't think Jesus is just asking us to pray for bread. And it is not because I am Keto, because I am not anymore. From the Reformers to today, most Biblical scholars understand bread to represent not only bread itself but all things that are necessary for life. In Luther's The Small Catechism, he writes this: Daily bread includes everything that has to do with the support and needs of the body, such as food, drink, clothing, shoes, house, home, land, animals, money, goods, a devout husband or wife, devout children, devout workers, devout and faithful rulers, good government, good weather, peace, health, self-control, good reputation, good friends, faithful neighbors, and the like. 1 Understood in this way, Jesus is not just teaching us to ask God for bread. In a much more Keto-friendly fashion, he is teaching us to ask God for everything that we need. So this prayer is meant to shape our prayer lives by teaching us to Ask God to provide. Ask God to provide you with the things that you need. Asking is an incredibly relational thing to do. God is our father who is in the heavens. We are his children whom he loves and loves to care for. We ask him for things. We ask him to provide for our needs. This is what children do to their parents. This is how children relate to their parents. This request, or petition, is the fourth of the six petitions that make up the bulk of The Lord's Prayer. With this petition, we have reached a turning point in the prayer, which is marked by a change in prepositions. The first three petitions are about God, and they use the pronoun "thy," or "your." "Hallowed be thy name. Thy kingdom come. Thy will be done." Now, we are shifting to the pronoun "our," and we are asking God for things that we need. "Give us this day our daily bread. Forgive us our trespasses. Lead us not into temptation, but deliver us from evil." You can see the shift. I am tempted to think that perhaps this is just how my children relate to me. Can I have some water? Can I have a snack? Can I watch a show? If you have young children, I know you can relate. But then I also think back to my days in college, and I was still asking my parents for things. One year for spring break, I had made some plans with my friends to go to Mexico. Our bright idea was to drive from Los Angeles down to Mexico and camp on the beach. Just find a beach and pitch a tent, and surf for a few days. My parents thought this was a terrible idea, and I couldn't figure out what in the world they were talking about. However, eventually, my friends and I decided to call off the trip. In the meantime, my Catalog No. 20210829 page 2 parents had planned a trip to Hawaii for the same week, so when my trip fell apart, I called them and asked, "Do you want to take me with?" Probably to keep me from changing my mind about Mexico, they let me come. Children ask their parents for things. It's what they do. When the request is reasonable, and sometimes even when it's not, parents are happy to say "yes." Do you ask God to provide for you? When you need something, do you ask God for it? When you want something, do you ask God for it? In John 14, Jesus says to his disciples, "If you ask me anything in my name, I will do it" (John 14:14). Now, this does not mean literally that you can ask Jesus for whatever you want and he will give it to you. When Jesus teaches us to pray for our daily bread, that is not a blank check to get whatever we ask. However, the more that we have prayed, "Thy kingdom come, thy will be done,"—the more the kingdom of God has invaded our hearts so that we desire the things that God desires, so that our will has become aligned with God will—to that extent, when we pray, "Give us this day our daily bread," our prayers will be answered. God loves to give good gifts to his children (Matthew 7:11). He loves it. Ask God because that is what children do. Don't demand even though children do that sometimes too! Don't demand, ask. But ask boldly. Ask God for a job that you love. Ask God for a spouse, if that is what your heart desires. Ask God to provide food. Ask him to provide a feast at times. Ask God for community. For friendship. For companionship. Ask God for an "A" on your exam. Ask God to help you get into the school of your dreams. Ask God for what you want and what you need, but do not ask God out of a place of greed. We are praying in line with the kingdom. We are praying in line with the will of God, so we must be ready to accept that if we do not get what we have asked God for in prayer, then we didn't really need it. Maybe we wanted it. Maybe we thought we needed it. But if our Father who is in the heavens—who owns the hills and cattle on them, the seas and the fish in them, who makes Google and Apple and Facebook look like little ants on a hill—if our Father decides not to give it to us, then we must be ready to accept that we did not truly need it. Beyond just asking: depend on God Notice, though, that Jesus does not simply teach us to ask God for bread—for our needs. He teaches us to ask God for our daily bread. He teaches us to ask God for enough bread for today. Not for next week. Not for next year. Not for retirement. For today. The image of daily bread brings to mind the story of the Exodus and the wilderness wandering in the Old Testament. After the people of Israel we freed from Egypt and God parted the Red Sea to deliver them, they found themselves in the desert. There is not a lot of food in the desert, so God provides manna. Bread. It wasn't actually bread. The people didn't know exactly what it was, but I'm sure it was Keto-friendly. When God provided manna, he provided it every day and exactly the amount they needed for that day. He told them not to collect any more than they needed, or else it would go bad overnight. Every day he sent fresh manna because he wanted to remind the people daily that he is the one who provided for them. He wanted to teach them to depend on him for their needs. Every day. Monday: "Give us this day our daily bread." Tuesday: "Give us this day our daily bread." Wednesday: "Give us this day our daily bread." January: "Give us this day our daily bread." February: "Give us this day our daily bread." As Jesus teaches us to pray for our daily bread, he teaches us we must depend on God for our needs. Every day. God, give me what I need for today. Give me the food I need for today. Give me the energy that I need for today. Give me the peace that I need for today. Give me the hope that I need for today. God give me what I need for today. You see, in this prayer, we are not only praying against hunger. We are also praying against self-sufficiency. We are praying against a spirit that says, I can provide for myself today, thank you very much. I've got this, God. I've can handle today on my own. But we won't know unless we ask. So Jesus teaches us to ask. He teaches us to ask God to provide. There are some of us in the Silicon Valley for whom the prayer for daily bread is a literal prayer against hunger. We are going to come back to that in a moment. But the far greater danger for most of us here is a spirit of self-sufficiency. Many of us here could miss our next paycheck and be just fine. Maybe we have to give up our avocado toast for a few weeks, but we will be just fine. Some of us here could never work another day in our lives and be just fine. It is so hard to depend on God when we are just fine. It is so hard to depend on God when we feel like we don't need anything. Or worse yet, when we feel like we can provide for ourselves. Catalog No. 20210829 page 3 We can't. God is the one who provides. We don't provide for ourselves. God provides for us. You may have graduated from Palo Alto High School. You may have gotten into Stanford University. You may have founded a start-up company. Or you may have immigrated here from another country and created a better life for your family. But you are not the one who provides for yourself. God created you. He has given you every talent that you have. He has opened every door that you have ever walked through. He has put every dollar in your bank account. God is the one who provides. Ironically, the more God has given us, the harder it is to recognize that it came from him. And the harder it is to depend on him. That's why we pray this prayer every day. "Give us this day our daily bread." God, give me what I need for today, for I recognize that everything I have is a gift from you, and everything I need is yours to give. It's a prayer of dependency. It's a prayer of reliance on God. And it's a prayer that we need so desperately here in Silicon Valley. Just because God is the one who gives us everything does not mean that we don't have to work for it also. Mark Batterson, an author and pastor in Washington, D.C. says, "Pray like everything depends on God. Work like everything depends on you." 2 After the service a few weeks ago, I had someone come up to me and ask me how I preach without notes. I actually do preach with notes. I have them right here. Some people might take this message and ask, Why write a sermon? Why prepare at all? Why not just get up here, depend on God, and let him do the rest? Because that is not how it works. God asks us, and he expects us to work. He expects me to prepare for my sermons. He expects you to work hard at whatever it is that you do. Hard work is deeply honoring to God. But here is the thing. When I get up here, no matter how hard I have worked or how prepared I am, nothing good will come of this sermon unless God makes it happen. God must take my words coming from his Word, by his Spirit, and give you ears to hear them and enlighten your mind to understand them and soften your heart to receive and enliven your body to go and live them out. Nothing good will come of this morning apart from God. And nothing good will come of all of your hard work unless God blesses it and makes it fruitful. God is the one who provides. So we must depend on him. Provide for the needs of others We might be tempted to stop here. We've looked at the whole prayer, after all. "Give us this day our daily bread." If we stop here, however, this prayer becomes individualistic. It sounds more like, "Give me this day my daily bread." But Jesus says, "Give us this day our daily bread." The plural pronoun is significant for two reasons. First, it turns the prayer from a simple petition to an intercession. That is, it turns it from a prayer that God would provide for my needs into a prayer that God would provide for the needs of others as well. Yes, God, give me what I need, but also give my sister in the next row what she needs. Give my brother back home what he needs. Give the men, women, and children fleeing from Afghanistan what they need. Give the firefighters fighting these flames what they need. Give our politicians and our leaders what they need. Give our doctors and nurses, our epidemiologists, and our cancer researchers what they need. Give our professors and teachers what they need. Give our CEOs what they need. Give our students and our direct reports what they need. God, give us this day our daily bread. This is a prayer of intercession. But it is also a call to action. It is a call to love our neighbor. It is a call to provide for our neighbor. We cannot pray, "Give us this day our daily bread" and then walk past an unhoused person without feeling an ounce of compassion. We cannot pray, "Give us this day our daily bread" with no regard for those who lack the ability or the opportunity to buy bread for themselves. And we had better not pray, "Give us this day our daily bread" while we preach a gospel that would deal with people's spiritual needs and have nothing to say about their physical needs. If we are going to pray this prayer—and we must pray this prayer—then we must also look for ways to provide for the needs of others. Look for opportunities to take what God has given to you and give it to someone who needs it. God doesn't need you to do this. He could provide directly for everyone's needs, just like he has provided for your needs. But that's not the way that God chose to do it because he wants us to do this together. As wonderful as Catalog No. 20210829 page 4 it is to receive something directly from the hand of God, it is even more wonderful to receive something from a brother or sister who is functioning as the hand of God. When I was in seminary, a couple who was a few years further down the road than us invited Linzy and me to join a small group with a few other couples our age and a few mentor couples. They hoped to encourage us in our marriage and help us walk with Jesus together, which they did. This couple's love language was spaghetti and really good wine. We were all seminary students with no extra room in the budget for much wine at all, much less really good wine. But each time we met, we enjoyed delicious spaghetti (or some other fantastic meal) and shared some really good wine. This couple was pretty well off, but you would never have guessed looking at the house they lived in, the cars they drove, or the vacations they took. But you started to get a sense of how much they had when you saw how much they gave away. Their attitude was simple: We have way more than we need, but it's not ours. God gave it to us so we could share it with others. What has God given to you so that you could share it with someone else? Has he given you more than you need? If so, who does he want you to share it with? Where are the needs that God has given you the opportunity to meet? There are a number of ways here at the church where you can share what God has given you with those who need it. If God has given you extra time, we have a shower ministry where you give our unhoused neighbors access to our shower here at the church. Every Sunday evening, there is an opportunity to cook a meal for those who may need one and serve it on our patio. Every Friday, our Recovery ministry provides a meal to those struggling with addiction, and they could use some volunteers. We have a Compassion Team who puts all of this together, and you can find out more about all of these opportunities at pbc.org/compassion. There are plenty of ways to do similar things beyond the walls of this church. Second Harvest Food Bank is a great place to donate time or resources to help people get access to food. You can sponsor a child through one of any number of organizations. You can buy groceries Catalog No. 20210829 page 5 for someone that you meet on the street. There are so many opportunities to help meet people's needs if we are looking for them and ready to meet them. Give us this day our daily bread. In this one short sentence, Jesus calls us to bring our requests to God and depend on him to provide while also looking for ways to share that provision with others. Let's circle back to avocado toast. When Jesus teaches us to pray for our daily bread, is he telling us to pray for avocado toast? Yes! I think he is. If you enjoy avocado toast, then that is a great prayer to pray. However, if you pray that prayer, you had better be ready to give your avocado toast away to someone with no toast at all, and you had better also be prepared to eat stale bread and water if that's what God sends your way. Endnotes 1. Martin Luther, The Small Catechism, https://catechism.cph.org/en/ lords-prayer.html. 2. Mark Batterson, The Circle Maker (Grand Rapids, MI: Zondervan, 2016).	<urn:uuid:79462003-c978-485e-afbd-8621c78d1074>	CC-MAIN-2021-39	https://s3.us-west-2.amazonaws.com/cdn.pbc.org/Main_Service/2021/08/29/SE+DW+20210829+WEB+Format.pdf	2021-09-21T14:17:01+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-39/subset=warc/part-00225-f465d820-0362-4c4c-a396-c69f5fd24cc4.c000.gz.parquet	565,056,814	4,798	eng_Latn	eng_Latn	0.998981	eng_Latn	0.999092	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3471, 7978, 12966, 17637, 20882 ]
American Cancer Society, Inc. and Affiliated Entities Combined Financial Statements As of and for the Year Ended August 31, 2009 with summarized financial information for the Year Ended August 31, 2008 and Report of Independent Auditors 0 American Cancer Society, Inc. and Affiliated Entities Contents August 31, 2009 and 2008 2 Report of Independent Auditors The Boards of Directors The American Cancer Society, Inc. and Affiliated Entities We have audited the accompanying combined balance sheet as of August 31, 2009 of the organizations described in Note 1 (collectively the Society), and the related combined statements of activities, functional expenses and cash flows for the year then ended. These financial statements are the responsibility of the Society's management. Our responsibility is to express an opinion on these financial statements based on our audit. The prior year summarized comparative information has been derived from the Society's 2008 combined financial statements and, in our report dated February 23, 2009 we expressed an unqualified opinion on those combined financial statements. We conducted our audit in accordance with auditing standards generally accepted in the United States. Those standards require that we plan and perform the audit to obtain reasonable assurance about whether the financial statements are free of material misstatement. We were not engaged to perform an audit of the Society's internal control over financial reporting. Our audit included consideration of internal control over financial reporting as a basis for designing audit procedures that are appropriate in the circumstances, but not for the purpose of expressing an opinion on the effectiveness of the Society's internal control over financial reporting. Accordingly, we express no such opinion. An audit also includes examining, on a test basis, evidence supporting the amounts and disclosures in the financial statements, assessing the accounting principles used and significant estimates made by management, and evaluating the overall financial statement presentation. We believe that our audit provides a reasonable basis for our opinion. In our opinion, the financial statements referred to in the first paragraph present fairly, in all material respects, the combined financial position as of August 31, 2009 of the organizations described in Note 1, and the combined changes in their net assets and their cash flows for the year then ended in conformity with U.S. generally accepted accounting principles. As discussed in Notes 1 and 4 to the combined financial statements, the Society adopted the recognition and disclosure provisions of FASB Staff Position No. FAS 117-1, Endowments of Not-for-Profit Organizations: Net Asset Classification of Funds Subject to an Enacted Version of the Uniform Prudent Management of Institutional Funds Act, and Enhanced Disclosures for all Endowment Funds, as of September 1, 2008. Our audit was conducted for the purpose of forming an opinion on the combined financial statements taken as a whole. The combining balance sheets, combining statements of activities, and combining statements of expenses by natural classification are presented for purposes of additional analysis and are not a required part of the combined financial statements. Such information has been subjected to the auditing procedures applied in our audit of the combined financial statements and, in our opinion, is fairly stated in all material respects in relation to the combined financial statements taken as a whole. January 28, 2010 Ernst & Young LLP Suite 1000 55 Ivan Allen Jr. Boulevard Atlanta, GA 30308 Tel: +1 404 874 8300 Fax: +1 404 817 5589 www.ey.com A member firm of Ernst & Young Global Limited AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINED BALANCE SHEETS (In Thousands) ASSETS August 31, The accompanying notes are an integral part of the combined financial statements. 2 AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINED STATEMENT OF ACTIVITIES FOR THE YEAR ENDED AUGUST 31, 2009, WITH SUMMARIZED FINANCIAL INFORMATION FOR 2008 (In Thousands) 225,126 556,446 391 150,644 6,102 44,831 24,922 1,008,462 47,140 (13,530) (1,339) 32,271 97,254 (96,198) 1,056 16,184 1,071 19,128 1,078,172 - - - - - 3 AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINED STATEMENT OF ACTIVITIES (continued) FOR THE YEAR ENDED AUGUST 31, 2009, WITH SUMMARIZED FINANCIAL INFORMATION FOR 2008 (In Thousands) EXPENSES % 15% 18% 14% 26% 73% 7% 20% 27% 100% The accompanying notes are an integral part of the combined financial statements 4 AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINED STATEMENT OF FUNCTIONAL EXPENSES FOR THE YEAR ENDED AUGUST 31, 2009, WITH SUMMARIZED FINANCIAL INFORMATION FOR 2008 (In Thousands) EXPENSES Salaries Supplies Telephone Travel 409,163 79,802 31,390 68,890 11,041 18,705 23,353 44,376 14,774 66,396 24,387 39,151 22,287 133,765 1,693 27,637 3,257 7,618 13,327 1,041,012 The accompanying notes are an integral part of the combined financial statements. 5 FOR THE YEARS ENDED AUGUST 31, 2009 AND 2008 (In Thousands) AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINED STATEMENTS OF CASH FLOWS 1. ORGANIZATION AND ACCOUNTING POLICIES Organization The American Cancer Society (the "Society"), is the nationwide, community-based, voluntary health organization dedicated to eliminating cancer as a major health problem by preventing cancer, saving lives and diminishing suffering from cancer through research, education, advocacy and service. Principles of Combination The accompanying combined financial statements include the consolidated accounts of the American Cancer Society, Inc. (the "National Home Office") and the American Cancer Society of Puerto Rico, Inc. ("Puerto Rico"). Puerto Rico is a membership corporation with the National Home Office as its only member. During fiscal year 2009, the American Cancer Society Foundation ("Foundation"), a membership corporation with the National Home Office as its only member, merged with the National Home Office. These consolidated accounts are combined with the accounts of the American Cancer Society Cancer Action Network ("ACS CAN") and the Society's 13 chartered Divisions (the "Divisions"), which are separately incorporated. All significant intra-Society accounts and transactions have been eliminated in the accompanying combined financial statements. The Society (including the National Home Office, its chartered Divisions and Puerto Rico) has received a determination letter from the Internal Revenue Service that it is exempt from income tax under Section 501(a) of the U.S. Internal Revenue Code as an organization described in section 501(c)(3). ACS CAN has received a determination letter from the Internal Revenue Service that it is exempt from income tax under Section 501(a) of the U.S. Internal Revenue Code as an organization described in section 501(c)(4). The Society prepares a separate Internal Revenue Service Form 990 for the National Home Office, ACS CAN, Puerto Rico and each chartered Division. New Accounting Pronouncements In September 2006, the Financial Accounting Standards Board ("FASB") issued Statement of Financial Accounting Standards No. 157, Fair Value Measurements ("Statement 157"). Statement 157 defines fair value, establishes a framework for measuring fair value in accordance with generally accepted accounting principles and expands disclosures about fair value measurements. On September 1, 2008, the Society adopted the provisions of Statement 157 related to fair value measurements and related disclosures for all financial assets and liabilities. The adoption of Statement 157 did not have a significant effect on the Society's financial position at August 31, 2009. The required disclosures have been included in Note 2 of the accompanying combined financial statements. FSP FAS 157-2, Partial Deferral of the Effective Date of Statement 157, deferred the effective date of Statement 157 for all nonfinancial assets and liabilities for fiscal years beginning after November 15, 2008. The Society is in the process of assessing the impact of Statement 157 on its nonfinancial assets and liabilities. In February 2007, the FASB issued Statement No. 159, The Fair Value Option for Financial Assets and Financial Liabilities – Including an amendment of FASB Statement No. 115 ("Statement 159"). Statement 159 permits entities to choose to measure many financial instruments and certain other items at fair value. On September 1, 2008, the Society adopted the provisions of Statement 159 related to measuring financial instruments and other items at fair value and the related disclosures. The Society elected fair value accounting for its nonperpetual beneficial interests in trusts held by third parties and its gift annuity obligations. The fair value methodology for these combined financial instruments is discussed later in this footnote. The adoption of Statement 159 did not have a significant impact on the combined financial statements as of August 31, 2009. 1. ORGANIZATION AND ACCOUNTING POLICIES, continued New Accounting Pronouncements, continued In August 2008, the FASB issued FASB Staff Position (FSP) No. FAS 117-1, Endowments of Not-forProfit Organizations: Net Asset Classification of Funds Subject to an Enacted Version of the Uniform Prudent Management of Institutional Funds Act, and Enhanced Disclosures for All Endowment Funds ("FSP FAS 117-1"). FSP FAS 117-1 provides guidance on the net asset classification of donor-restricted endowment funds for a not-for-profit organization that is subject to an enacted version of the Uniform Prudent Management of Institutional funds Act of 2006 ("UPMIFA"). UPMIFA is a model act approved by the Uniform Law Commission that serves as a guideline for states to use in enacting legislation. FSP FAS 117-1 also enhances disclosures about an organization's endowment funds, regardless of whether the organization is subject to UPMIFA. On September 1, 2008, the Society adopted FSP No. FAS 117-1 and related disclosures. The effect of adoption of Statement 117-1 is presented in Note 4 along with the required disclosures. In May 2009, the FASB issued Statement No. 165, Subsequent Events ("Statement 165"). Statement 165 sets forth the period after the balance sheet date during which management of a reporting entity shall evaluate events or transactions that may occur for potential recognition or disclosure in the combined financial statements, circumstances under which those events or transactions may be recognized and disclosures to be made for those events or transactions. Statement 165 is effective for the Society's fiscal year 2009, and the required disclosures have been included in Note 17. In June 2009, the FASB issued Statement No. 168, The FASB Accounting Standards Codification and the Hierarchy of Generally Accepted Accounting Principles ("Statement 168"). Statement 168 establishes the FASB Accounting Standards Codification as the source of authoritative accounting principles recognized by the FASB to be applied by nongovernmental entities in the preparation of financial statements in conformity with GAAP. The Society is required to adopt the provisions of Statement 168 for its fiscal year ending August 31, 2010. The Society does not believe the adoption of Statement 168 will have a significant impact on the combined financial statements as of August 31, 2010. Cash and Cash Equivalents The Society considers all highly liquid investments with an original maturity of three months or less, when purchased, to be cash equivalents with the exception of cash held for reinvestment which is included in other investments, gift annuity investments, collateral received under the securities lending program and investments, as appropriate. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Fair Value of Financial Instruments The Society's financial instruments consist of cash and cash equivalents, other investments, gift annuity investments, securities lent under securities lending program, collateral received under securities lending program, receivables, legacies and bequests receivable, beneficial interests in trusts, investments, research and other program awards and grants payable, accounts payable and accrued expenses, gift annuity obligations, payable under securities lending program, and debt. Receivables, legacies and bequests receivable and research and other program awards and grants payable are recorded at their net realizable value, which approximates fair value. Other investments, securities lent under securities lending program, collateral received under securities lending program, investments, beneficial interest in trusts and gift annuity investments and the related obligations are recorded at their fair values. All other financial instruments are stated at cost, which approximates fair value. Securities Lending The Society participates in a securities lending program with its investment custodian. The Society lends a portion of its investments to certain approved firms in exchange for collateral for the loaned securities. The Society does not loan any securities restricted by donors. The loaned securities are contractually required to be continuously secured by collateral consisting of cash, which is reinvested, and U.S. government securities with a minimum value of 100% of the loaned securities adjusted daily. The investment custodian's general practice is to obtain collateral with a value of 102% of the loaned securities adjusted daily. The Society maintains effective control of the loaned securities through its custodian. Under the terms of the agreement, the borrower must return the same, or substantially the same, investments that were borrowed. The Society receives compensation, net of related fees, for lending its securities which is included in investment income. The loaned securities are reflected as securities lent under securities lending program in the accompanying combined balance sheets. At August 31, 2009 and 2008, $163,253,000 and $159,298,000, respectively, is recorded as securities lent under securities lending program in the accompanying combined balance sheets. At August 31, 2009 and 2008, $166,450,000 and $162,605,000, respectively, is recorded as collateral received under securities lending program and as payable under securities lending program in the accompanying combined balance sheets. Collateral received under the securities lending program is recorded at its fair value. The payable under securities lending program is carried at cost, which approximates fair value. 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Investments Pending actual disbursement for budgeted program expenditures, funds are invested in securities designed to maximize resources available for programs while minimizing risk. To help achieve these objectives, the Society maintains two combined investment pools: the Combined Investment Pool ("CIP") for short term liquidity and the Combined Endowment Pool ("CEP") for principal preservation. The investment objectives of the CIP and CEP are subject to limitations defined by the National Home Office's Board of Directors and are set to provide maximum current income within the approved risk parameters. These investments do not have a significant concentration of credit risk within any industry, geographic location, or specific institution. Interest and dividend income is presented net of investment advisory fees. Total earnings on investments are credited to unrestricted net assets unless otherwise restricted by the donor or relevant law. Securities listed on national and international exchanges are principally valued at the regular trading session closing price on the exchange or market in which such securities are principally traded on the last business day of each period presented using the market approach. Government obligations (including those loaned under securities lending program) are valued on the basis of evaluated prices provided by independent pricing services. Corporate obligations, pooled mortgage backed securities, and other fixed income securities are valued on the basis of evaluated prices provided by independent pricing services. Such prices are believed to reflect the fair market value of such securities using the income approach. Investments in common collective trusts are generally valued using the market approach on the basis of the relative interest of each participating investor (including each participant) in the fair value of the underlying net assets of each of the respective common collective trusts. Gift annuity investments and the related obligation are recorded at their fair values based on quoted market rates or other relevant market data. Government Grants Receivable All government grants receivable are expected to be collected within one year and are recorded at net realizable value. Pledges Receivable Pledges receivable that are expected to be collected within one year are recorded at net realizable value. Pledges receivable that are expected to be collected in future years are recorded at the present value of the estimated future cash flows. Pledges receivable recorded in fiscal 2008 and prior years have been discounted at rates ranging from 3.50% to 4.75%. The rates approximate the rates of return on U.S. government securities at the origination of the pledge. Pledges receivable recorded in fiscal year 2009 have been discounted using a rate of 2.60%, which is commensurate with the risks involved with the ultimate collection of the pledges receivable. The discount is amortized using an effective yield over the expected life of the pledges receivable. 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Fixed Assets and Depreciation Land, buildings and leasehold improvements, furniture, fixtures, equipment, computer software and other capitalized assets are recorded at cost. Contributions of long-lived assets are recorded at the estimated fair market value at the date of receipt and are recorded as unrestricted support unless the use of such contributed assets is restricted by a donor-imposed restriction. If donors contribute long-lived assets with stipulations as to how long the assets must be used or with any other restrictions, such contributions are reported as temporarily restricted support. Depreciation expense is recognized on a straight-line basis over the estimated useful lives of the respective assets, as follows: Buildings 20 to 40 years Leasehold improvements Lesser of life of the lease or estimated life of the improvement Furniture, fixtures, equipment, computer software and other capitalized assets 3 to 10 years Equipment under capital leases Lesser of life of the lease or estimated life of the equipment Research and Other Program Awards and Grants Payable The Society makes awards and grants for research, education and medical projects in the field of cancer. The minimum amount for which the Society is obligated is recorded upon the grant's approval. Awards and grants payable beyond one year are reported at the present value of their estimated future cash flows and have been discounted at rates ranging from 2.25% to 6.25%. These rates approximate the rates of return on U.S. government securities at the origination of the awards and grants. Awards and grants payable recorded in fiscal year 2009 have been discounted using a rate of 2.25%, which is commensurate with the risks involved with the ultimate payment of these obligations. The discount is amortized using an effective yield over the expected life of the awards and grants contracts. Contributed Services A substantial number of volunteers have made significant contributions of their time to the Society's program and supporting services. The value of this contributed time is not reflected in the combined financial statements since it does not require a specialized skill. However, certain other contributed services that require specialized skills, were provided by individuals possessing those skills, and would otherwise need to be purchased if not provided by donation. These services are recognized as revenue and expense. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Planned Gifts (Legacies and Bequests, Beneficial Interests in Trusts and Gift Annuities) The Society is the beneficiary of planned gifts under bequests, other testamentary documents, trusts and similar deferred contributions. The assets from a bequest or a contribution may be given directly to the Society, or may be put in the care of a trustee, with the Society being designated as having a full or partial beneficial interest in the trust ("BIT"). Certain gifts are considered split-interest agreements whereby the Society receives benefits that are shared with either the donor or third party beneficiaries. Both deceased donors, through a will, and living donors may restrict their gift to a specified purpose or geographic area (i.e., a purpose restriction), or defer their gift through use of a nonperpetual trust (i.e., a time restriction). Such gifts are classified as temporarily restricted revenues. A purpose restriction is satisfied when the Society incurs expenses satisfying the purpose restriction. A time restriction is satisfied when the donor stipulated time has elapsed. Gifts may also be permanently restricted under a perpetual trust. See below for a further description of nonperpetual trusts and perpetual trusts. Legacy and Bequests Receivable Direct gifts of assets are recorded at their estimated fair value as public support (legacy or contribution revenue) when the Society has received an unconditional promise to give. Subsequent adjustments to the fair value are recognized as public support consistent with the initial recording of the gift. The Society considers a bequest unconditional when the probate court declares the testamentary instrument valid and the proceeds are measurable. Beneficial Interests in Trusts Nonperpetual trusts are trusts where donors have established and funded trusts under which specified distributions are to be made to a designated beneficiary or beneficiaries over the trust's term. Nonperpetual trusts are recorded at their estimated fair value based on the present value of the Society's estimated future cash receipts from the trust. In fiscal year 2009 and 2008, based on then current financial market conditions, the Society estimated the present value of nonperpetual trusts using an investment return rate (net of trustee fees and other expenses) of 7.25% and 7.50%, and a discount rate of 4.50% and 5.00% respectively, commensurate with the risks involved. The carrying value of the initial gift of the nonperpetual BIT is recognized as temporarily restricted public support (legacy or contribution revenue depending upon the initial source of the gift). Any subsequent adjustments to the nonperpetual BIT are recorded as a change in value of split-interest agreements. Perpetual trusts are trusts under which the Society will receive income distributions in perpetuity, but will never receive the corpus (principal). Perpetual trusts are initially recorded as permanently restricted legacy or contribution revenue, depending on the initial source of the gift, at the fair market value of the Society's interest in the trust assets at the time of the gift. Subsequent changes to the trust's fair market value are recognized as permanently restricted net unrealized gains or losses. Income received from the trusts is recognized as temporarily restricted or unrestricted investment income, depending on the existence or absence of donor-imposed restrictions. 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Beneficial Interests in Trusts, continued The Society uses significant unobservable inputs (level 3, as defined in Note 2) to estimate the fair value of BITs as of August 31, 2009. The need to use unobservable inputs generally results from the lack of an active market or marketplace with respect to BITs. The Society's level 3 BITs total approximately $270,257,000 at August 31, 2009 and includes both nonperpetual and perpetual trusts, the interest in which cannot be traded in an active market or marketplace. Therefore no significant observable market data for these instruments is available. The fair value of perpetual trusts is based on the fair value of the underlying trust assets. As trust statements are not received as of August 31 for each trust, the fair value, as of various dates, of the underlying assets is adjusted based on changes in the relevant market indices from the date of the trustee statement to year-end that correlate to the estimated asset allocation of the underlying assets. The management of the assets within the various trusts, including purchase and sale decisions, is performed by the respective trustee and the Society has no ability to control these decisions. Distributions from these trusts are based on the terms of the underlying trust agreement which generally require that investment income be distributed on at least an annual basis. The fair value of nonperpetual trusts is based on an income approach (present value techniques) using internally developed models. Assumptions are made regarding the expected rate of return on the investments in the trust, the discount rate, and the expected mortality of the individual(s) if the termination of the agreement is dependent on life expectancy. An expected rate of return on the investments in the trusts is estimated using historical investment returns for various relevant market indices for the assumed asset allocation of the nonperpetual trusts. The discount rate used to estimate the present value of the Society's interest is 4.5%. The expected mortality is estimated using the Annuity 2000 tables. Each of these calculations is based on the fair value of the underlying assets of the trust. As trust statements are not received as of August 31 for each trust, the fair value, as of various dates, of the underlying assets is adjusted based on changes in the relevant market indices from the date of the trustee statement to year-end that correlate to the estimated asset allocation of the underlying assets. As the fair value of these trusts is derived from internal estimates of the present value of the Society's interest in the underlying assets, incorporating market data when available, the amounts ultimately received could differ from the amounts reflected in the historical combined financial statements. Gift Annuities Gift annuities require an annuity to be paid to the donor or the donor's beneficiary, funded by the donated assets, over a designated period of time or the beneficiary's lifetime, with the remainder becoming a gift to the Society. The actuarially determined liability is recorded based on the terms of the gift, and the difference between the present value of the estimated liability and the fair value of the gift is recognized as revenue at the time of the gift. In fiscal years 2009 and 2008, the assumptions used in the valuation of the annuity liability include mortality in accordance with the Annuity 2000 Table and an annual investment yield rate of 6.00% for immediate annuities and 4.00% for deferred payment annuities, compounded annually, net of expenses. These rates are commensurate with the risks associated with the ultimate payment of the obligation. The Society maintains assets sufficient to meet the annuity requirements stipulated by the various state laws. The Society may also be the beneficiary of an interest in trusts and other assets in situations where it has not been notified of its interest, its interest may be conditional or revocable, or the value of its interest may not be readily ascertainable. In such circumstances, no contribution revenue has been recorded. 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Accounting for Contributions Contributions are recognized when an unconditional promise to give is made or when cash is received, if an unconditional promise does not exist. All contributions are considered to be available for unrestricted use unless specifically restricted by the donor. Amounts received that are designated for future periods or are restricted by the donor for specific purposes are reported as temporarily restricted or permanently restricted support that increase those net asset classes. Unconditional promises to give without a stipulated due date and for which the Society has met all conditions precedent to receipt of the contribution prior to the Society's fiscal year-end are classified as unrestricted net assets. A donor restriction is satisfied when a stipulated time restriction expires or when a purpose restriction is accomplished. Upon satisfaction, temporarily restricted net assets are reclassified to unrestricted net assets and are reported in the combined statement of activities as net assets released from restrictions. Restricted contributions received in the same year in which the restrictions are met are recorded as an increase to restricted support at the time of receipt and as net assets released from restrictions. The principal and any donor restricted income from permanently restricted gifts are classified as permanently restricted net assets. Income on those assets, not permanently restricted by the donor, is classified as temporarily restricted (if restricted by the donor or by relevant law) or unrestricted net assets. Contributed merchandise and other in-kind contributions, including merchandise remaining in inventory at year-end, are reflected as contributions at their estimated fair values when received or when an unconditional promise to give has been made. The Society does not imply time restrictions on contributions of long-lived assets (or of other assets restricted to the purchase of long-lived assets) received without donor stipulations about how long the contributed assets must be used. As a result, contributions of cash and other assets restricted to the acquisition of long-lived assets are reported as temporarily restricted revenue that increases temporarily restricted net assets; those restrictions expire when the long-lived assets are placed in service. Grant Revenue Grant revenue on cost-reimbursement grants or contracts is recognized when the Society requests reimbursement from granting agencies after the program expenditures have been incurred. As such, the Society recognizes revenue and records a receivable for the reimbursement amount from the granting agency. Such grant programs are subject to independent audit under the Office of Management and Budget Circular A-133 and review by grantor agencies. Such review could result in the disallowance of expenditures under the terms of the grant or reductions of future grant funds. Based on prior experience, the Society's management believes that costs ultimately disallowed, if any, would not materially affect the combined financial position of the Society. Advertising Costs Advertising costs are expensed as incurred. Advertising expenses incurred for fiscal years ended August 31, 2009 and 2008 were $22,489,000 and $25,143,000 respectively. NOTES TO COMBINED FINANCIAL STATEMENTS AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES AUGUST 31, 2009 AND 2008 1. ORGANIZATION AND ACCOUNTING POLICIES, continued Estimates The preparation of financial statements in conformity with accounting principles generally accepted in the United States requires management to make estimates and assumptions that affect the reported amounts of assets and liabilities and disclosure of contingent assets and liabilities at the date of the combined financial statements, and the reported amounts of revenues and expenditures during the reporting period. Actual results may differ from those estimates. Presentation of Certain Prior Year Information and Reclassifications The fiscal year 2009 combined financial statements include certain prior year summarized comparative information in total but not by net asset class. Such information in total does not include sufficient detail to constitute a presentation in conformity with accounting principles generally accepted in the United States. Accordingly, such information should be read in conjunction with the Society's combined financial statements for the fiscal year ended August 31, 2008, from which the summarized information was derived. Certain reclassifications have been made to prior year amounts to conform to the current year presentation. 2. FAIR VALUE MEASUREMENT The hierarchy of the fair value frame work established by Statement 157 is described below: Level 1 Inputs to the valuation methodology are unadjusted quoted prices for identical assets or liabilities in active markets that the Society has the ability to access. Level 2 Inputs to the valuation methodology include: * Quoted prices for similar assets or liabilities in active markets; * Quoted prices for identical or similar assets or liabilities in inactive markets; * Inputs other than quoted prices that are observable for the asset or liability; * Inputs that are derived principally from or corroborated by observable market data by correlation or other means. If the asset or liability has a specified (contractual) term, the level 2 input must be observable for substantially the full term of the asset or liability. Level 3 Inputs to the valuation methodology are unobservable and significant to the fair value measurement. The valuation methods described in Note 1 may produce a fair value calculation that may not be indicative of net realizable value or reflective of future fair values. Furthermore, while the Society believes its valuation methods are appropriate and consistent with other market participants, the use of different methodologies or assumptions to determine the fair value of certain financial instruments could result in a different fair value measurement at the reporting date. The following tables set forth by level, within the fair value hierarchy, the Society's assets and liabilities as of August 31, 2009. As required by FASB Statement 157, assets and liabilities are classified in their entirety based on the lowest level of input that is significant to the fair value measurement. 2. FAIR VALUE MEASUREMENT, continued Assets and liabilities measured at fair value on a recurring basis as of August 31, 2009 (in thousands) Assets and liabilities measured at fair value on a non-recurring basis as of August 31, 2009 (in thousands) Pledges and grants receivable Legacies and bequests receivable Research and other program awards and grants payable Total assets and liabilities at fair value The table below sets forth a summary of changes in the fair value of the Society level 3 assets and liabilities measured on a recurring basis for the year ended August 31, 2009 (in thousands): Balance, beginning of year Realized and unrealized losses Purchases, sales, issuances, and settlements (net) Balance, end of year The unrealized losses are included in the net unrealized losses on perpetual trusts in the accompanying statement of activities and are related to assets still held at August 31, 2009. 3. CASH AND CASH EQUIVALENTS, OTHER INVESTMENTS, GIFT ANNUITY INVESTMENTS, INVESTMENTS AND SECURITIES LENT UNDER SECURITIES LENDING PROGRAM The fair value of cash and cash equivalents, other investments, gift annuity investments, investments, and securities lent under securities lending program as of August 31, 2009 and 2008 are as follows (in thousands): Investment advisory fees paid by the Society were approximately $2,272,000 and $2,121,000 for the fiscal years ended August 31, 2009 and 2008, respectively. 4. ENDOWMENT Interpretation of Relevant Law ACS CAN and certain Divisions are subject to an enacted version of UPMIFA, while the National Home Office, Puerto Rico and certain other Divisions remain subject to the Uniform Management of Institutional Funds Act ("UMIFA") or other relevant law. The interpretation of relevant law among the entities of the Society is discussed below. The Society has interpreted the Uniform Management of Institutional Funds Act (UMIFA) as requiring the preservation of the fair value of the original gift as of the gift date of the donor-restricted endowment funds absent explicit donor stipulations to the contrary. As a result of this interpretation, the Society classifies as permanently restricted net assets (a) the original value of gifts to the permanent endowment, (b) the original value of subsequent gifts to the permanent endowment, and (c) accumulations of investment returns to the permanent endowment made in accordance with the direction of the applicable donor gift instrument, when applicable. The remaining portion of the donor-restricted endowment fund that is not classified in permanently restricted net assets is classified as temporarily restricted net assets to the extent the donor restricted income earned on such endowments to a particular purpose or time, and in all other cases is classified as unrestricted net assets. Such amounts recorded as temporarily restricted net assets are released from restriction when the donor stipulated purpose has been fulfilled and/or the required time period has elapsed. 17 4. ENDOWMENT, continued Interpretation of Relevant Law, continued The Society has interpreted the Uniform Prudent Management of Institutional Funds Act (UPMIFA) as requiring the preservation of the fair value of the original gift as of the gift date of the donor-restricted endowment funds absent explicit donor stipulations to the contrary. As a result of this interpretation, the Society classifies as permanently restricted net assets (a) the original value of gifts donated to the permanent endowment, (b) the original value of subsequent gifts to the permanent endowment, and (c) accumulations to the permanent endowment made in accordance with the direction of the applicable donor gift instrument at the time the accumulation is added to the fund. The remaining portion of the donor-restricted endowment fund that is not classified in permanently restricted net assets is classified as temporarily restricted net assets until those amounts are appropriated for expenditure by the Society in a manner consistent with the standard of prudence prescribed by UPMIFA. The following represents the net asset classes of the Society's endowment funds as well as the changes in endowments for the year ended August 31, 2009 (in thousands). 4. ENDOWMENT, continued Funds with Deficiencies From time to time, the fair value of assets associated with individual donor-restricted endowment funds may fall below the level that the donor or relevant law requires the Society to retain as a fund of perpetual duration. In accordance with U.S. generally accepted accounting principles, deficiencies of this nature would be reported in temporarily restricted net assets to the extent there are accumulated gains available to absorb such loss, or otherwise unrestricted net assets. Deficiencies of this nature that are reported in unrestricted net assets were $3,024,000 as of August 31, 2009. These deficiencies resulted from unfavorable market fluctuations that occurred after the investment of new contributions and continued appropriation for certain programs that was deemed prudent by the Society. Subsequent gains that restore the fair value of the assets of the endowment fund up to the $3,024,000 in deficiencies will be classified as an increase in unrestricted net assets. Return Objectives and Risk Parameters The Society has adopted investment and spending policies for endowment assets that attempt to provide a predictable stream of funding to programs supported by its endowment while seeking to maintain the purchasing power of the endowment assets. Under this policy, as approved by the Society, the endowment assets are invested in a manner that is intended to produce results that exceed the price and yield results of relevant market indices while assuming a moderate level of investment risk. Spending Policy To the extent of a permanently restricted endowment's cumulative undistributed earnings, and unless the donor has specified otherwise, 4%-5% (based on the policy of the respective division) of the fair value of an endowment is available for spending each year. In addition, the difference between the actual total return each year and the spending percentage is charged or credited to unrestricted or temporarily restricted net assets (depending on the donor's instructions regarding the use of investment income or relevant law). The Society believes a spending policy is necessary to carry out the statutorily prescribed standard of ordinary business care and prudence and uses a spending rate of 4%-5% in order to maintain the purchasing power of the endowment. 5. PLEDGES AND GRANTS RECEIVABLE As of August 31, 2009 and 2008, the expected future cash receipts from unconditional pledges and grants receivable, excluding amounts due from federated fund raising organizations, government grants and receivables related to donated land under lease of $11,808,000 and $8,775,000 for the years ended August 31, 2009 and 2008, respectively, are as follows (in thousands): AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 6. FIXED ASSETS Fixed assets as of August 31, 2009 and 2008 are as follows (in thousands): Depreciation expense including expenses or assets used in exchange transactions for the years ended August 31, 2009 and 2008 was approximately $23,313,000 and $21,480,000, respectively. Software amortization expense for the years ended August 31, 2009 and 2008 was approximately $4,566,000 and $6,235,000, respectively. 7. DEBT Debt as of August 31, 2009 and 2008 is as follows: The Eastern Division purchased a condominium located in New York City in January 2007 which currently serves as office space and as a Hope Lodge facility to house and support cancer patients undergoing treatment in New York City. The purchase is financed through Industrial Development Bonds issued by the New York City Industrial Development Agency. The outstanding balance of the Industrial Development Bonds was $44,664,000 and $45,435,000 as of August 31, 2009 and 2008, respectively. The term of the bonds is 30 years with a fixed interest rate of 4.75%. The net book value of the property is $40,755,000 and $42,224,000 as of August 31, 2009 and 2008, respectively. The Society has various industrial development and revenue bonds (the "Bonds"), with variable interest rates (ranging from 0.38% to 4.75% as of August 31, 2009), two of which are convertible to a fixed rate at the Society's option. The outstanding balance of the Bonds was $19,105,000 and $21,955,000 at August 31, 2009 and 2008. The bonds mature at various dates until 2037. The bonds are collateralized by certificates of deposit, property and letters of credit, which expire at various dates through 2012 unless terminated earlier. At August 31, 2008, $223,000 of bond proceeds is included in cash and cash equivalents in the accompanying combined balance sheets. The Society has various notes payable with variable interest rates (ranging from 3.40% to 5.65% as of August 31, 2009). The outstanding balance of the notes payable was $4,082,000 and $4,640,000 at August 31, 2009 and 2008, respectively. Certain notes payable are secured by certificates of deposit in the amount of $1,459,000 at August 31, 2009. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 7. DEBT, continued Approximate annual payments as of August 31, 2009, excluding interest, are payable as follows (in thousands): Fiscal year: The debt is secured by related properties, furnishings and equipment, which have a net book value of approximately $52,191,000. 8. RESEARCH AND OTHER PROGRAM AWARDS AND GRANTS PAYABLE The aggregate amount of research and other program awards and grants for which the Society is obligated under its agreements as of August 31, 2009 and 2008 are $226,329,000 and $243,001,000, respectively. The present value as of August 31, 2009 and 2008 is $217,339,000 and $229,687,000, respectively. The discount of $8,990,000 will be recognized as interest expense in fiscal years 2010 through 2014. As of August 31, 2009, the awards and grants are payable as follows (in thousands): Fiscal year: 9. PENSION PLANS The Society maintains noncontributory defined benefit pension plans (the "Plans"), which cover substantially all employees of the Society. The benefits are based on years of service and certain averages of compensation. Pension expense is recognized by the Society based on the actuarially determined amount, which for fiscal years 2009 and 2008 was $25,083,000 and $19,761,000, respectively. The Society's liability for contributions accrued and unpaid as of August 31, 2009 and 2008 was $163,498,000 and $48,714,000, respectively. These amounts are included in accrued retirement plan benefits in the accompanying combined balance sheets. 9. PENSION PLANS, continued The current strategic mix for the Plans has a blended exposure to equity and debt market risk. The Plans employ an active management strategy that has historically generated excess returns and places greater emphasis on manager skills to produce excess return while employing various risk mitigation strategies to reduce volatility. The plan assets at August 31 consist of: The benefit obligation and the assets of the Plans were $520,043,000 and $356,545,000, respectively, as of August 31, 2009. The benefit obligation and the assets of the Plans were $438,488,000 and $389,774,000, respectively, as of August 31, 2008. The Society employs a "building block approach" in determining the long-term rate of return for plan assets. Historical markets are studied and long-term historical relationships between equities and debt are preserved consistent with the widely accepted capital market principle that assets with higher volatility generate a greater return over the long run. Current market factors such as inflation and interest rates are evaluated before long-term capital market assumptions are determined. The long-term portfolio return is established via a building block approach with proper consideration of diversification and rebalancing. Peer data and historical returns are reviewed to check for reasonability and appropriateness. While the approach gives appropriate consideration to recent fund performance and historical returns, the assumption is primarily a long term, prospective rate. The Society also maintains a nonqualified and unfunded Supplemental Executive Retirement Plan (the "SERP") for certain employees whose income exceeds the maximum income that can be considered under the Plans. The Society's liability for benefits accrued and unpaid as of August 31, 2009 and 2008 was $16,775,000 and $19,225,000, respectively. These amounts are included in accrued retirement plan benefits in the accompanying combined balance sheets. Information related to the Society's Pension Plans and SERP as of August 31, 2009 and 2008 and the related changes during the years then ended are as follows (in thousands): 9. PENSION PLANS, continued 9. PENSION PLANS, continued The Society expects to contribute $17,721,000 in fiscal year 2010. Included in unrestricted net assets at August 31, 2009 are the following amounts that have not yet been recognized in net periodic pension cost: unrecognized prior service costs of $7,501,000 and unrecognized actuarial losses of $217,702,000. The prior service cost and actuarial losses included in unrestricted net assets and expected to be recognized in net periodic pension cost during the fiscal yearended August 31, 2010 are $1,381,000 and $18,808,000, respectively. Future changes in actual compensation and retirement dates can materially affect both the amount of the benefits ultimately paid and the period over which the related expense is recognized. 10. POSTRETIREMENT NONPENSION BENEFITS The Society maintains an unfunded postretirement benefit plan for employees, which covers certain employees of the Society. Employees hired prior to January 1, 1995 retiring from the Society on or after attaining age 55 who have rendered at least ten years of service to the Society receive postretirement medical, dental, and life insurance coverage. These benefits are subject to deductibles, co-payment provisions, and other limitations, and the Society may amend or change the postretirement plan periodically. The Society accrues the cost of providing postretirement benefits for medical, dental, and life insurance coverage over the active service period of employees and is amortizing the unrecognized transition obligation over 20 years. Medical trend rates do not apply as the plans are on fixed payment amounts. The accumulated postretirement benefit obligation as of August 31, 2009 and 2008 and related changes during the years ended August 31, 2009 and 2008 consisted of the following components (in thousands): AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 10. POSTRETIREMENT NONPENSION BENEFITS, continued AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 10. POSTRETIREMENT NONPENSION BENEFITS, continued The Society expects to contribute $3,570,000 in fiscal year 2010. Included in unrestricted net assets at August 31, 2009 are the following amounts that have not yet been recognized in net periodic pension cost: unrecognized transition obligation of $3,096,000, unrecognized prior service costs of $823,000 and unrecognized actuarial losses of $11,444,000. The transition obligation, prior service cost and actuarial losses included in unrestricted net assets and expected to be recognized in net periodic pension cost during the fiscal year-ended August 31, 2010 are $763,000, $759,000 and $679,000, respectively. 11. OPERATING LEASES The Society leases telecommunication systems related to its National Cancer Information Center and occupies office and warehouse space under operating leases, some of which are subject to escalation and expire on various dates through fiscal year 2022. Future minimum annual rentals with noncancellable terms are as follows as of August 31, 2009 (in thousands): Rental expense from operating leases for the year ended August 31, 2009 and 2008 was approximately $31,345,808 and $31,160,000, respectively. 12. RESTRICTED NET ASSETS Temporarily restricted net assets and the earnings from permanently restricted net assets as of August 31, 2009 and 2008 have been restricted by donors as follows (in thousands): 12. RESTRICTED NET ASSETS, continued For net assets that are shown as time restricted, the earnings are not restricted as to purpose. For permanently restricted net assets, the principal is restricted in perpetuity, and only the earnings on the net assets shown above may be spent for the restricted purpose. Certain reclassifications have been made to the 2008 net asset categories to conform to the 2009 presentation. These reclassifications include an increase of $3,463,000 to unrestricted net assets and a $3,463,000 decrease to temporarily restricted net assets. These reclassifications relate to the beginning 2008 balances and had no impact on the change in net assets or total net assets. 13. CONTRIBUTED SERVICES, MERCHANDISE, AND OTHER IN-KIND CONTRIBUTIONS In fiscal year 2009 and 2008, the Society recorded contributed services of $1,613,000 and $1,105,000, respectively, related to the communication of program and fund-raising messages through various media. In addition, the Society has valued and recorded contributed services provided by scientific peer reviewers, which consist of medical doctors, PhD's, professors, biomedical and psychosocial professionals, social welfare service providers, and other professional service providers whose efforts are necessary for the Society to carry out its programs. In fiscal year 2009 and 2008, the Society's management estimates that approximately 24,800 and 25,960 hours, respectively, have been contributed by scientific peer reviewers and has valued such services at $1,801,000 and $1,822,000, respectively. Contributed Merchandise: Cars For a Cure The Society operates the Cars For a Cure program to solicit donations of used vehicles from the public. The Society sells these donated vehicles, primarily at wholesale dealer auctions, to generate cash to support the Society's life saving programs. The contribution of the vehicle is recorded as merchandise and other in-kind contributions in the accompanying combined statement of activities at the gross wholesale proceeds for vehicles sold by August 31 and at estimated gross proceeds for donated vehicles not sold by August 31. The transactions recorded during fiscal years 2009 and 2008 are as follows (in thousands): 13. CONTRIBUTED SERVICES, MERCHANDISE, AND OTHER IN-KIND CONTRIBUTIONS, continued Discovery Shops The Society operates Discovery Shops to solicit donations of clothing and household items from the public. Discovery Shops are upscale resale stores selling donated merchandise to generate cash to support the Division's programs. The contribution of the merchandise is recorded in the accompanying combined statement of activities as merchandise and other in-kind contributions at the gross proceeds for items sold by August 31 and at estimated gross proceeds for donated items not sold by August 31. The transactions recorded during fiscal years 2009 and 2008 are as follows (in thousands): Other Contributed Merchandise In fiscal years 2009 and 2008, the Society received cosmetic kits with an estimated fair value of $14,610,000 and $6,557,000, respectively, which were donated by the Personal Care Products Council for use in the Look Good Feel Better quality of life program. In fiscal years 2009 and 2008, the Society also received wigs with an estimated fair value of $1,016,000 and $1,833,000, respectively, which were donated by Celebrity Signatures International, Inc. The Society provided the merchandise to chemotherapy patients along with training in the proper application of cosmetics and wigs. The Society received other in kind contributions of donated land under lease and items to be used in the Society's Hope Lodges. Hope Lodges are residential facilities providing temporary housing free of charge for cancer patients and a family caregiver during cancer treatments away from their home. These donations were approximately $5,458,000 and $7,094,000, respectively, for fiscal years 2009 and 2008. These items are being used and therefore there is no related exchange income, expenses or selling expenses related to these in kind contributions. In fiscal years 2009 and 2008, the Society received in-kind contributions of advertising production, magazine space, public service announcements and in-store advertising materials from various retail and professional organizations with an estimated fair value of $14,431,000 and $4,175,000. 14. EXCHANGE TRANSACTIONS Exchange transactions are reciprocal transfers in which each party receives and sacrifices something of equal value as opposed to a nonreciprocal transaction (i.e., a contribution) in which a donor provides resources to support the Society's mission and expects to receive nothing of direct value in exchange. Costs of exchange transactions that benefit the recipient of the exchange and are not directly related to the Society's mission are reported as exchange expenses. Costs related to exchange transactions that directly benefit or support the Society's mission are included with the Society's program or supporting services expenses. Exchange transaction income and expenses for fiscal years 2009 and 2008 are as follows (in thousands): Benefits Purchased by Donors at Special Events The Society conducts special events in which a portion of the gross proceeds paid by the participant represents payment for the direct cost of the benefits received by the participant at the event. Unless a verifiable, objective means exists to demonstrate otherwise, the fair value of meals and entertainment provided at special events is measured at the actual cost to the Society. The direct costs of the special events that ultimately benefit the donor rather than the Society are recorded as exchange transaction income and exchange transaction expense. All proceeds received in excess of the direct costs are recorded as special events revenue in the accompanying combined statement of activities. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES NOTES TO COMBINED FINANCIAL STATEMENTS AUGUST 31, 2009 AND 2008 15. ACTIVITIES WITH JOINT COSTS In fiscal years 2009 and 2008, the Society conducted activities that included fund-raising appeals as well as program and management and general components. Those activities included direct mail, telecommunications, and other constituent relationship activities. The costs of conducting those joint activities which met the purpose, audience and content criteria of AICPA Statement of Position ("SOP") 98-2, Accounting for Costs of Activities of Not-for-Profit Organizations and State and Local Government Entities That Include Fund-Raising, included a total of approximately $160,786,000 and $181,959,000 of joint costs for fiscal years 2009 and 2008, that were functionally allocated as follows (in thousands): 16. COMMITMENTS AND CONTINGENCIES The Society is party to legal claims arising in the course of its normal business activities. Although the ultimate outcome of these claims cannot be ascertained at this time, it is the opinion of management that none of these matters, when resolved, will have a material effect on the Society's net assets. 17. SUBSEQUENT EVENTS Management has adopted SFAS No. 165, Subsequent Events, and has disclosed all subsequent events through January 28, 2010, the date the combined financial statements were available to be issued. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINING BALANCE SHEETS AUGUST 31, 2009 (In Thousands) Other investments Gift annuity investments DUE FROM AFFILIATES RECEIVABLES, net FIXED ASSETS, net Total assets ACCRUED EXPENSES: DUE TO AFFILIATES OTHER LIABILITIES DEBT Total liabilities NET ASSETS: Unrestricted: Total unrestricted Temporarily restricted Permanently restricted Total net assets TOTAL 112,123 $ 984,059 2,160,931 321,195 826,529 - 838,304 1,334,402 2,160,931 $ AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINING STATEMENTS OF ACTIVITIES FOR THE YEAR ENDED AUGUST 31, 2009 (In Thousands) Income Expenses Affiliates Unrestricted Temporarily restricted TOTAL 186,811 $ 523,865 534 135,600 (32,857) 59,698 23,972 - - 897,623 29,561 (15,038) (42,401) (27,878) 97,903 (95,423) 2,480 19,388 - 296 5,142 897,051 175,918 723 21,979 - 16,777 215,397 (175,918) (1,309) (21,979) - (16,777) (215,983) - 586 - - - 586 - AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINING STATEMENTS OF ACTIVITIES (continued) FOR THE YEAR ENDED AUGUST 31, 2009 (In Thousands) EXPENSES Program services: Supporting services: CHANGE IN NET ASSETS NET ASSETS, end of year TOTAL 149,829 177,849 129,396 275,377 732,451 62,948 222,280 285,228 1,017,679 - 1,017,679 134,604 (255,232) 1,589,634 - 1,589,634 1,334,402 $ The accompanying notes are an integral part of the combined financial statements. AMERICAN CANCER SOCIETY, INC. AND AFFILIATED ENTITIES COMBINING STATEMENTS OF EXPENSES BY NATURAL CLASSIFICATION FOR THE YEAR ENDED AUGUST 31, 2009 (In Thousands) ACS CANCER EXPENSES Salaries Employees benefits Payroll taxes Professional fees Supplies Telephone Postage and shipping Occupancy Travel Insurance Interest expense Miscellaneous The accompanying notes are an integral part of the combined financial statements. TOTAL 409,974 $ 88,943 32,577 60,686 7,522 17,501 21,637 45,724 13,012 57,148 19,667 29,115 26,959 121,957 - - 1,704 27,798 2,880 18,344 14,531 1,017,679	<urn:uuid:08ed8718-6876-4c64-b1dc-aa32779d2787>	CC-MAIN-2014-35	http://media.cmgdigital.com/shared/news/documents/2011/11/07/2009_Combined_Financial_Statements.pdf	2014-09-02T14:01:35Z	s3://commoncrawl/crawl-data/CC-MAIN-2014-35/segments/1409535922087.15/warc/CC-MAIN-20140909041922-00051-ip-10-180-136-8.ec2.internal.warc.gz	332,794,401	12,643	eng_Latn	eng_Latn	0.792385	eng_Latn	0.992335	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "dan_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "sco_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 240, 332, 3768, 3970, 4336, 4682, 5178, 5327, 9213, 11979, 14933, 18043, 20544, 24162, 28352, 31713, 34826, 35750, 37843, 39085, 41847, 44136, 45750, 47916, 47945, 49774, 49945, 51467, 53712, 55875, 57401, 58830, 59353, 59865, 60365, 60987 ]
AGENDA – October 10, 2019 Approve Supplementary Agenda Receive MINUTES Agriculture Committee Meeting Minutes - September 5, 2019 Receive DELEGATION YOUNG AGRARIANS Jolene Swain, Land Matcher, Central & Northern BC RE: BC Land Matching Program (via teleconference) REPORTS Debbie Evans, Agriculture Coordinator - Funding of Bulkley-Nechako and Fraser (Page 6) - Fort George Regional Adaptation Strategy Projects (2020-2023) Recommendation VERBAL REPORTS Ministry of Agriculture and Agricultural Land Commission Meeting October 3, 2019 - Prince George SUPPLEMENTARY AGENDA NEW BUSINESS IN-CAMERA MOTION In accordance with Section 90(1)(i) of the Community Charter, it is the opinion of the Committee Members that the receipt of advice that is subject to solicitor-client privilege, including communications necessary for that purpose must be closed to the public and therefore exercise their option of excluding the public for this meeting. ADJOURN PRESENT: Chair Mark Parker Directors Gladys Atrill Shane Brienen Mark Fisher Tom Greenaway Clint Lambert Brad Layton Linda McGuire Jerry Petersen Bev Playfair Michael Riis-Christianson Kim Watt-Senner Gerry Thiessen Directors Dolores Funk, Village of Burns Lake Absent Rob Newell, Electoral Area "G" (Houston Rural) Staff Curtis Helgesen, Chief Administrative Officer Cheryl Anderson, Manager of Administrative Services Janette Derksen, Deputy Director of Environmental Services Debbie Evans, Agriculture Coordinator John Illes, Chief Financial Officer Jason Llewellyn, Director of Planning Wendy Wainwright, Executive Assistant Media Blair McBride, Lakes District News CALL TO ORDER Chair Parker called the meeting to order at 1:30 p.m. AGENDA Moved by Director Lambert Seconded by Director Layton AG.2019-5-1 “That the Agriculture Committee Agenda of September 5, 2019 be adopted.” (All/Directors/Majority) CARRIED UNANIMOUSLY MINUTES Agriculture Committee Meeting Minutes -May 2, 2019 Moved by Director Petersen Seconded by Director Brienen AG.2019-5-2 “That the Minutes of the Agriculture Committee Meeting of May 2, 2019 be approved.” (All/Directors/Majority) CARRIED UNANIMOUSLY REPORTS RDBN 2012 Agriculture Plan Update Report Moved by Director Layton Seconded by Director Lambert AG.2019-5-3 "That the Agriculture Committee receive the Agriculture Coordinator’s September 5, 2019 memo titled “RDBN 2012 Agriculture Plan Update report.” (All/Directors/Majority) CARRIED UNANIMOUSLY NDIT – Agriculture Coordinator -Pilot Project Extension and Disbursement Schedule -Northern Development Project Number 5112 20 Moved by Director Playfair Seconded by Director Riis-Christianson AG.2019-5-4 "That the Agriculture Committee receive the correspondence from Northern Development Initiative Trust – Agriculture Coordinator - Pilot Project Extension and Disbursement Schedule – Northern Development Project Number 5112 20." (All/Directors/Majority) CARRIED UNANIMOUSLY BC Meat Inspection Program RE: Feedback on Class D Licences – Regional District of Bulkley-Nechako Moved by Director Lambert Seconded by Director Petersen AG.2019-5-5 "That the Agriculture Committee receive the correspondence from the BC Meat Inspection Program RE: Feedback on Class D Licences – Regional District of Bulkley-Nechako." (All/Directors/Majority) CARRIED UNANIMOUSLY VERBAL REPORT Agriculture Land Commission (ALC) – Jason Llewellyn, Director of Planning Jason Llewellyn, Director of Planning provided an overview of the challenges regarding the Ministry of Agriculture and Agriculture Land Commission’s (ALC) regulation prohibiting the deposit of soils from another parcel of land onto land within the Agriculture Land Reserve (ALR) being limited to 1,000 m² and the ALC expecting local governments to enforce their regulations through the local government building permit process. Staff are currently researching the RDBN’s role and flexibility in addressing the ALC requirements. Mr. Llewellyn outlined the ALC application process for a property owner needing to conduct groundwork on their property that requires more than 1,000 m² of soils. The ALC has 60 days once a property owner submits a Notice of Intent to provide approval or request further information, if more information is required the timeline is extended a further 60 days. Concerns were brought forward in regard to the potentially lengthy process and impacts to a property owner in a short northern building season. The ALC also provides a second option that potentially lessens the wait time but a separate application is required for a $1,500 permit fee. The Board expressed its concerns in regard to the ALC’s expectation of local government. Frustrations were brought forward in regard to the ALC eliminating the two zones and only having one zone for the Province and no northern input. Discussion took place in regard to the Board advocating for a two zone system. VERBAL REPORT (CONT’D) Staff will bring forward a report at the September 19, 2019 Board Meeting regarding the RDBN’s roles concerning the ALC’s expectation of local government. Director Fisher requested staff bring forward a press release in regard to the information including the Board’s stance on the issue at the September 19, 2019 meeting for Board review. Discussion took place regarding the potential intent of the ALC regulations and questions were raised in regard to the Ministry of Agriculture educating the public in regard to the regulation changes. Chair Parker noted the importance of meeting with the Minister of Agriculture and the Liberal Opposition Critic at the 2019 UBCM Convention. Verbal Report Moved by Director Layton Seconded by Director Lambert AG.2019-5-6 “That the Agriculture Committee receive the Director of Planning’s verbal report re: Agriculture Land Commission.” (All/Directors/Majority) CARRIED UNANIMOUSLY ADJOURNMENT Moved by Director Watt-Senner Seconded by Director Layton AG.2019-5-7 “That the meeting be adjourned at 2:05 p.m.” (All/Directors/Majority) CARRIED UNANIMOUSLY _________________________ ____________________________ Mark Parker, Chair Wendy Wainwright, Executive Assistant Background Information: BC Agriculture and Food Climate Action Initiative in partnership with the Regional District of Bulkley-Nechako (RDBN), and the Regional District of Fraser-Fort George (RDFFG), has developed the Regional Agriculture Strategy document. This strategies document encompasses both RDBN and RDFFG lands. The focus of the plan is to identify projects and opportunities for agricultural producers to adapt to climate change. The document was previously presented to the Board and is on the RDBN website under the agriculture page for climate change, and the priority impact areas, strategies and actions are on pages 16 – 41. Proposal Now that the strategies plan has been completed, a four-year (2020-2023) work plan is being developed that will prioritize key actions to undertake. To leverage the initial $300,000 Canadian Agricultural Partnership (CAP) funding, and to oversee implementation of the plan, BC Agriculture and Food Climate Action Initiative is looking for additional support from other partners, including both the RDBN and RDFFG. The initial request was $5,000 annually. The RDFFG on September 19, 2019 committed to provide $5,000 annually for 2019 – 2022. On September 27, 2019, the RDBN and RDFFG were approached by staff of BC Agriculture and Food Climate Action Initiative to increase the annual funding to $7,500. The funds for 2019 were approved by the RDBN CAO from the existing 2019 Agriculture budget with no amendments required. Funding for the Agriculture function currently falls under the RDBN’s general administration budget with full participation from the RDBN’s member municipalities and electoral areas. The RDBN will continue to partner with BC Agriculture and Food Climate Action Initiative and the RDFFG to forward the objectives of the Bulkley-Nechako and Fraser-Fort George Regional Agriculture Adaptation Strategy. RECOMMENDATION: (All/Directors/Majority) THAT the Agriculture Committee approve the support of annual funding in principal in the amount of $7,500 for the years 2020 to 2023 for the Bulkley-Nechako & Fraser-Fort George, BC Agriculture & Climate Change, Regional Adaptation Strategies Projects subject to final budget approval by the Board; AND THAT Debbie Evans, Agriculture Coordinator continue to serve as the RDBN representative on the Advisory Committee; AND THAT the Administration Department will determine level of in-kind participation based on expertise and available resources, where the RDBN has been identified as a potential partner for an identified action.	<urn:uuid:b3b2307a-faab-4ef3-ac36-1f753901506b>	CC-MAIN-2021-49	https://www.rdbn.bc.ca/application/files/2315/7014/0793/October_10_Agenda_Contents_Page_Final.pdf	2021-12-01T13:13:51+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00045-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	1,014,488,717	1,945	eng_Latn	eng_Latn	0.899962	eng_Latn	0.964245	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 965, 2164, 4916, 6156, 8034, 8710 ]
Privacy Flash – Issue 15 Privacy at your fingertips Privacy is becoming increasingly important to everyday business. Legal developments and regulators' increasing attention to privacy are two of the key drivers behind this. The aim of the Privacy Flash is to provide monthly updates on global regulatory developments, as well as relevant news and information on upcoming events in the field of data protection and privacy. Previous issues are available on our website, via the 2015 \| 2016 archive. For additional information, to subscribe, or to suggest improvements to the Privacy Flash, please email [email protected]. To unsubscribe, please send us an email using this link. Highlights * Privacy Shield: DPAs comment * EU ePrivacy Directive under review * Russian data localisation update * WhatsApp/Facebook: Sharing of user personal data * Belgian State Secretary for Privacy eyes strengthening of DPA * GDPR: Belgian DPA issues 13 steps * South Africa: New Data protection regulator * Philippines: New Data Privacy Act * New York: Cybersecurity regulation for financial institutions * PNR: Draft agreement Canada/EU News DPAs comment on Privacy Shield As reported in Privacy Flash issue 14, the European Commission adopted the EUUS Privacy Shield framework with an adequacy decision on 12 June 2016. By notifying the Member States, the new framework for EU-US personal data transfers entered into force immediately. The adoption of the Privacy Shield marks the return to normalcy for transatlantic data transfers after the previous Safe Harbor framework was invalidated by the European Court of Justice in October 2015. As of 1 August 2016, companies are again able to self-certify with the US Department of Commerce, which operates the Shield. The European Data Protection Authorities were positive about the amendments made to the first draft of the Privacy Shield. Nevertheless, they remain sceptical with regards to the commercial aspects and the access by U.S. public authorities to data transfers stemming for the European Union. According to the DPAs, the Privacy Shield lacks provisions on automated decision-making and on the right to object to data processing. Furthermore they urge for clarification on the applicability of the provision to data processors. Additionally less strict guarantees should be enacted on the independence and powers of the Ombudsperson. According to the Chairwoman of the Art. 29 Working Party, the adequacy of the EU-U.S. Privacy Shield will not be challenged in its first year. In May 2017, the European Commission has scheduled a mandatory review of the adequacy of the Privacy Shield. EU ePrivacy Directive under review On 11 April 2016, the European Commission launched a public consultation to evaluate and review Directive 2002/58 on privacy and the electronic communication sector. The said Directive, commonly referred to as the ePrivacy Directive (ePD) was adopted with a view to harmonise national rules in relation to the processing of personal data in the electronic communications sector. The recent adoption of the General Data Protection Regulation (GDPR) as well as the rapidly changing technological landscape have inspired the European Commission to review the ePD. As mentioned in Privacy Flash issue 12, the reform of the Directive was launched in order to assess the need to broaden its scope, which currently only applies to traditional telecom providers, as well as to assess the consistency between the ePrivacy Rules and the GDPR and finally to enhance secure and confidential communications throughout the European Union. The consultation aimed at gathering views of all relevant stakeholders on the proposed reform and was open until 5 July 2016. The objectives of the ePD's review are fourfold: * Ensure consistency between the ePrivacy rules and the General Data Protection Regulation * Update the scope of the ePD against the background of the new technological evolutions and market reality * Increase security and confidentiality of communications * Address conflicting enforcement and improve harmonisation across Europe On 25 July 2016, the Article 29 Working Party and the European Data Protection Supervisor issued opinions on the ePD reform. Although these opinions are not binding in nature, their importance are considerable since they are an indication of how Data Protection Authorities will interpret the legal framework and how they aim to influence the reform of the ePD. Art. 29 Working Party recommends the European Commission to: * Scope: Extend the scope of the ePD to cover new types of telecom services ("over the top services") such as Internet telephony (VoIP), instant messaging, WhatsApp, webmail and messaging in social networks. Additionally the Working Party urges the Commission to clarify the meaning of "public electronic communications network", "electronic communications services" since they are often unclear and do not reflect the infrastructure of today's communication networks. * Confidentiality: Apply the requirement of confidentiality to all publicly available networks and services (wired or wireless, public, privately owned or managed) such as Wi-Fi services offered in hotels, universities, trains and hotspots. Furthermore, the article laying down confidentiality should be revised to establish a general prohibition of the interception, surveillance, monitoring of the content of electronic communications. * Consent: The prior consent of the user should remain key in the Directive, with regards to collecting metadata, content data and tracking techniques. Additionally, the Directive should refer to the GDPR provisions to ensure consistency. * Cookies: The provision on cookies should be rewritten in order to be as technologically neutral as possible to cover tracking techniques used on smartphones and Internet of Things applications. * Direct marketing: Revise the rules for unsolicited communications to ensure prior consent of the user for all types of unsolicited communications irrespective of the means used (e.g. mail, fax, text, video calls, etc.). * Deletion of data breach notification rules: To avoid duplicate notifications given the GDPR's data breach notification requirements, the Working Party recommends deleting the current data breach notification rule from the ePD. * Enforcement: Data Protection Authorities operating on the basis of GDPR should also be competent on ePD matters that involve personal data to promote harmonised sanctions and consistent enforcement. The opinion of the EPDS closely relates to the Working Party's recommendations with regards to extending the scope, improve the protection of confidentiality of electronic communications, requiring prior consent for unsolicited communications, conditions for consent, etc. The finalisation of the e-Privacy Directive reform will be expected by the end of 2016. Russian data localisation update As previously reported in Privacy Flash issue 6, Russian's new data localisation requirement entered into force in September 2015. The amended data protection law now requires companies from all over the world collecting or processing personal data of Russian citizens to store these data on Russian territory. The entry into force followed a warning shot by the government's IT, telecom and media regulator Roskomnadzor, who briefly blacklisted the Russian-language version of Wikipedia in August. In Russia, Roskomnadzor acts as the de facto Data Protection Authority. One of its task is to oversee the enforcement of the new data localisation rules, which seems to be initially aimed at Russian companies. According to reports, large foreign internet companies had been given until 29 August 2016 to comply. On 1 September 2016, Roskomnadzor reported to the press on the progress made during the first year of enforcement. The regulator came to the overall conclusion that a big majority of the audited companies comply with the localisation requirement. The audits cover mainly industry "clusters" such as e-commerce platforms, recruitment agencies, insurance companies and others. Additionally, general monitoring activities are carried out in reaction to public complaints. Since September 2015, 954 scheduled audits and 82 ad hoc audits were carried out. In the upcoming months another 470 audits are planned. The regulator identified about 1,822 infractions of which only 23 were related to the data localisation requirement. Next, another 8 infractions of the latter requirement were identified through general monitoring. The regulator has ordered to cease the infractions within a period of sixth months. Furthermore the regulator detected frequent usage of the online register of data operators that violate the Russian data protection law. About 161 blocked websites have been listed in the register up to now. In addition, about 63,000 data operators have notified the regulator of the location of their databases in accordance with the legal requirement to notify databases containing personal data. It is fair to say that the recent press release indicates that the Russian privacy regulator will proceed to enforce the data localisation requirement, mainly through audits. Instead of being fine focused, the main purpose of the regulator is to motivate companies to comply with the regulations in place. WhatsApp's sharing of user personal data with Facebook under scrutiny of EU DPAs On 25 August 2016, WhatsApp announced an update to its Terms of Service and Privacy Policy in order to allow user data to be shared with Facebook. Upon WhatsApp's acquisitions by Facebook in 2014, both companies were requested by the Director of the FTC's Bureau of Consumer Protection to update their privacy notices with the objective to inform consumers about the recent merger. In the Frequently Asked Questions, WhatsApp sets forth the reasoning behind this update. The new Terms of Service and Privacy Policy were updated to help customers gain insight in the new WhatsApp features and services such as WhatsApp Calling, WhatsApp for web and desktop and end-to-end encryption, as well as their strategy to assist customers to communicate with businesses that use WhatsApp services. Notwithstanding the fact that WhatsApp is now part of Facebook, both entities will continue to provide separate services. This however does not prevent personal data to be shared with Facebook and the Facebook family of companies for enabling better coordination and to improve the effective use of both companies' services. The stated overall purpose for which information will be shared with Facebook is to allow both companies (1) to calculate more effectively unique users, (2) to more efficiently fight spam and abuse, (3) to suggest Facebook users better friend suggestions and (4) to provide them with more relevant ads. Despite the possibility to opt out of the said data sharing with Facebook, the British DPA (ICO) is concerned about WhatsApp's initiative to share user data with Facebook for the purpose of carrying out targeted advertising. On 26 August 2016, Information Commissioner Elizabeth Denham stated: "The changes WhatsApp and Facebook are making will affect a lot of people. Some might consider it'll give them a better service, others may be concerned by the lack of control. Our role is to pull back the curtain on things like this, ensuring that companies are being transparent with the public about how their personal data is being shared, and protecting consumers by making sure the law is being followed. We've been informed of the changes. Organisations do not need to get prior approval from the ICO to change their approaches, but they do need to stay within data protection laws. We are looking into this." On 27 September 2016, the Hamburg DPA (Germany) took a firm action by ordering Facebook to stop storing and using personal data from over 35 million German WhatsApp users. The German DPA believes the German privacy law has been infringed by misleading consumers and not requiring explicit opt-in consent for the sharing. Facebook said it would appeal the order. Art. 29 Working party and other European DPAs, such as the Belgian and the French are also looking with great vigilance to the announced changes. Belgian State Secretary for Privacy intends strengthening of DPA During a television interview on 12 September 2016, the Belgian State Secretary for privacy, Philippe De Backer, announced his intention to strengthen the powers of the Belgian Data Protection Authority , the Privacy Commission. In his view, Data Protection Authorities (DPAs) should be empowered to sanction and impose fines onto companies which do not comply with the Belgian Privacy Act. He stated that fines will only be a last measure of redress. As a first step, DPAs should be more proactive. This would entail using the power to carry out privacy audits in a number of determined business sectors to check the current state of compliance with the requirements under the Privacy Act. Furthermore, the State Secretary highlighted the importance of raising privacy awareness amongst data subjects, especially in respect of their rights and obligations under the Privacy Act. Belgian DPA issues 13 steps to comply with the GDPR On 16 September 2016, the Belgian DPA (the Privacy Commission) issued guidance on how to prepare for the General Data Protection Regulation, which will be applied as of 25 August 2018. The guidance was issued following requests from many businesses on the impact and applicability of the new Regulation. By following 13 proposed steps, data controllers and processors will be able to detect differences between the current Belgian Privacy Act of 1992 and the new Regulation enabling them to prepare for May 2018. In the upcoming months, the Belgian DPA will issue additional guidelines and develop instruments for further assisting companies and organisations with their preparation. In the meantime, the Belgian DPA advises companies to identify which provisions of the GDPR will have the biggest impact on their processes and to prioritise those when assessing compliance with the new regulation. South Africa nominates data protection regulator South Africa's National Assembly has nominated Pansy Tlakula on 7 September 2016 as the Chair of the National Information Regulator to enforce the Protection of Personal Information Act 2013 (POPI) and to nominate the members of the office. The South African regulator's office works independently and can be held accountable by the National Assembly. Together with her co-workers, Pansy Tlakula will hold office for five years maximum with the possibility to be re-elected. The nomination will now have to be formally confirmed by the South African president. The regulator will have investigatory and enforcement powers to (amongst others) issue large administrative fines and demand publication of data breaches. Following the nomination of the regulator, certain rules of the POPI will have to be promulgated and the date of commencement of the Act will have to be made public. Companies will be given time to comply with the new rules and will not be held accountable for non-compliance for the 12 months post commencement date of the Act. Some voices state that the commencement date should be 24 May 2017, a year prior to the European General Data Protection Regulation becoming enforceable. This timeframe would allow companies to manage compliance with both the European regulation and the South African act. The Philippines finalise implementing rules to the Data Privacy Act In the Philippines, a comprehensive Data Privacy Act has been put in place since 8 September 2012. The latter Act mandated the establishment of a National Privacy Commission (NPC) empowered to supervise compliance with the Data Privacy Act and to issue rules (IRRs) regulating the implementation of the Act. Following a public consultation, the Implementing Rules and Regulations of Republic Act No. 10173 (IRRs) were published on 24 August 2016 and are enforceable as of 9 September 2016, 15 days after publication in the Official Journal. The publication of the IRRs is to be considered a major step forward for the protection of personal data in the Philippines. The rules aim to establish a high level of protection and are based on those already implemented in other data protection regimes such as the GDPR in Europe and the Personal Information Protection Act (PIPA) in South Korea. Some of the main concepts of the Data Privacy Act are listed below: * The Act defines personal information as "any information, whether recorded in a material form or not, from which the identity of an individual is apparent or can be reasonably and directly ascertained by the entity holding the information, or when put together with other information would directly and certainly identify an individual". Sensitive personal information are additionally protected. When processing sensitive data of over 1,000 data subjects, data controllers and processers are obliged to register the data processing with the NPC within a fixed period of one year. * The material scope not only covers data controllers – those who determine the means and purposes of the data processing, but also data processors – those who act on the instructions of the data controllers. Also personal data not relating to Philippine residents is protected by this Act. * Transparency, accuracy, legitimacy, proportionality are central principles under the Act. * Private sector data sharing can only take place with the prior consent of the data subject. * A data protection officer, compliance officer, or any other person has to be appointed by each person or body that processes personal data and will be accountable for the protection of privacy and security. * Security measures including organisational, physical and technical have to be adopted taking into account the nature of the data, risks, size of organisation, complexity of operations, current best privacy practices and cost. * Data controllers are obliged to notify the NPC of any data breach within 72 hours in the event of a real likelihood of serious harm to the data subject. Data breaches are sanctioned significantly including imprisonment from 1 to 3 years. * In line with the GDPR, the Data Privacy Act also provides the data subject the right to be informed, to object, to access and to rectify personal data and to data portability. State of New York proposes Cybersecurity regulation for financial institutions On 12 September 2016, the state of New York proposed a regulation requiring financial institutions such as banks and insurance companies to implement cybersecurity governance. One element of the proposed regulation includes the appointment of a cybersecurity officer with the task to oversee companies' cybersecurity program. Furthermore a written cybersecurity policy should be in place addressing a minimum number of fourteen cyber topics including incident response plans and the protection of data privacy. Companies will be required to notify the NYDFS of any material breach within 72 hours after discovery and carry out an annual risk assessment and penetration testing. The timing of the proposal is not surprising, given the increased focus of the federal regulator, the Securities and Exchange Commission (SEC), on the financial industry's cybersecurity practices. Earlier, the NYDFS has sent a survey to 200 regulated financial services institutions in order to gain a better understanding of the business' initiatives to fight cybercrime. Those surveys were summarised in the "Reports on Cyber Security" in the insurance sector on the one hand and the banking sector including third party service providers on the other hand. Companies will be required to take steps to confirm that their current cybersecurity programs are in compliance with these new regulatory requirements. After publication in the New York State Register, the proposed cybersecurity regulation will be subject to a 45-day notice and public comment period. Draft agreement between Canada and the EU on the transfer of passenger name record (PNR) data under fire On 8 September 2016, Advocate General Mengozzi of the Court of Justice of the European Union issued an opinion on the compatibility of the draft PNR agreement between Canada and the EU with the European Charter of Fundamental Rights. The opinion can be linked to the Courts previous rulings in Digital Rights Ireland – declaring the Data Retention Directive invalid – and the Schrems case – declaring the Safe Harbor framework inadequate. Although AG opinions are not binding to the Court, they are of high importance for the Court and are mostly followed in its final judgement. The PNR agreement was drafted in spring 2010 to gather passenger data of flights between Canada and the European Union. The transfer of data to competent Canadian authorities would serve to track and prevent terrorist attacks and other international crimes. The data collected covers amongst others passenger travel habits, payment information and dietary prescriptions revealing passenger's sensitive personal data such as health, religion or ethnic origin. Despite the fact that the draft agreement was signed on 25 June 2014, the European Parliament referred the agreement to the Court to verify compliance of the draft agreement with provisions of privacy and personal data as laid down in the Charter of Fundamental Rights. According to the AG, the agreement is incompatible with the said Charter because (1) it concerns the use, retention and processing of sensitive data, (2) PNR data would be retained for a period of five years maximum without reference to the purpose, (3) Canada is able to process PNR data beyond what is strictly necessary and independently of the purposes as laid down the agreement and (4) there is an absence of adequate safeguards and mechanisms to supervise the subsequent transfer of PNR data to foreign authorities. In his opinion, the agreement should be amended to exclude the collection of sensitive data and to target only those persons who can reasonably be expected to be a suspect of international crimes and terrorism. Enforcement * The French Data Protection authority, CNIL, issued on 20 July 2016 a formal notice to Microsoft to seek compliance with the French Data Protection Act within the next three months. The notice was initiated due to Microsoft's new operating system - Windows 10 - that enabled excessive collection of personal data and the tracking of the browsing history of users without their consent. Several breaches were identified, related to - amongst others - proportionality, data security, registration requirements, cookie law and cross-border data transfers. Microsoft risks being sanctioned with a fine of possibly EUR 150,000 to EUR 3 million (under the new French Digital Republic Law). * A car finance brokerage company was fined £30,000 by the Data Protection Authority in the UK, ICO, for sending out 65,000 unsolicited direct marketing text messages. * A software firm has suffered a data breach by someone who used an internal login without being authorised. The ICO and the police are currently investigating. * A local government body was fined £100,000 by the UK regulator for having left documents and files containing highly sensitive personal data in an abandoned building. * A telecom provider was fined £1,000 after its appeal to the ICOs decision was dismissed by the Information Tribunal. The case concerned a failure to notify a personal data beach to the ICO within 24 hours, under the Privacy and Electronic Communications Regulation. * Bluetrace, a technology company that develops Business Intelligence systems based on Wi-Fi and Bluetooth signals was issued penalties by the Dutch Data Protection Authority for gathering personal data of customers in the absence of providing prior notice. * The ICO fined a debt management company for £40,000 for sending out unwanted marketing texts to data subjects. * A marketing services company was fined £60,000 for making 1.6 million nuisance calls about market solar panels and green energy equipment. * The ICO fined a local authority £100,000 for leaving behind files containing personal data in a disused building. Conferences European Privacy Academy Dolce La Hulpe, Belgium, 13 – 16 November 2016 http://www.europeanprivacyacademy.com/ The European Privacy Academy is a unique training, knowledge and networking centre, focused on practical day-to-day management of privacy challenges. It provides both an on campus data protection officer course and on-campus or inhouse department-specific data protection training during which attendees learn to efficiently manage privacy and security in an integrated risk-based manner. The next sessions of the European Privacy Academy's DPO Course will take place on: * 14 - 17 November 2016 and 6 February 2017 * 8 - 11 May 2016 and 18 September 2017 * 13 - 16 November 2017 and 5 February 2018 * 7 - 10 May 2018 and 17 September 2018 IAPP Europe Data Protection Congress Brussels, Belgium, 7 – 8 November 2016 https://iapp.org/conference/iapp-europe-data-protection-congress/ The annual Data Protection Congress of the International Association of Privacy Professionals (IAPP) returns to Brussels on 7 November 2016 and offers participants keynotes from prominent privacy professionals, as well as thoughts on the upcoming General Data Protection Regulation (GDPR) from prominent data protection regulators. 15th Annual Data Protection Compliance Conference London, United Kingdom, 13 – 14 October 2016 http://www.pdpconferences.com/find-a-conference/82-15th-annual-dataprotection-compliance-conference This conference organised by PDP aims at providing data privacy professionals with the core tools and necessary information they need to have it applied in their daily practice. International Conference of Data Protection & Privacy Commissioners Marrakesh, Morocco, 17 – 21 October 2016 https://icdppc.org/news-events/forthcoming-conference-updates/ The International Conference of Data Protection and Privacy Commissioners aims at putting privacy on the agenda in the Arab, Muslim and African regions. The conference will be partially closed and partially open to the public. More information will be published in the coming months. 11th Annual Data Protection Practical Compliance Conference Dublin, Ireland, 17 – 18 November 2016 http://www.pdp.ie/conferences/conferences-overview/82-11th-annual-dataprotection-practical-compliance-conference The Annual Data Protection Practical Compliance Conference is dedicated to divulge information and prepare organisations on the General Data Protection Regulation. Next to the workshops, guests will have plenty of opportunity to network together with other Information and Compliance professionals and advisors. Conference on the General Data Protection Regulation Leuven, Belgium, 18 November 2016 Conference organised by the Belgian Data Protection Authority. More info to follow soon. Deloitte refers to one or more of Deloitte Touche Tohmatsu Limited, a UK private company limited by guarantee ("DTTL"), its network of member firms, and their related entities. DTTL and each of its member firms are legally separate and independent entities. DTTL (also referred to as "Deloitte Global") does not provide services to clients. Please see www.deloitte.com/about for a more detailed description of DTTL and its member firms. Deloitte provides audit, tax and legal, consulting, and financial advisory services to public and private clients spanning multiple industries. With a globally connected network of member firms in more than 150 countries, Deloitte brings world-class capabilities and high-quality service to clients, delivering the insights they need to address their most complex business challenges. Deloitte has in the region of 225,000 professionals, all committed to becoming the standard of excellence. This communication contains general information only, and none of Deloitte Touche Tohmatsu Limited, its member firms, or their related entities (collectively, the "Deloitte Network") is, by means of this communication, rendering professional advice or services. No entity in the Deloitte network shall be responsible for any loss whatsoever sustained by any person who relies on this communication. © 2016. For information, contact Deloitte Belgium. To no longer receive emails about this topic please send a return email to the sender with the word "Unsubscribe" in the subject line.	<urn:uuid:cfde2a7c-2665-4ae5-945c-04ae77d23bb0>	CC-MAIN-2018-26	https://www2.deloitte.com/content/dam/Deloitte/be/Documents/risk/Security%20and%20privacy/PrivacyFlash/ers-privacy-flash-issue15.pdf	2018-06-20T04:30:53Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267863411.67/warc/CC-MAIN-20180620031000-20180620051000-00617.warc.gz	961,804,267	5,469	eng_Latn	eng_Latn	0.989896	eng_Latn	0.995316	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1139, 4051, 6909, 9990, 13243, 15961, 19140, 22295, 24388, 26343, 28697 ]
EDINBURGH: MORNINGSIDE PARISH CHURCH OF SCOTLAND Scottish Charity No. SCO34396 (Hereinafter referred to as the Congregation) DATA PROTECTION POLICY CONTENTS 1. Overview 2. Data Protection Principles 3. Personal Data 4. Special Category Data 5. Processing 6. How personal data should be processed 7. Privacy Notice 8. Consent 9. Security 10. Sharing personal data 11. Data security breaches 12. Subject access requests 13. Data subject rights 14. Contracts 15. Review Data Protection Policy 1 Overview 1.1 The congregation takes the security and privacy of personal information seriously. As part of our activities we need to gather and use personal information about a variety of people including members, former members, adherents, employees, office-holders and generally people who are in contact with us. The Data Protection Act 2018 (the "2018 Act") and the EU General Data Protection Regulation ("GDPR") regulate the way in which personal information about living individuals is collected, processed, stored or transferred. 1.2 This policy explains the provisions that we will adhere to when any personal data belonging to or provided by data subjects, is collected, processed, stored or transferred on behalf of the congregation. We expect everyone processing personal data on behalf of the congregation (see paragraph 5 for a definition of "processing") to comply with this policy in all respects. 1.3 The congregation has a separate Privacy Notice which outlines the way in which we use personal information provided to us. A copy can be obtained from the congregation's Data Protection Officer, the Church Office or is available on the congregation's website. 1.4 All personal data must be held in accordance with the congregation's Data Retention Policy, which must be read alongside this policy. A copy of the Data Retention Policy can be obtained from the congregation's Data Protection Officer, the Church Office or is available on the congregation's website. Data should only be held for as long as necessary for the purposes for which it is collected. 1.5 This policy does not form part of any contract of employment (or contract for services if relevant) and can be amended by the congregation at any time. It is intended that this policy is fully compliant with the 2018 Act and the GDPR. If any conflict arises between those laws and this policy, the congregation intends to comply with the 2018 Act and the GDPR. 1.6 Any deliberate or negligent breach of this policy by an employee of the congregation may result in disciplinary action being taken in accordance with our disciplinary procedure. It is a criminal offence to conceal or destroy personal data which is part of a subject access request (see Paragraph 12 below) and such conduct by an employee would amount to gross misconduct which could result in dismissal. 2 Data Protection Principles 2.1 Personal data will be processed in accordance with the six 'Data Protection Principles.' It must: - be processed fairly, lawfully and transparently; - be collected and processed only for specified, explicit and legitimate purposes; - be adequate, relevant and limited to what is necessary for the purposes for which it is processed; - be accurate and kept up to date. Any inaccurate data must be deleted or rectified without delay; - not be kept for longer than is necessary for the purposes for which it is processed; and - be processed securely. We are accountable for these principles and must be able to demonstrate compliance. 3 Definition of personal data 3.1 "Personal data" means information which relates to a living person (a "data subject") who can be identified from that data on its own, or when taken together with other information which is likely to come into the possession of the data controller. It includes any expression of opinion about the person and an indication of the intentions of the data controller or others, in respect of that person. It does not include anonymised data. 3.2 This policy applies to all personal data whether it is stored electronically, on paper or on other materials. 4 Definition of special categories of personal data 4.1 'Special categories of personal data' are types of personal data consisting of information revealing: racial or ethnic origin; political opinions; religious or philosophical beliefs; trade union membership; genetic or biometric data; health; sex life and sexual orientation; and any criminal convictions and offences. 4.2 A significant amount of personal data held by the congregation will be classed as special category personal data, either specifically or by implication, as it could be indicative of a person's religious beliefs. 5 Definition of processing 5.1 'Processing' means any operation which is performed on personal data, such as collection, recording, organisation, structuring or storage; adaption or alteration; retrieval, consultation or use; disclosure by transmission, dissemination or otherwise making available; and restriction, destruction or erasure. 6 How personal data should be processed 6.1 Everyone who processes data on behalf of the congregation has responsibility for ensuring that the data they collect and store is handled appropriately, in line with this policy, our Data Retention policy and our Privacy Notice. 6.2 Personal data should only be accessed by those who need it for the work they do for or on behalf of the congregation. Data should be used only for the specified lawful purpose for which it was obtained. 6.3 The legal bases for processing personal data (other than special category data, which is referred to in Paragraph 8 below) are that the processing is necessary for the purposes of the congregation's legitimate interests; or that (so far as relating to any staff whom we employ) it is necessary to exercise the rights and obligations of the congregation under employment law. 6.4 Personal data held in all ordered manual files and databases should be kept up to date. It should be shredded or disposed of securely when it is no longer needed. Unnecessary copies of personal data should not be made. 7. Privacy Notice 7.1 If someone would not reasonably expect the way in which we use their personal data, we will issue information about this using a Privacy Notice which will be given to them at the point when the data is provided. 7.2 If our use of personal data is what someone would reasonably expect, we will provide information about this using a Privacy Notice which will be available on the congregation's website and can be found on the noticeboards in the church vestibule and the caretaker's area. 8. When is consent needed for the processing of personal data? 8.1 A significant amount of personal data held by the congregation will be classed as special category personal data, as it could be indicative of someone's religious beliefs. 8.2 Processing of such special category data is prohibited under the GDPR unless one of the listed exemptions applies. Two of these exemptions are especially relevant (although others may also apply): - the individual has given explicit consent to the processing of the personal data for one or more specified purposes; OR - processing is carried out in the course of its legitimate activities with appropriate safeguards by a foundation, association or any other not-forprofit body with a political, philosophical, religious or trade union aim and on condition that the processing relates solely to the members or to former members of the body or to persons who have regular contact with it in connection with its purposes and that the personal data is not disclosed outside that body without the consent of the data subjects. 8.3 Most of the processing carried out by the congregation will fall within the latter exemption, and will be carried out by the congregation with appropriate safeguards to keep information safe and secure. This information will not be disclosed outside the Church without consent. Such processing will not require the explicit consent of the data subject. 8.4 Where personal data is to be shared with a third party, the congregation will only do so with the explicit consent of the data subject. For example, personal data will only be included in a directory for circulation or included on a website where consent has been obtained. 8.5 If consent is required to process the information this should be recorded using the style consent form. If consent is given orally rather than in writing, this fact should be recorded in writing. 9. Keeping personal data secure 9.1 Personal data should not be shared with those who are not authorised to receive it. Care should be taken when dealing with any request for personal information over the telephone or otherwise. Identity checks should be carried out if giving out information to ensure that the person requesting the information is either the individual concerned or someone properly authorised to act on their behalf. 9.2 Hard copy personal information should be stored securely (in lockable storage, where appropriate) and not visible when not in use. Filing cabinets and drawers and/or office doors should be locked when not in use. Keys should not be left in the lock of the filing cabinets/lockable storage. 9.3 Passwords should be kept secure, should be strong, changed regularly and not written down or shared with others. 9.4 Emails containing personal information should not be sent to or received at a work email address (other than an @churchofscotland.org address) as this might be accessed by third parties. 9.5 The 'bcc' rather than the 'cc' or 'to' fields should be used when emailing a large number of people, unless everyone has agreed for their details to be shared amongst the group. 9.6 If personal devices have an @churchofscotland.org account linked to them these should not be accessed on a shared device for which someone else has the pin code. 9.7 Personal data should be encrypted or password-protected before being transferred electronically. 9.8 Personal data should never be transferred outside the European Economic Area except in compliance with the law. 10. Sharing personal data 10.1 We will only share someone's personal data where we have a legal basis to do so, including for our legitimate interests within the Church of Scotland (either within the Presbytery or to enable central databases held within the Church Office at 121 George Street, Edinburgh to be maintained and kept up to date). This may require information relating to criminal proceedings or offences or allegations of offences to be processed for the protection of children or adults who may be at risk and to be shared with the Church's Safeguarding Service or with statutory agencies. 10.2 We will not send any personal data outside the European Economic Area. If this changes all individuals affected will be notified and the protections put in place to secure your personal data, in line with the requirements of the GDPR, will be explained. 11. How to deal with data security breaches 11.1 Should a data security breach occur, the congregation will notify the Presbytery Clerk immediately. If the breach is likely to result in a risk to the rights and freedoms of individuals then the Information Commissioner's Office must be notified within 72 hours. 11.2 Breaches will be handled by the Presbytery Clerk in accordance with the Presbytery's data security breach management procedure. 12. Subject access requests 12.1 Data subjects can make a subject access request to find out what information is held about them. This request must be made in writing. Any such request received by the congregation should be forwarded immediately to the Presbytery Clerk who will coordinate a response within the necessary time limit (30 days). 12.2 It is a criminal offence to conceal or destroy personal data which is part of a subject access request. 13. Data subject rights 13.1 Data subjects have certain other rights under the GDPR. This includes the right to know what personal data the congregation processes, how it does so and what is the legal basis for doing so. 13.2 Data subjects also have the right to request that the congregation corrects any inaccuracies in their personal data, and erase their personal data where we are not entitled by law to process it or it is no longer necessary to process it for the purpose for which it was collected. Data should be erased when an individual revokes their consent (and consent is the basis for processing); when the purpose for which the data was collected is complete; or when compelled by law. 13.3 All requests to have personal data corrected or erased should be passed to the congregation's Data Protection Officer who will be responsible for responding to them in liaison with the Presbytery Clerk. 14. Contracts 14.1 If any processing of personal data is to be outsourced from the congregation, we will ensure that the mandatory processing provisions imposed by the GDPR will be included in the agreement or contract. 15. Policy review The Kirk Session will be responsible for reviewing this policy from time to time and updating the congregation in relation to its data protection responsibilities and any risks in relation to the processing of data.	<urn:uuid:8a442ddb-a09e-4d24-bc7b-784db6568060>	CC-MAIN-2022-21	http://morningsideparishchurch.org.uk.c31.sitepreviewer.com/wp-content/uploads/2018/05/Data-Protection-Policy-MPC.pdf	2022-05-21T00:43:37+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00036-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet	39,904,961	2,629	eng_Latn	eng_Latn	0.869984	eng_Latn	0.995592	[ "swe_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 148, 469, 2746, 4268, 6526, 8819, 10931, 12846, 13310 ]
Mass Intentions SATURDAY JANUARY 20 4:00 PM + MIKE & ANN RUSSEL SUNDAY JANUARY 21 8:30 AM JOHN & LEENA HOHMAN 11:00 AM INCREASE IN VOCATION TO RELIGIOUS LIFE TUESDAY JANUARY 23 8:00 AM +BRIAN & BRUCE RUSSEL WEDNESDAY JANUARY 24 8:00AM RITA TAYLOR BIRTHDAY THURSDAY JANUARY 25 8:00 AM OLLINGER FAMILY BIRTHDAYS FRIDAY BIRTHDAY JANUARY 26 8:00 AM BIBIANA SANCHEZ SATURDAY JANUARY 27 4:00 PM CAROLYN FAIREY SUNDAY JANUARY 28 8:30 AM MADDIE CLAIRE BOONE 11:00 AM VINCENT DUFF Eastern Shore Medical Weight Loss 251-625-4030 Collection details : 01/14/2024 Sunday collection $ 3713 Parish projects $ 40 Total deposit $ 3,753 17 & 18 February 2024; special collection for the Black Indian Missions Knights of Colubus and- Ladies Auxiliary #8740 - In the beginning was the word… Our Lady of Lourdes Liturgy WEEKLY READINGS Sunday 21 Jon 3:1-5, 10 1 Cor 7:29-31 Mk 1:14-20 Third Sunday in Ordinary Time Monday 22 Tuesday 23 Wednesday 24 Thursday 25 Friday 26 Saturday 27 2 Sm 5:1-7, 10 Mk 3:22-30 Day of Prayer for the Legal Protection of Unborn Children 2 Sm 6:12b-15, 17-19 Mk 3:31-35 Tuesday of the Third Time Week in Ordinary 2 Sm 7:4-17 Mk 4:1-20 Memorial of Saint Francis de Sales, Bishop and Doctor of the Church Acts 22:3-16 Mk 16:15-18 Feast of the Conversion of Saint Paul, Apostle 2 Tm 1:1-8 Mk 4:26-34 Memorial of Saints Timothy and Titus, bishops 2 Sm 12:1-7a, 10-17 Mk 4:35-41 Saturday of the Third Time Week in Ordinary ANNOUNCEMENTS 3 & 4 February 2024: Financial report for the year 2023 will be presented by Mrs. Gina McKeller (Finance council member) Catholic Parish OUR LADY OF LOURDES January 21 2024 Third Sunday in Ordinary Time Eucharistic Adoration, REV. PRABHU AROCKIASAMY, PASTOR EDCONNICK, DEACON 14 February 2024: Ash Wednesday; Masses @ 8:00am & 16 February 2024 @ 5:00 pm Stations of the cross by the Parishioners( if you like to read one of 14 Stations, please contact Mrs. Sallie Washington) & 5:30pm Lenten fish fries. Thanks to knights & Ladies Auxiliaries for cooking & serving fish 5:30pm fries. 17 & 18 February 2024: Importance of Stewardship & Financial scope for 2024 will be spoken by Mr. Ken Klienchrodt 28 April 2024 our Annual Lawn Party; Please stay tuned for more Information. 2024 Catholic Charities envelopes are in the pews and at the three entrances of the Church; please take and generously contribute to help people in need at the central and southern half of Alabama. 1621 Boykin Blvd Mobile, AL 36605 Church Email: [email protected] Church Phone Number: 251-479-9885 Www.ourladyoflourdesparish.com Office hours: Monday : Office Closed Tuesday— Friday : 9AM to 1PM SATURDAY & SUNDAY : OFFICE CLOSED Sacrament of reconciliation and schedules Saturday 3:15pm Eucharistic Adoration & Confession 3:30 PM – Holy rosary 4:00 PM – Holy Mass Sunday 8:00 AM – Eucharistic 8:30am- 10:30 adoration holy mass am – Eucharistic adoration 11:00am- holy mass Regular Weekdays Monday- communion service Tuesday—Friday 8:00 am – holy mass ANNOUNCEMENTS January 20/21: 2024 Catholic Charities appeal by the guest speaker Mr. Garfield Burke Jr. PhD. At all the weekend masses. Lenten rice bowls are at the three entrances of the church, please take and save what you could to help the hungry and those in need. You could bring those rice bowls back on Holy Thursday or Good Friday. "KofC Council 8740 is holding its annual Super- bowl Squares Fundraiser. They're selling 100 squares at $50.00 each. Text or call David Ladnier at 251-375-4844 to reserve your squares. cash prize of $1,000.00, and the Council will make a profit of $1,000.00." The four winners of each of the four quarters will receive a mass St. Peter, disciple of Jesus and leader of the Apostles St. Peter was a simple fisherman when he first encountered Jesus. Despite no training in the law of Moses or ministry, he became one of the most influential leaders in the early church. Through all of these interactions, Jesus was teaching and guiding Peter to become the steady, dependabile leader God had planned. Saint Peter's great love for Jesus made it possible to anything that Jesus asked. When other disciples were shocked at the Bread of Life Discourse and walked away, and Jesus asked twelve disciples, St. Peter's confidence and impulsiveness in speaking with Jesus create some of the most memorable moments in the Gospels. Will you leave me too?. Peter was first to speak up "Lord, to whom shall we go? You have the message of eternal life" (John 6:68). At the Last Supper, when Jesus presented his Body and Blood as the new Convenant, Peter did not question his power to turn simple bread and wine into his Body and Blood. Lord, open my mind and heart to the treasure of Your Truth as revealed in the Doctrine He had seen what Jesus could do and so he truly believed in the True Presence. Peter is a great role model for us. He exemplifies many of our human weaknesses but he never let his sins lead him away from Jesus, but rather lets them lead him to Jesus. of the Real Presence. Grant that my eyes may see, through faiths vision, the wonders of Your Love in The Most Holy Eucharist. As I meditate on the mystery of Your Hidden Presence, I entreat You to increase my faith, enkindle my hope, and deepen my love for You, my Eucharistic King. Amen Eucharistic Heart of Jesus, Have mercy on us Mary, Mother of the Eucharist, Pray for us St. Peter, Pray for us GOSPEL RFLECTION Dear Brothers and Sisters in Christ Jesus, Today we begin a continuous reading of Mark's Gospel that will carry us through this segment of the liturgical season of Ordinary Time. Remember that in Cycle B of the Lectionary, most of the Gospel readings are taken from the Gospel according to Mark. The Gospel of Mark does not begin with a narrative about Jesus' birth. Instead Mark begins by reporting on the preaching of John the Baptist. John is described as the voice in the wilderness sent to prepare the way of the Lord. Immediately after describing the work of John the Baptist, Mark reports on Jesus' baptism and his temptation in the desert. Jesus' public ministry begins after the arrest of John the Baptist. Mark wants his readers to understand the important connection between the end of the ministry of John the Baptist and the beginning of Jesus' own ministry. As we learn at the beginning of today's Gospel reading, Jesus preaches the Kingdom of God in continuity with the preaching of John the Baptist. Like John the Baptist, Jesus' pronouncement of the kingdom is a call to repentance. Yet Jesus' preaching is greater than John's. Jesus begins the time of fulfillment; the Kingdom of God is already here. This will be demonstrated again and again, both in Jesus' words and in the actions that follow. Jesus' healings and forgiveness of sins are signs of the Kingdom of God that he announces in his teaching. In contrast to last week's Gospel, in Mark's Gospel Jesus takes the initiative in calling his first disciples. As mentioned last week, it was more typical of first-century rabbinical schools for students to seek out rabbis, asking to be their disciples. In Mark's Gospel, Jesus breaks with this tradition and invites his disciples to learn from him. Jesus is said to have first called four fishermen—Simon, Andrew, James, and John. Simon and Andrew are brothers. Jesus promises that he will make them "fishers of men." James and John are also brothers. Mark does not report Jesus' words of invitation to them, but he does report that they left their fishing immediately; their father, Zebedee, was left behind in the boat. Mark's Gospel is told with a great sense of urgency and immediacy. Jesus is a person of action, and events occur in rapid succession. We see this in today's Gospel. Time is of the essence; the fishermen immediately put aside their livelihood to become Jesus' disciples. The Kingdom of God is here and now. The time of fulfillment is at hand. How might our lives be different if we more fully shared this sense of the immediacy of God's kingdom? In the name of the Father and of the Son and of the Holy Spirit - Amen. Rev. Prabhu Arockiasamy PRAYER LIST Anita Barclay, Campbell Berger, Katherine Berger, Bethany Ann Boltz, Roy Williams, Logan Bowers, Jerry Boyes, Patrick Webb Brownlie-Carey, Noli Causay, Teresa Coleman, Lee Cooley, Peter Coo- ley, Anita Cowart, Anne Davidson, Daniel Dorrie- ty, Marquitta Dukes, Dodie Dumas, Louise Frontz, Janet Gafford, Tony Golemon, Mary Ann Keith, Dennis Keith, Liz Kilborn, Edward Kimbrough, Debora Klaus, Steven Kuszynski, Shirley Lacy, Michael Langan, Alfred Leonard, Margie Lord, Rodney Lundy, Mary McKeough, Patricia McRoy, Craig Miley, Archie Moore, Elaine Moore, Wally Neese, Kenny Nixon, Tiffany Neese, Darlene O'Rourke, Alex Paneda, Lita Paneda, Scott Peck, Ursula Quintana, Kaitlyn Reynolds, Simon Schum, Cindy Snow, Mandy Spotswood, Curtis Steiner, Rita Steiner, Todd Stringfellow, Barbara Thomas, Katelyn Tillman, Tyler Upton, Rudy Visperas, Melanie Wacker, Albert Washington, Heather Washington, Darlene Watson, Lou Watt, Brad Wells, Bubba Williams, Bobby Zarate, Diane Lit- tle , Joyce Ladnier, Roy Still, William Patrick A, Fred L. Lorge, Joan A. Lorge, Barbara Smith, Frank Seltzer, Dennis Cottrell , Pete, Sam Barks- dale, Joey Murphy, Chuck Simmons , Damian Turk, John O'Conner, Fr. Francis J. Sofie Jr , Me- gan , Stephen Wiese, Matthew wiese, Raymond Floyes, Kay K Shaw, Lloyd J. Thompson , Ruby P Thompson, George E. Merren, Jr, Flora Decker, Mary Ann Fletchery, Pat McKeough , Mathew Wil- son , Eddie Booth Jr, Helen Bender, Paige Ellis, Eunice Miles, Gloria Leslie, Diana Holifield, Bea Burton , Janet & John Frazier, Henry Hoven, Mark Westbrook, Ronnie Hudson, Jewanda Taylor Jowe , Nicholas Balch ,Jean Stanley , Colleen O'Rourke, Perry Hockaday, David Curtis, Kristi D Young, Beth Kenny, Chad Gorlett, Ted Beasley, Angie Beasley,Mark Tranier, Barbara Tranier & Linda Davis MASS OPENING February 16 2024—Opening February 17 2024—Opening February 18 2024—Opening February 21 2024—Opening February 22 2024—Opening February 23 2024—Opening February 24 2024—Opening February 25 2024—Opening	<urn:uuid:3b2d4df9-42da-4549-8b1c-e8fbbe86a2e9>	CC-MAIN-2024-18	https://ourladyoflourdesmobile.weebly.com/uploads/9/0/8/4/90846438/oll012124-bulletin.pdf	2024-04-25T11:14:54+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-18/subset=warc/part-00246-29538f81-5664-4df2-acb6-7d8ba3d2a1aa.c000.gz.parquet	402,566,574	2,848	eng_Latn	eng_Latn	0.975649	eng_Latn	0.985543	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3719, 10329 ]
Sleep Tips: Temperature The following advice is only recommended for children who are over the age of 12 months Body temperature fluctuates during the day. Your child's body temperature will peak late afternoon and then start to drop in the evening. About two hours before bed, core body temperature lowers, which signals to the brain that it's time to fall asleep. This lowering of body temperature kickstarts melatonin production, which is the hormone that helps your child to fall asleep. Above 24 o C - Too Hot! Your child is likely to experience restlessness and have difficulties falling or staying asleep. 15.6 o C - 19.4 o C - Just Right! This is the ideal bedroom temperature for most people. Below 12 o C - Too Cold! Cold rooms can affect sleep, especially REM sleep. If your child is too cold, it may be difficult for them to settle to sleep. Invest in a room thermometer so that you can keep track of the temperature in your child's room and monitor how they sleep. Tips for reducing heat to promote sleep * Turn down or turn off radiators. * Reduce the level of bedding. Use a lower tog duvet or a light sheet. Look for bedding that is breathable or made with TENCEL - a material used in bedding that keeps the body cooler. * Remove soft toys from around the bed as they can trap heat. * Give your child light cotton underwear or nightwear to wear in bed. * Use a fan (only if your child is not disturbed by the noise). If it is particularly hot, you can place a tray of ice in front of the fan, which will cool the room even more. * Open bedroom windows (only if the noise outside won't bother your child). If you do open windows, be sure to keep blinds and curtains shut, so the room stays dark. * Fill a hot water bottle with cool water and place it at the bottom of the bed near your child's feet or put cooling socks on your child's feet. * Tie long hair up. Whilst there are common strategies that may support the sleep of babies and children, there are also different parenting and professional styles that may favour one approach over another. There is no single solution that will suit everyone. The advice contained in these downloads is for general information purposes only and is intended to give you some basic tips and strategies. Our advice is NOT intended to be a substitute for medical advice or treatment.	<urn:uuid:cce246c5-1419-4ec6-b5e8-f46cef3c2794>	CC-MAIN-2024-26	https://www.pikefold.manchester.sch.uk/serve_file/16327522	2024-06-22T05:26:16+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-26/subset=warc/part-00113-44971353-df4b-48d7-8025-975e8feb989b.c000.gz.parquet	803,337,585	497	eng_Latn	eng_Latn	0.99919	eng_Latn	0.99919	[ "eng_Latn" ]	false	rolmOCR	[ 2347 ]
SIEM REAP DECLARATION OF COMMITMENT 1. We, the Executive Directors of the Linking Organisations of the International HIV/AIDS Alliance, assembled in Siem Reap from 18-21 March 2019 for the annual Directors' Meeting, to celebrate our achievements around building a strong partnership of national civil society organisations that has become a leading force in the HIV response locally and globally, and to mark the evolution of our network into the Frontline AIDS partnership. 2. We declare our commitment to greater engagement and collaborative action together as Frontline AIDS, and to ending the epidemic of AIDS by 2030, taking into account our differing contexts in regions and countries throughout the world, as follows: - We will draw upon 25 years of technical expertise working with marginalised populations, to solve the toughest challenges that are too often avoided and ignored. - We will act as one globally diverse movement of people and organisations to deliver proven locally relevant innovations at scale, reaching those too often excluded. - We will constantly re-think what we do and challenge ourselves and our partners to do things differently. 3. We have undertaken to develop and implement a Frontline AIDS Plan of Action to set out our priorities and determine how our partnership will contribute to the HIV response. 4. We are proud to be founding partners of the Frontline AIDS partnership. Together with others, we commit to igniting innovations that will break down the social, political and legal barriers that marginalised people face and which stand in the way of a future free from AIDS. 5. And finally, we commit to learn from our own and other Frontline AIDS partners' experiences, contributing our strong leadership and innovative ideas, because we know that no one organisation can end AIDS alone.	<urn:uuid:5c32b58f-ba58-4a8f-8afa-e42629a91c02>	CC-MAIN-2024-10	https://frontlineaids.org/wp-content/uploads/2019/03/Final_Siem-Reap-Declaration-of-Commitment_28.3.19-WEB.pdf	2024-03-01T05:19:53+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-10/subset=warc/part-00253-d9675c6d-5c8d-45bb-9c98-c56e42022a4d.c000.gz.parquet	259,441,893	351	eng_Latn	eng_Latn	0.997998	eng_Latn	0.997998	[ "eng_Latn" ]	false	rolmOCR	[ 1832 ]
Antioch University AURA - Antioch University Repository and Archive Dissertations & Theses Student & Alumni Scholarship, including Dissertations & Theses 2017 Parental Advocacy, Stress, and Efficacy: The Hidden Costs of Diagnosing Learning Disabilities Katherine A. Behar Antioch University, New England Follow this and additional works at: http://aura.antioch.edu/etds Part of the Clinical Psychology Commons Recommended Citation Behar, Katherine A., "Parental Advocacy, Stress, and Efficacy: The Hidden Costs of Diagnosing Learning Disabilities" (2017). Dissertations & Theses. 344. http://aura.antioch.edu/etds/344 This Dissertation is brought to you for free and open access by the Student & Alumni Scholarship, including Dissertations & Theses at AURA - Antioch University Repository and Archive. It has been accepted for inclusion in Dissertations & Theses by an authorized administrator of AURA - Antioch University Repository and Archive. For more information, please contact [email protected], [email protected]. Running Head: PARENTAL ADVOCACY, STRESS, AND EFFICACY Parental Advocacy, Stress, and Efficacy: The Hidden Costs of Diagnosing Learning Disabilities by Katherine Alana Behar B.A., Stony Brook University, 2008 M.S., Long Island University, 2010 M.S., Antioch University New England, 2015 DISSERTATION Submitted in partial fulfillment for the degree of Doctor of Psychology in the Department of Clinical Psychology at Antioch University New England, 2017 Keene, New Hampshire DISSERTATION COMMITTEE PAGE The undersigned have examined the dissertation entitled: Department of Clinical Psychology PARENTAL ADVOCACY, STRESS, AND EFFICACY: THE HIDDEN COSTS OF DIAGNOSING LEARNING DISABILITIES by Katherine Alana Behar presented on February 16, 2017 and hereby certify that it is accepted. Candidate for the degree of Doctor of Psychology Dissertation Committee members: Barbara Belcher-Timme, PsyD Gina Pasquale, PsyD Accepted by the Department of Clinical Psychology Chairperson Dissertation Committee Chairperson: Martha Straus, PhD George Tremblay, PhD on 2/16/17 Signatures are on file with the Registrar's Office at Antioch University New England. Acknowledgements Words truly cannot express my gratitude for the love and support of my family and friends. To my parents, thank you for always being there to support me, to love me, and to stand up for me. Thank you for believing in me, even when I did not believe in myself. To Jason, thank you for your unconditional love and support and for your understanding and acceptance of the many sacrifices we have made over the last number of years. To Jon and Naara, thank you for your encouragement and your humor. Thank you for always seeing the light at the end of the tunnel and for helping me see it too. To Kathy and Danielle, thank you for never allowing me to doubt myself or think I wouldn't finish. For pushing me to be a better psychologist and for your willingness to help me no matter what. To Dominick, even without knowing it, you have been an inspiration to me. Thank you for spending so much time and care teaching me. I would not be where I am today without your expertise, warmth, encouragement and mentorship. I would also like to thank my committee members, who during my time at Antioch have taught me so much; I could not ask for a better group of role models. To Gina and Barbara, thank you for all of your help, guidance, and faith in me to complete this study. To my Chair, Marti, thank you for showing me the importance of never giving up on myself and for pushing me to produce a piece of work that I am truly proud of. Table of Contents List of Tables List of Figures Abstract The allocation of educational resources has been a widely debated topic. While scholars and government officials have focused their attention on how resources are divided, significantly less attention has been paid to how parents are advocating for their children to obtain necessary resources themselves. Existing data agree that fighting for educational resources can cause stress to parents (Levine, 2006). This is especially true for parents of children with learning disabilities. These children often require more individualized academic and educational attention. Currently, little research exists which focuses on the relationship between parental stress and parental self efficacy (the belief that one has an ability to accomplish a task) and none of the existing research focuses on parents of learning disabled children specifically. Self-efficacy is particularly important for those seeking resources for their children because parents who believe they can gain resources for their children are more likely to attempt to do so. The purpose of this study was to understand the relationship between parental stress and parental self-efficacy as well as understand the impact socioeconomic status has on parental perception of efficacy. Using a series of regression models, I determined that there is a negative correlation between stress and self-efficacy but that socioeconomic status seems to have no impact on the strength of this relationship. Such results suggest that regardless of socioeconomic status, the more stress Generation X parents feel, the less self-efficacious they feel. While no significant moderation was found, understanding the relationship between self-efficacy and parental stress of Generation X parents is still important. This information can help inform mental health practitioner's conceptualization and treatment of parents of learning-disabled children. Keywords: Generation X; learning disability; parental stress; self-efficacy; socioeconomic status Parental Advocacy, Stress, and Efficacy: The Hidden Costs of Diagnosing Learning Disabilities This study explored the role of socioeconomic status in the relationship between parental stress and self-efficacy for Generation X parents of children with learning disabilities. The study also aimed to provide a better understanding of the role that stress and self-efficacy play in a parent's ability to advocate for his or her learning disabled child. Parents must often fight for resources for their children in schools, and, as a result, parental self-efficacy is crucial. Self efficacy plays an important role in how an individual approaches a stressful or difficult task; if parents feel that they are able to succeed, they are more likely to advocate for their children. The transactional model of stress and coping is a framework for evaluating the processes of coping with stressful events. According to this model, stressful experiences are not "one size fits all" but rather, are mediated by a person's appraisal of the stressor. In addition, the social and cultural resources that an individual has at his or her disposal influence the impact of an external stressor (Antonovsky & Kats, 1967). When faced with a stressor, an individual first evaluates the potential threat (primary appraisal). By doing so, the individual is able to judge the significance of an event as stressful, positive, controllable, challenging, or irrelevant. If individuals feel they are facing a stressor, a second appraisal follows—an assessment of the coping resources and options available to deal with the stressor (Cohen, 1984). In other words, secondary appraisals address what one can do about the situation. This stress and coping framework supports the idea that individuals both evaluate and manage stress depending on social and cultural resources (Cohen, 1984). The current study hypothesizes that while all parents of children with learning disabilities face stress, those with more socioeconomic resources are able to translate stress into motivation while those with less resources experience stress as a roadblock. According to the National Center for Learning Disabilities (2014), 2.4 million American public school students were identified as having a learning disability ("LD"). The Learning Disability category was one of the fastest growing categories of special education, increasing more than 300% between 1976 and 2000. In order to address the growing educational need in the US, the Individuals with Disabilities Education Act (IDEA) was developed to provide special education and related services to children and youth with disabilities who are 3–21 years old. The law guaranteed each child a free public education, appropriate to the individual's needs. However, with such severe competition for educational resources, school districts often struggle to effectively manage the educational needs of the students. Under the Individuals with Disabilities Education Act (IDEA), schools that fail to appropriately educate disabled children can be made to pay for private school tuition; however, only wealthy parents can afford to first send their children to an expensive private school and sue for reimbursement later. Learning disabilities are disproportionately diagnosed among those living in poverty (2.6 %) versus those living above poverty (1.5 %); (National Center for Learning Disabilities, 2014), so public educational resources need to be allocated accordingly—based on socioeconomic status. While the relationship between self-efficacy and advocating is clear—in that people who feel they are able to accomplish a task are more likely to try and do so—the reasons why one parent might report more self-efficacy than another is not well established. Current data indicate that wealthy parents devour educational resources at disproportionate rates, which might suggest that parents with high socioeconomic status have more "power" to advocate for their learning disabled children. But they also face significant social and emotional stress (Luthar, 2003). Even so, it is likely that poverty itself is disempowering; wealthy parents with high socioeconomic status and high levels of stress might still experience higher level of self-efficacy than parents with low socio-economic status and high levels of stress. Historically, narratives of success have served as part of the foundation of American culture. Over the years, the quality and length of education has become a potent measure by which to determine success. During a speech on college affordability, President Obama stated, "Now, there aren't many things that are more important to that idea of economic mobility—the idea that you can make it if you try – than a good education. All the students here know that" (The White House, Office of the Press Secretary, 2013, para. 26). Obama offered his remarks in the spirit of inclusion; however, it is indisputable that affluent families have significantly more resources to acquire quality educations. Although educational success has long been viewed as a pathway to greater economic advantage, little evidence for such social mobility currently exists. Indeed, as greater numbers of diverse students have entered public schools, the fight for finite resources has intensified. Studies, such as those conducted by Duncan and Murnane (2011), have suggested that the growing achievement gap may be due, in part, to increasing parental investment in children's cognitive development but not to parental achievement, as the relationship between parental achievement and child achievement appears to have remained relatively stable over the last five years. As part of the fight for educational advantage, a shift in the way people think about disabilities has occurred. Once thought of as stigmatizing, disability diagnoses are now considered advantageous in the fight for educational resources. Statement of Concern Previous research has provided a base of information on the relationship between socioeconomic status and child behavior. For instance, it has been widely accepted that poor children are at high risk for stress, as well as for social, emotional, and behavioral problems. Over the past few years, children of affluent parents have received increased attention as a population that is also at risk for these difficulties (Luthar, 2003). While many studies have focused on the stress of raising a special needs child, little research has focused on the differential effect socioeconomic status has on self-efficacy for these parents. By looking at the role that socioeconomic status plays in the relationship between parental stress and self-efficacy, this study aimed to provide a better understanding of whether the ability to advocate for educational resources is influenced by stress and/or socioeconomic status. It is hypothesized wealthy parents with high socioeconomic status and high levels of stress likely experience higher level of self-efficacy than parents with low socio-economic status and high levels of stress. This study sought to clarify the role socioeconomic status plays in the relationship between parental stress and self-efficacy and aims to provide a better understanding of whether the ability to advocate for educational resources is influenced by stress and/or socioeconomic status for parents of children diagnosed with a learning disability. Rationale and significance. In a country with ongoing economic disparities, including an increasingly struggling middle class and growing numbers of impoverished children, limited public education resources are being stressed to the breaking point. According to the National Center for Learning Disabilities (2014), "learning disabilities" is the largest category of students receiving special education services, and is also one of the fastest growing categories of special education. Between 1976 and 2000, the learning disability category increased by more than 300% (National Center for Learning Disabilities, 2014). It is no surprise that affluence allowed for greater educational opportunity, including access to expensive private schools. However, it is surprising that educational assistance in public schools, such as Individualized Education Programs (IEPs) and 504 plans, for those with learning disabilities, could have so many additional benefits: boost grades, improve students' chances of getting into top colleges, and help students receive more time and other accommodations on college entrance exams (Rado, 2012). It might mark a new chapter in affluent American life that parents have sought diagnoses for their children; at some point in recent history, a child having a disability turned from a stigma to an advantage. Indeed, economic advantage alone is no longer a guarantee of success. Numerous recent studies have addressed the emotional difficulties uniquely faced by affluent children under pressure to excel in school (e.g., Koplewicz, Gurian, & Williams, 2009; Luthar, 2003; Luthar & Latendresse, 2005; Luthar & Sexton, 2005). Editorials and the popular press have similarly highlighted an intensifying competition for advantage and educational resources (e.g., Johnson, 2012; Phillips, 2012; Rado, 2012), describing in detail the competitive struggles among families vying for highly selective schools and universities (e.g., Freedman, 2013; Levine, 2007; Teitell, 2013). Affluent children are showing significant signs of emotional duress at all levels of education. However, the experiences of their parents have been notably absent from the conversation surrounding the rising stress and competition for educational advantages. Indeed, there is, to date, no published literature that focuses on how parents experience stress and self efficacy as they fight for resources to help their children to succeed at extraordinarily high levels. More specifically, there is no literature which focuses on the role socioeconomic status plays in the relationship between parental stress and self-efficacy. This study aimed to provide a better understanding of whether the ability to advocate for educational resources is influenced by stress and/or socioeconomic status, particularly for parents with children diagnosed with a learning disability. Conceptual Framework A conceptual framework is the structure of concepts, assumptions, beliefs and theories that support and inform research. A conceptual framework is also an important part of research design (Miles & Huberman, 1994; Robson, 2011). According to Miles and Huberman, a conceptual framework, "explains, either graphically or in narrative form, the main things to be studied-the key factors, concepts, or variables-and the presumed relationships among them" (p. 18). In order to "frame" the research questions, the Transactional Model of Stress and Coping will be used (Lazarus & Cohen, 1977). The Transactional Model of Stress and Coping is a framework used to evaluate how individuals cope with stressful events. When faced with a stressful situation, a person evaluates the situation in two ways: (a) evaluating the significance of the stressor and (b) assessing if the stressor can be controlled or managed (Glanz et al., 2002). Coping efforts develop out of a person's secondary appraisal; if a person believes they are overwhelmed, they are more susceptible to the negative effects of stress. Stress does not affect all people equally, but it can lead to illness or other negative experiences. Lazarus and Cohen's (1977) Transactional Model of Stress and Coping fits well with the focus of this project as it is a model which specifically takes into consideration the impact stress has on coping. The model also acknowledges that access to different resources will impact the coping outcome differently. More specifically, the Perceived Stress Scale, which was used in this study to measure parental stress is based upon Lazarus's original transactional model of stress. This original model argues that the experience of a stressor is influenced by evaluations on the part of the person as to how well he or she can manage a stressor given available coping resources (Cohen, Kamarck, & Mermelstein, 1983). Research Question The primary research question of this study is as follows: What is the role that socioeconomic status plays in the relationship between parental stress and self-efficacy for Generation X parents of children with learning disabilities? A related sub-question of this study is: How does socioeconomic status have a differential effect on self-efficacy in stressed parents of children with learning disabilities? Literature Review The following literature review focuses on the changing psychology and culture surrounding the diagnosis and treatment of learning disabilities in the US. It specifically explores the current allocation of financial and educational resources. In addition, it focuses on the demographics of Generation X parents, social pressure, and the relevance of parental stress and efficacy in raising a child with a learning disability. Learning Disabilities Learning disabilities have been defined as neurologically based processing problems in the brain. These problems affect a person's ability to receive, store, process, retrieve or communicate information, and impact certain skills, such as reading, writing, planning, paying attention, remembering information, and executive functioning more generally. While the specific nature of these brain-based disorders is still not well understood, considerable progress has been made in mapping some of the characteristic difficulties of learning disorders to specific brain regions and structures (National Center for Learning Disabilities, 2014). In addition to progress in the area of brain mapping, there is now an increased understanding of the relationship between genetics and learning disabilities, as documentation of the same or related disorders have occurred with considerable frequency within members of the same families (National Center for Learning Disabilities, 2014). According to the National Center for Learning Disabilities (2014), learning disabilities are not caused by visual, hearing or motor disabilities, intellectual disabilities, emotional disturbances, cultural factors, economic disadvantages, or inadequate instruction. However, there is a higher reported incidence of learning disabilities among people living in poverty, perhaps because of the increased risk of exposure to poor nutrition, ingested and environmental toxins, and other risk factors during early and critical stages of development. For example, learning disabilities may be the result of damage to the developing brain before or during birth, including maternal illness, injury or malnutrition, drug or alcohol use during pregnancy, low birth weight, oxygen deprivation, and premature or prolonged labor. Other possible postnatal causes of learning disabilities might include traumatic injuries, severe nutritional deprivation, or exposure to poisonous substances, (e.g., lead; National Center for Learning Disabilities, 2014). Special Education in the United States. Before the Education for All Handicapped Children Act (EAHCA) became law in 1975, U.S. public schools accommodated only one out of every five children with disabilities (U.S. Office of Special Education Programs, n. d.). In 1990, the EAHCA was replaced by the Individuals with Disabilities Education Act (IDEA), to place more emphasis on the individual rather than the condition the individual faced (i.e., the handicap). The basis of IDEA was that all children between the ages of 3 and 21 were entitled to an individualized, free, and appropriate public school education, including those deemed as having a "disability that adversely affects academic performance as being in need of special education and related services" (National Center for Education Statistics, 2015a, para. 1). This act became a law in 2004. IDEA ensured states and public agencies provided early intervention, special education, and related services to more than 6.7 million children and youth with disabilities in public schools across the nation (National Center for Education Statistics, 2015a). Many students with disabilities have made significant gains in public schools, because of IDEA. According to Hallahan and Kauffman (1982), labeling students with specific disabilities led to the development of specialized teaching methods, assessment approaches, and behavioral interventions that were useful for all teachers. Prevalence of learning disabilities. Houtrow, Larson, Olson, Newacheck, and Halfon (2014) examined the prevalence of childhood disabilities and found that nearly 6 million children were considered disabled in 2010-2011. This number represented a 15.6% increase from 2001 2002. In addition, there was nearly a 20% increase in disabilities classified as neurodevelopmental, or attributable to mental health problems. A similar study, which used the National Longitudinal Survey of Youth, reported that the prevalence of learning and behavior problems more than doubled from 1988 to 2006 (Van Cleave, Gortmaker, & Perrin, 2010). The increased rate of childhood disabilities was disproportionately driven by the 21% increase of children diagnosed with neurodevelopmental conditions. Houtrow et al. (2014) suggested four possible explanations for the increased rates of disabilities related to neurodevelopmental or mental health conditions: (a) changes in diagnostic criteria; (b) overall increases in rates of certain diagnoses, such as autism; (c) an increased awareness of such conditions; and (d) the need for a specific diagnosis to receive services. For a variety of reasons, disability diagnoses have increased at a dramatic rate, placing intense demands on the educational system to provide services that, by law, they have to offer. Changes in Diagnosis/ the Diagnostic and Statistical Manual 5 The newest version of the Diagnostic and Statistical Manual (DSM-5), the standard by which psychological and learning disorders are determined, may be partially responsible for the dramatic increase in children identified with learning disabilities. One significant change from earlier versions eliminates the requirement for a significant discrepancy between IQ and Achievement to diagnose a learning disability (Tannock, 2014). The DSM-5 criteria underscore a new understanding: learning disabilities are not connected to children's cognitive abilities or their academic achievement levels, but rather, to neurodevelopmental disorders that, "impede the ability to learn or use specific academic skills" (Tannock, 2014, para. 1). Those crafting the DSM-5 believed the changes would enable practitioners to focus more clearly on intervention services. The elimination of the discrepancy criterion supports the importance of intervention possibly at the cost of diagnostic consistency— potentially leading to misdiagnosis and over diagnosis in the future (Tannock, 2014). Parents with economic resources may be discovering unintended benefits from these diagnostic changes. With more emphasis being placed on the examiner's interpretation of clinical material and less on objective test data, individuals with the financial ability to seek out or "shop around" for private testing services have more incentive to do so. Given that the criteria for making a diagnosis is not as stringent as it once was, acquiring a learning disability diagnosis may not be as difficult. The increase in learning disability diagnosis among the more affluent coincides with the advent of these new standards. Indeed, researchers such as Abrams (2005) have noticed a recent trend of "buying" diagnoses to gain untimed or extended time for standardized testing for children in wealthier families. Access to diagnosis for educational advantage is a trend that has been described widely in the popular press, For example, in a recent New York Times article, titled Paying for a Disability Diagnosis to Gain time on College Boards, Dr. Jeanne Dietrich, a psychologists in White Plains, New York noted that she had five requests for testing because parents reported having a child that, "bombed the SAT and wanted a quick diagnosis because the application deadline was nearing for the next round of tests" (Gross, 2002, para 6). Drs. Luck and Mattis, also psychologists in White Plains, New York, noted similar experiences of "seeing many parents and college-bound teenagers who want only one thing: a diagnosis that will entitle the youngster to additional time to take the Scholastic Achievement Tests" (Gross, 2002, para 3). These researchers conclude that the evident trend is related to the recent decision by the College Board to remove the "flag" for students who take the tests under various special conditions. In other words, colleges do not know which of their applicants had untimed tests. Clearly, many parents are asking for evaluations legitimately, but "more and more are also asking because, why not ask? It's part of our culture that every point matters, so they're looking for any kind of edge" (Gross, 2002, para 4). There are many psychological, social, and cultural reasons to be concerned that diagnoses can be bought. And the trend of diagnosis shopping is particularly alarming when one considers the increasing number of children diagnosed with learning disabilities competing also for the finite amount of money allocated for special education resources. DSM-5 changes have not only impacted psychological testing and diagnosis, but have also affected the delivery of services to children. For example, the changes made to the criteria for diagnosing autism and related disorders could significantly impact what and how services are delivered. Individuals once diagnosed with higher functioning Asperger's disorder might no longer meet the stricter Autism Spectrum Disorder criteria of the DSM-5. As a result, these individuals might not qualify for services any longer. Conversely, some critics have argued that changes in the DSM-5 could plausibly increase the number of children that meet the criteria for diagnosis. For example, diagnoses of ADHD in older children are likely to increase with the changes made to the DSM-5. Greater numbers of children diagnosed with ADHD will then add to the burden placed on overwhelmed special education services in schools. Changing Academic Standards Historically, the United States government has maintained only minimal academic standards for students. Despite multiple modifications in standards at the government and community levels, as growing numbers of diverse students go through school, access to resources is increasingly inequitable for poor and minority children. Efforts have been made to address this. For example, in 2015, under President Obama, the Every Student Succeeds Act (ESSA) was signed into law. The ESSA was a reauthorization of the Elementary and Secondary Education Act (ESEA), which Present Johnson had signed into law in 1965. The ESEA originally focused on civil rights and offered federal grants to districts with low-income students. The ESEA was an example of the federal government's expanding role in funding public education (U.S. Department of Education, 2015). The ESSA was a replacement for the unpopular No Child Left Behind Act (NCLB). This act was originally created to hold schools and states more accountable for ensuring the education of poor and minority children, but many states felt that the standards were too strict and that the government was taking too much control. While the role the federal government has played in academics has changed over the years, one constant has remained clear–throughout history, poor and minority children have received fewer resources, less funding, and less attention. As a result of the federal government's minimal and uneven involvement, academic benchmarks are primarily determined by the state or by smaller governing bodies, such as local communities and school districts. Therefore, the academic standards of schools have tended to reflect the socioeconomic statuses of the communities in which they are located. In other words, the wealthier the community is, the higher the expectations and academic standards are, and the more resources allocated. Since the 1960s, many steps have been taken to develop unified academic standards, though there has been much controversy regarding the success of such programs: economics continue to override simple social policy fixes. In general, children in poorer communities attend poorer schools. While larger communities have continued working to develop cohesive academic standards, the truth is that, "the closeness of the connection between home influences and school results suggests that education reform alone cannot eliminate the wide achievement gaps dividing low-income and minority students from their more affluent White and Asian peers" (Barton & Coley, 2007, p. 2). Over the past several decades, the federal government has made some additional efforts to address inequitable educational standards. For example, in 1989, Present George H.W. Bush set six education goals for the year 2000, with "Goals 2000," (Rothstein, 1999). In 1994, under Present Clinton, the U.S. Congress adopted these goals and added two more. The original goals were as follows: By 2000, all children would start school ready to learn; 90% would graduate from high school; all would demonstrate competency over challenging subject matter in English, math, science, foreign languages, civics, economics, the arts, history, and geography; the United States would be first in the world in math and science; all adults would be literate; no schools would have drugs, violence, firearms or alcohol; teachers would have needed skills; and all schools would get parents involved. (New York State Achieves, 2006., p. 1) The focus of "Goals 2000" was to help support the "state development of standards and assessments and school district implementation of standards-based reform" (New York State Archives, 2006, p. 65). Goals 2000 strategically required very little regulation, as it supported the individual reform efforts many states already had underway. In addition, any state that adhered to any basic standard-based reform and had a planning process could receive funding under this program. However, as is the downside of any program regulated by smaller governing bodies, Goals 2000 relied on state by state requirements; consequently, the program's impact greatly varied from state to state, district to district, and even school to school. Since most of the funding from Goals 2000 was allocated at the district level, there was not much money available at the state level to help under-resourced districts. Even high-poverty districts that were aware of federal programs that could help them were not experienced enough in standards-based reform to apply for funding (New York State Archives, 2006). Thus federal initiatives have had relatively little impact in closing the gap between impoverished and wealthier school districts. Resources and Demographics According to 2012 research conducted by the Organization for Economic Cooperation and Development (OECD), out of 34 industrialized countries, the United States spends the most money per student per year, at approximately $16,000. However, this money has not been evenly distributed. The United States also offers more educational resources to schools serving affluent students than those serving poor students. For example, among the 34 OECD nations, disadvantaged schools only have lower teacher/student ratios than those serving more privileged students in the United States, Israel, and Turkey. In addition, wealthy school districts spent thousands of dollars more per student than poor school districts did, on average. For example, Bronxville Union Free School District in New York, the second richest district in the country, spent an average of $27,980 per student, per year, according to the U.S. Census Bureau's American Community Survey from 2006-2010. In contrast, Queensbury Union Free School District, also in New York, spent an average of $12,264 per student, per year. More money for the rich means more services for the rich, which inevitably means less money and fewer services for the poor. In the United States, resources and funding for learning disabilities is broken down into a number of categories including Section 504 of the Rehabilitation Act of 1973 (Section 504) and rights under IDEA such as an Individualized Educational Program (IEP) and education in the Least Restrictive Environment (LRE) (National Center for Learning Disabilities, 2014). Section 504 was created to prevent discrimination against people with disabilities in federally funded programs and activities, such as public schools. While section 504 does not directly fund programs, it does permit the government to terminate funding given to programs that discriminate against people with disabilities. Some schools use Section 504 to support students who have learning disabilities but only require minor accommodations or modifications (National Center for Learning Disabilities, 2014). In addition, children with disabilities who do not require more comprehensive special education support also are frequently served under this law. Interestingly, all students eligible for special education services under IDEA are also eligible under Section 504, while the reverse is not true. Under the Individuals with Disabilities Education Act (IDEA), federal special education funds are distributed through state grant programs. Most of the annual funding comes from Part B of IDEA. In the 2014-2015 school year, the total IDEA funding was $12.50 billion and $11.47 billion was dedicated to Part B Section state grants. When IDEA was put in place, it was estimated that children with disabilities cost approximately twice as much to educate as other children (New America, 2015). In support of this estimate, a study by the Center for Special Education Finance (2004) found that in the 1999-2000 school year, schools spent 1.9 times more in total expenses and 2.08 times more in current operating expenditures on students with disabilities. Notably, even with this finding, the rise of spending on special education was mostly the result of an increase in the number of students identified as "disabled," and less the result of a disproportionate increase in the cost of special education services (EdCentral.org, n.d.). Affluence and Learning Disability Diagnosis The association between poverty and higher rates of learning disabilities has been long established. Notably, over the past 10 years there have also been remarkable increases in numbers of children from more affluent families who have been diagnosed with a neurodevelopmental or mental health disability (Houtrow et al., 2014). Although the absolute rates of children with disabilities is still higher among poorer children, Houtrow and colleagues found that children who lived in richer homes (≥400% above the federal poverty level) had a 28.4% relative increase of disability diagnoses, as compared to those who lived in poverty, who experienced a 10.7% increase. The 10-year study shed light on the first disproportionate rise in neurodevelopmental or mental health disabilities occurring among socially and economically advantaged families since 1957, when the National Health Interview Survey (NHIS) began tracking childhood disabilities (Houtrow et al., 2014). The reasons for this increase in LD diagnosis among more affluent children appear to stem from a confluence of factors. One such factor may be extreme competition for admission to prestigious colleges. For example, an ABC News article, titled "Does loophole give rich kids more time on SAT?" suggested that high school students from affluent districts might sometimes obtain questionable diagnoses to earn extended time on standardized tests, including the SATs (Tapper, Morris, & Setrakian, 2006). According to the College Board, approximately 2% of students in an average school should be diagnosed with learning disabilities, but, in some elite schools, up to 46% of students have received special accommodations to take standardized tests, including the SATs (Tapper et al., 2006). Similarly, Abrams (2005) conducted a study on students in an elite school in Washington, DC and found that the number of students receiving accommodations was more than three times the national average. In addition, he found that, on average, the students who received accommodations obtained scores on standardized tests that would have unquestionably qualified them for entry into prestigious universities. Generally, students with learning disabilities who receive appropriate accommodations are expected to then perform as well as most other students. The high level of superior scores in Abrams' study may actually suggest over performance—and a likely misuse of the system. Clearly then, as Abrams (2005) suggests, while untimed testing has evident benefits for learning disabled students, it also offers notable advantages to non-learning disabled students. Abrams reported the following compelling data: learning-disabled students who received extended time on the SATs scored an average combined score of 975 on the math and verbal sections. Standard test takers in 2005 scored an average of 1,029 on these combined sections. Affluent students in Washington, DC who took untimed SATs in 2005 scored an average combined score of 1,105. This score was well above the national average in 2005—and even further above the 2005 Washington, DC average of standard test takers, who scored a combined average of 957. These data not only supported the argument that having unlimited time on tests had a greater benefit for non-disabled students, but also offer evidence for the growing concern that children from affluent families might well be "buying" the diagnosis of learning disabilities to gain untimed access to college entrance examinations. It is not possible to ascertain the extent or implications of this particular test-taking loophole. In an attempt to protect learning-disabled students from unfair prejudice, the College Board stopped flagging scores of students who took the SATs with extended time, in 2003. As a result, colleges could no longer determine if tests were taken under standard or non-standard conditions. While removing the flags did protect students from unwanted bias, Abrams (2005) pointed out that it also might have made it easier for students who did not need extended time to ask for it, regardless. This new zeitgeist of diagnostic advantage has unexplored effects on the involved children, their parent, schools and universities, and the way resources are allocated in the US. Access to Resources in the United States—Allocation of Special Education Services In 1975, the U.S. Congress passed IDEA. This act was intended to create equality in a once broken educational system. The IDEA guaranteed all children the right to a free, appropriate public education, including children with disabilities. While the IDEA was created with equality in mind, there has been a significant variation in the extent that these guarantees have been upheld since its inception. For example, according to several researchers (e.g., Codrington & Fairchild, 2012; Fierros & Controy, 2002), children with disabilities in low income and minority communities have been consistently denied appropriate educational services, either by misdiagnosis or by a complete denial of any educational difficulties. Similarly, Rado (2012) states, "Only about 1 % of public school students statewide had 504 plans in 2009-10, but wealthy school districts in North Cook and Lake counties had nearly four to five times that figure" (para. 11). Demographics and the "Gen X Effect" According to the National Center for Learning Disabilities, between 1976 and 2000, "learning disabilities" was the fastest growing category of special education, growing more than 300% (2014), leading to the highest percentage of children diagnosed with learning disabilities in history. A study published in the June 2011 issue of Pediatrics, noted that the rate of developmental disability was on the rise by about 17 % between 1997 and 2008—the span of time coinciding with the rapid rise in "Generation X" becoming parents of school-age children. While the exact boundaries and life-experiences that define a generation aren't precise, Generation X has been viewed as those born in the 20-year span between 1960-1980 or, more narrowly, in the 12-year span between 1965-1977 (Martin & Tulgan, 2002; Zemke, Raines, & Filipczak, 2000). Cohort effects. Cohort theory has been used in social science to describe ways individuals in a cohort relate to each other. More specifically, generational cohort theory explains differences in cohort relationships across generations (D'Amato & Herzfelt, 2008; Edmunds & Turner, 2005). According to this theory, important historical events and social changes in society could affect the values, attitudes, beliefs, and tendencies of members. Historical events might include traumatic experiences, such as wars, wealth booms and busts, or experiences that symbolize an ideology (Sessa, Kabacoff, Deal, & Brown, 2007). Events that take place during earlier development period rather than in later years are especially consequential. Therefore, individuals who are born during a particular time, and are in the same cohort, often have shared specific inclinations and cognitive styles. According to Howe and Strauss (2000), three attributes that more clearly identified a generation include: (a) perceived membership, (b) common beliefs and behaviors, and (c) common location in history. The generations that have been most often discussed in popular literature are the Baby Boomers, those born between the mid-1940s and the mid-1960s, Generation X (Gen Xers), those born between 1960 and 1980, and Millennials, those born between 1980-2000. The current study focused on Generation X parents, those individuals who are now be between ages of 36-56 who have an adolescent between ages 10 and 17. Even though Generation X is a relatively small demographic cohort, Generation X parents appear to wield significant economic clout that may be integral to this remarkable increase in diagnosed learning disabilities in their children. Parenting and Wealth In the popular press, Gen Xers have often been described as the "overlooked generation" (Taylor & Gao, 2014). Gen Xers are a relatively small generation in size, with approximately 65 million people squeezed between two much larger generations—Baby Boomers (approximately 77 million people) and Millennials (approximately 83 million people). As compared to Baby Boomers and Millennials, Gen Xers are less often discussed. In a Pew Research survey, about 6 in 10 Baby Boomers and Millennials said they thought their generation was unique, as compared to half of Gen Xers who said the same (Taylor & Gao, 2014). Similar research conducted by the Pew Research Center suggested that Gen Xers might be a less distinct generation for many reasons, often finding themselves right in the middle on many polls, including scales measuring demographics, attitudes on political and social issues, and use of technology (Taylor & Gao, 2014). While Gen Xers have often been thought of as forgotten middle children, they do stand out significantly on one important measure—spending power. According to a Shullman Research Center (2014) study, Generation X's spending power is significantly disproportionate to their numbers. The Shullman Research Center notes that Generation X is the smallest of the three middle generations (Boomers, Gen X, and Millennials), but Gen Xers have more spending power than any other generation, with 29% of estimated net worth dollars and 31% of total income dollars. Though Gen Xers who make more than $250,000 annually only made up 6 million of 60 million people, research showed that most Gen Xers still have higher average incomes than their Baby Boomer or Millennial counter parts. In addition to noting the spending power of Gen Xers, the Shullman Research Center reported on how such resources were being allocated. Notably, a major value of Gen Xers educating their children; 50% of Gen Xers said providing for their children's college costs was a major goal, as compared to only 20% of adults overall. Generation X as parents. In the early 1990s, Gen Xers began to have school-aged children. Around 2005, Gen Xers made up the majority of middle school parents, and, by 2008, most had children in high school. The term "helicopter parents" was coined to describe Baby Boomers, the parents of Millennials. This name, however inaccurate it might be, came from a popular press idea about Boomers' tendencies to hover over their children in all areas of their development. In comparison, Howe (2010) describes Gen Xers as "stealth fighter parents" as follows: Stealth fighter parents do not hover. They choose when and where they will attack. If the issue seems below their threshold of importance, they save their energy and let it go entirely. But if it crosses their threshold and shows up on the radar, they will strike rapidly, in force and often with no warning. (para. 4) Thomas (2009) similarly describes the Gen X parenting style as "ferociously advocating for their children, responding with hostility to anyone they perceive as getting in the child's way" (para. 9). Many researchers have described Gen Xers as the least nurtured generation in American history, citing the statistic that 40% of them were raised as latchkey kids. According to Dr. Michel Brody (as cited in Thomas, 2009), the Gen X parenting style developed out of the need for them to "heal the wounds from their own childhoods through their children" (para. 12). Howe (2010) described Boomers as parents who deeply cared about the moral and civic goals of education, as compared to Gen Xers, who tended to be more interested in how schools created opportunities for their children. Another interesting and important difference in the parenting styles of Boomers and Gen Xers is their use of technology. Gen Xers were first introduced to technology in the 1990s. As parents, Gen Xers were comfortable with using technology, and combined with their individualistic mindsets, were self-taught experts on the needs of their children. Howe described Boomers as a generation who simply assumed the reward of school; by contrast, Gen Xers were more skeptical of anything they could not see. As school age children, Gen Xers faced failing educational systems in the midst of 1960 reforms, and, as parents, Gen Xers wanted proof that their children would not face the same problems. With this goal in mind, Gen Xers have been described as parents who are willing to do whatever it takes to help their children succeed. While Howe discusses the results of extensive social research on generational trends, such conclusions are presented as broad generalizations. While interesting and salient to the study of parenting, such descriptions are not necessarily representative of Gen X parents across the cultural, ethnic and socioeconomic spectrum. Parental involvement Across the socio-economic spectrum, the role of parental involvement has been well documented. Involving parents in schools has proven to be a powerful way to bridge the gap between home and school, and to eventually improve student achievement. According to numerous studies (e.g., Hara & Burke, 1998; Hill & Craft, 2003; Marcon, 1999), parental involvement in a child's education has consistently been found to be positively associated with a child's academic performance. The positive correlation between parental involvement and child academic success has not only been noted by researchers, but also by lawmakers and politicians. At a press conference held in 2009, President Obama promoted accountability from both students and parents, stating, "no government policy will make any difference unless we also hold ourselves more accountable as parents" (The White House, Office of the Press Secretary, 2009, para. 44). In addition, the Obama administration planned to double allocations for parental involvement programs to $270 million, and encouraged states to use another $145 million to provide grants to promising parent-involvement initiatives (Barton & Coley, 2007). Though parental involvement has been shown to have a positive correlation with child academic performance, aggressive advocating among more outspoken parents may lead to unevenly dispersed limited resources. Parenting, affluence, and social pressure. In the last few years, headlines such as "Mom Arrested For Hacking School Computers to Change Kids' Grades" have seemed to be increasingly prevalent in mainstream media (Lupkin, 2012). This story was about Catherine Venusto, a Pennsylvania mother who faced six felony charges for allegedly hacking into her children's school computer to change her daughter's grades. She was accused of changing her daughter's "F" to an "M," for "medical exception," in 2008, and of changing her son's "98" to a "99," in 2009 (Lupkin, 2012, para. 3). It was discovered that Venusto hacked into the school district computer system over 100 times (Lupkin, 2012). Although this was a single anecdote, it might have resonated with the new stealth-fighter zeitgeist. While the Pennsylvania school district released an official statement, pledging to do everything they could to prevent similar incidents from ever happening again, the underlying causes of the action are worthy of greater exploration. Some researchers have suggested that one underlying cause could have been the cultural shift toward greater competition for what affluent parents perceived as limited resources (e.g., Ivy league education and smaller Advanced Placement classes). "Good" was simply not good enough anymore. According to Madeline Levine, a psychologist and author of Teach Your Children Well (2012) and The Price of Privilege (2006), parents did not want to hear that their children were average (as cited in Shepard, 2005). Although probability theory has stated that, in a normal distribution, over 80% of what is being measured falls in the middle, parents like Venusto, especially those offering their offspring so many other advantages, may not want to believe that they have average children. The Culture of Grade Inflation Another related element in the Gen X parenting analysis is the culture of grade inflation. For example, according to Harvey C. Mansfield, a government professor at Harvard College, "A little bird has told me that the most frequently given grade at Harvard College right now is an A-" (Moraski, 2007, para. 4). Data released by Benedict H. Gross, the dean of Harvard University, found that 48.8% of grades awarded in 2005-2006 were A's or A-'s. In contrast, only a third of grades were As or A-s in the 1985-1986 academic year which suggests, at very least a sharp increase in grade inflation over the last 20 years (Moraski, 2007). In a faculty meeting, Mansfield (as cited in Clarida & Fandos, 2013), argued that the school's steep inflation represented "a failure on the part of this faculty and its leadership to maintain our academic standards" (para. 3). While Mansfield represented a growing number of academic faculty members who have acknowledged how problematic grade inflation has become at that elite institution—and others like it—little research has been conducted to address the problem and discover why it is happening. There is however, some speculation about the source of grade inflation. For example, Arthur Levine, a former president of Columbia University, Teachers College (as cited in Shepard, 2005), attributed the trend of grade inflation to the Vietnam War, in which "men who got low grades could get drafted" (p. 3). Levine (as cited in Shepard, 2005) argued that the second piece of the inflation puzzle was "the spread of graduate schools where only A's and B's were passing grades" (p. 3). These ideals may have been passed down to undergraduates, perhaps setting a new standard. In this analysis, too, affluent Gen X parents who paid for their children to attend college wanted good returns on their investments, and their expectations might have also played a significant hidden role in grade inflation. For example, Levine (as cited in Shepard, 2005) also believed that parents expected nothing less than perfect grades, in exchange for tens of thousands of dollars in tuition each year. Parents and students want to know that they were "getting their money's worth-" college has become a consumer product, rather than just a privilege (Shepard, 2005, p. 3). The consumer reality for parents who pay steep tuition for their children to attend private school, or live in areas with costly property taxes is that they seem to expect an exceptional product for the price they are paying to fund their children's education (Shepard, 2005). Access to exclusive schools, then, seems to not only be something to strive towards but something one can purchase, like any other consumer good, for those with enough money. According to Stossel (2004), the increasingly selective nature of elite higher education also seemed to represent "a moment of truth—a judgment day of sorts when the talented, the impressive, and the worthy, are sorted from the merely average; and hopeful youngsters learn whether they are destined for greatness or for unremarkable, middling lives" (para. 1). Stossel also states, "As nearly every ambitious high school student knows, failure to gain admission to the Ivy League or to one of the nation's other top schools translates into second-class status for life" (para. 1). Although ample data have suggested that success and happiness have little to do with the colleges people attend, Stossel described this as the new zeitgeist among affluent American Gen X parents (Bain, 2012). The Pressure of Affluence Despite their significant access to resources, children raised by affluent Gen Xers appear to be more vulnerable than previous generations of children. Several researchers (e.g., Levine 2006; Luthar, 2013; Luthar & D'Avanzo, 1999) have suggested that children of affluent parents suffer higher than expected rates of depression, anxiety, substance abuse, and other problems generally attributable to intense academic expectations. As a component of fierce competition, their parents may feel isolated and stressed as well. Indeed, despite the increased rates of significant emotional distress, affluent parents may demonstrate a lack of understanding regarding their child's need for treatment—perhaps as a result of sharing the dominant belief that wealthier children constitute a low risk population. The pressure experienced by affluent Gen X parents might be partly attributable to their increasingly distinct subculture, disconnected from the norms and realities faced by other generations and economic groups. For example, while there is immense competition among affluent high school students for elite college admissions, Blum (2009) points out "only three % of colleges accept less than one third of their applicants" (p. 96). In other words, most colleges accepted most students who apply. Blum's study supports the idea that underachieving among the privileged classes is now interpreted by parents as failure to achieve at a superior level, regardless of a child's actual aptitude. According to Luthar (2013), affluent children suffer as the result of "high-octane achievement," or the pressure to not just succeed, but also excel in multiple areas, such as school, extracurricular activities, and in their social lives (para. 8). Luthar further explained that affluent children experience even more pressure knowing such high goals were close within their reach and comparably expected of their peers. For example, students who could afford the best SAT tutoring felt the most pressure to study and get perfect scores. Advantage, expectations, and anxiety. A small but growing body of research on affluence and stress provides a rationale for the stress and anxiety faced by the children of wealthy parents (Levine, 2006; Luthar, 2013; Luthar & D'Avanzo, 1999). Though parents were generously implicated in these studies, significantly less research has directly focused on the impact of affluence on parents' own levels of stress and experiences of efficacy providing the best opportunities for their children. And though few would question parents' motivations for wanting the best for their children, stories such as those described by Golden's (2006) raise questions about the desperate entitlement of parents feeling compelled to buy college admissions for their children. Golden argues that top universities are also complicit, doing everything in their power to admit children of affluence and privilege. Buying Ivy admissions is not new though. According to an article in the Economist, former president George Bush and former secretary of state John Kerry were both "C" students who would have had little chances of getting into Yale if they had not come from Yale families (2006). However, with more high school seniors applying to college, the disproportion is also increasing. In fact, it is widely known that elite colleges like Yale and Amherst admit a much higher percentage of legacy applicants—known for their financial commitment to the institution—than applicants overall (Golden, 2006). Parental stress about college—beginning even in with toddlers in preschool— may be a powerful motivator for parents to advocate for their children. With an increase in competition for fewer spots in urban private schools, often starting before kindergarten, the rising cost of higher education, and fierce competition for scholarships, many authors and educators have suggested that affluent parents feel pressured to help their children in any way possible. Researchers (e.g., Palmer, 2005; Rojstaczer, 2002) suggest that some parents describe increased competition as the reason they pushed better-than-average grades; other parents may believe that average simply was not good enough in their families. Charity Preston, an elementary school teacher in Sandusky, Ohio said she had seen this occur most often with parents of gifted children. She said, "Many parents expect their child to get an A, period" (Lloyd, 2016, para. 11). She also added that it was "a matter of social competition among parents" (Lloyd, 2016, para. 11). There are many reasons why parental expectations of their children's success do not match the reality of the bell curve; however, it is likely that the effort it takes to realize these expectations is stressful for affluent Gen X parents as well as for their children, Stress and Success in America In such a volatile economic, social, and political time in the United States, social inequality has seemed to spread, while the opportunity for upward social mobility has appeared to slow down. Adding to the gap between the haves and have-nots, the returns on higher education have increased—the median earnings of Americans with bachelor's degrees or higher were about double those of high-school dropouts, in 2000 ("Poison Ivy," 2006). According to the National Center for Education Statistics (2015b), in 2011, adults in the United States with higher educational attainment also had significantly higher employment rates than adults with lower educational attainment. The clear division of wealth along educational lines has added another layer of pressure to succeed in school. Insecurity/Superiority In addition to competition between classes caused by economic wealth, Max Weber (1968), a sociologist and political economist and profound influencer of social theory and social research, believed that power and prestige cause competition within classes, particularly the upper class. Competition within classes is particularly important to understand when considering the advantages, expectations, and anxiety of affluent Generation X parents. Weber first noted that elite status groups remained connected to each other based on personal ties (such as socioeconomic status) and a sense of honor. This collectivist theory was reinforced by shared conventions specific to a group's collective traits, tastes, and interests (Dimaggio, 1982). According to this tradition, status cultures are seen as resources that aid in success, and are passed down from parents to children. This theory is particularly interesting when used to consider how the relationship between parental self-efficacy and parental stress is influenced by socioeconomic status, and the competitive drive that attends privilege. While all Generation X parents likely feel some level of stress and challenge to their sense of self-efficacy attending to their learning disabled children, the relationship between stress and self-efficacy is likely different depending on socioeconomic status. Parental Anxiety and Efficacy Parental stress and efficacy in Gen-Xers raising learning disabled children are best understood in the context of three psychological perspectives: (a) stress and investment, (b) cohort effects, and (c) the parent-child relationship. Stress and investment. Psychologists and evolutionary biologists, such as Trivers (1974), have most often used parental investment theory to explain differences in parental behavior towards high-risk children. Trivers' concept of parental investment theory has two main ideas. First, parental investment includes all actions that contribute to the reproductive success of the offspring, and, second, investment in one child compromises the ability of the parent to invest in other children. In other words, focusing on one child takes time and energy away from other children. Although this theory has almost exclusively been applied to discussions of the abuse and neglect of "high risk" (low-phenotypic-quality) children, Trivers' parental investment theory could also help explain parental anxiety related to learning disabled children. When considering parental investment theory in a more general context, high-risk should be more loosely understood as any child who might be at risk for not succeeding. According to parental investment theory, the parental dilemma is foremost whether or not to "invest" in high-risk children. For evolutionary psychologists, the term invest is simply defined as "to keep alive." As applied to parental anxiety, the term invest has a more literal definition. According to Mann (1992), the decision to invest in high-risk children is a costly one, but yields high return on investment. Though Gen Xers have been considered to be the "least parented" generation-half of Gen Xers grew up in divorced households, the majority were raised in daycare, and 40% were latchkey children—they evidently believe that investing in their children is a worthwhile expenditure (Thomas, 2010). In one study supporting this thesis, Thomas found that Gen X parents were overly protective and involved advocates of their children, because their own parents were either uninvolved or absent in their childhoods. In addition, Gen X parents witnessed tremendous social change and instability. They saw their parents processing the Vietnam War and the downfall of President Nixon in Watergate. As teenagers, they experienced the collapse of Wall Street in the 1980s, recessions in the 1990s, and the fall of the housing and technology markets in recent years. Interestingly, many researchers (e.g., Halstead, 1999; Thielfoldt & Scheef, 2004) have also described Gen Xers as an individualist generation, as compared to the older Boomers. As previously noted, Gen Xers may be considered a more individualistic generation because of their mistrust of authority and experiences as latchkey kids (Taylor & Gao, 2014). These experiences are associated with traits of independence, resilience, and adaptability (Taylor & Gao, 2014). These traits also likely factored into Gen Xers' decisions to individualistically invest in their children at all costs. As parents, Gen Xers expect immediate and ongoing feedback, and are also comfortable giving feedback. For instance, a Baby Boomer might complain about his or her dissatisfaction with his or her child's teacher, but would perhaps be less likely to act on his or her dissatisfaction, figuring it was a part of the school experience. An affluent Gen Xer parent would not waste any time getting involved, and would explain to the teacher exactly what he or she believed was the problem (Thielfoldt & Scheef, 2004). A foundational assumption of parental investment theory is that offspring production is constrained by resources. Another fundamental prediction of parental investment theory is that parents will experience a trade-off between fewer "high quality" offspring and more "low quality" offspring (Lack, 1947). Evolutionary theory offers additional support for the idea that parents will preferentially invest in their own offspring, as opposed to the offspring of others, and that parents will receive the greatest inclusive fitness benefits if they direct their investment toward their own children. In the case of Gen Xer parents who already have individualistic tendencies, it helps to explain how Gen X parents might experience the greatest benefits if they solely invest in their own offspring. In the current study, parental investment is fundamentally constrained by competition for external resources. Parents must engage in purposeful advocacy to acquire and maintain remedial services and supports for their relatively disadvantaged children. Therefore, the concept of individualistic investment is particularly salient for supporting children with learning disabilities; those "at-risk" for not succeeding academically. The parent-child relationship. The desire of parents to invest intensively in their offspring begins in a child's infancy—if not en utero. Parental investment in infancy is profoundly emotional, requiring of mothers as Winnicott (1960) suggests, a "primary maternal preoccupation." Winnicott's theory examines an infant's move towards independence from the mother. For some more affluent Gen X families, it appears that those stealth fighter pilot moms are more reluctant to separate; some of these parents seem to be stuck in the earlier merger phase. According to Winnicott (1960), a child or infant cannot be understood without the context of the parent. Winnicott described the period of infancy as the period of ego development during which integration was the main feature. Though the general tendency of an infant is towards growth and development, an infant could not reach independence without the appropriate maternal care. Winnicott described satisfactory parental care as: (a) holding; (b) mother and infant partially relating; and (c) infant independently relating (1960). In the holding stage, an infant experiences absolute dependence, as the infant is merged as one with the mother. In the second stage, the infant experiences relative dependence, during which the infant could become aware of needs and relate to the mother as an external entity. In the third stage, the infant moves towards independence, during which the infant develops an intellectual understanding of his or her own needs (Winnicott, 1960). In Winnicott's (1960) frame, the end of merging results in a change. As soon as the mother and child separate, the mother's attitude changes, as she no longer has to magically understand the needs of her child. The mother seems to know that the child has the capacity to send signals about his or her needs. If a mother knows too well what a child needs, there would be no need for parent child separation or for a relationship to develop. As a result, the child would never be able to gain control of expressing his or her own needs and would never need to, as the mother would consistently be able to predict the needs of the child, as if they were still merged and the child were still an infant (Winnicott, 1960). In a society of stealth fighter parents, particularly those raising more vulnerable children contending with learning challenges, the process toward greater independence appears to be slowed. More of these children may remain merged with their parents (Howe, 2010). The needs of the child and of the mother can seem indistinguishable. The aim of my study was to explore the role that socioeconomic status plays in the relationship between parental stress and self-efficacy in Generation X parents who have children with learning disabilities. In this inquiry, I intended to shed some light on the important issue of stress in parents of learning disabled children, and more specifically, the way socioeconomic status influences the strength and direction of the relationship between parental stress and self efficacy. Methodology The following methodology section includes methodological rationale, participant selection and recruitment, inclusion criteria, participant demographics, measures, procedures, data analysis strategies that were used, and ethical considerations. Quantitative Rationale The goal of the current study was to better understand the relationships among parental stress, self-efficacy, and the socioeconomic status specifically of Generation X parents who have children with learning disabilities. The specific subset of parents was selected for the purpose of studying a group assumed to have a higher than average level of stress. It was hypothesized that the relationship between parental stress and parental self-efficacy is impacted by socioeconomic status. Based on a review of the literature, I predicted a positive liner relationship between stress and self-efficacy for parents with high socioeconomic status and a negative liner relationship between stress and self-efficacy for parents with low socioeconomic status. This study used quantitative methods to test the hypothesis. Quantitative research seeks to understand the direction of the relationships between variables and can establish the strength of cause-and-effect relationships. Furthermore, since one goal of the study was to understand the experiences of a generation, quantitative data based on a random sample could be generalized to a wider population. In this study, socioeconomic status was the moderator variable between parental anxiety and parenting self-efficacy. Participants The identified study population was Gen Xers born between 1960 and 1980. I was interested in gathering a random and diverse sampling of Gen Xers from across the United States. Therefore, participants were recruited via social media, by word of mouth, and through a large academic listserve. Once identified as interested, participants were screened for their inclusion in the study. Inclusion criteria were listed as follows: Participants had to be the parent of children under the age of 17 who had an IEP or 504 accommodations for a learning disability, or who were actively seeking such accommodations. Children with diagnoses of Autism or primarily emotional disabilities were excluded from the study as their needs were more complex and parental stress for this population was already well documented. Recruitment Data were collected between the months of October and November in 2016. During recruitment, flyers were posted in public spaces such as libraries, coffee shops and bus stops. Recruitment letters were sent to private and group therapy practices and to school administrators in Connecticut, Maryland, Massachusetts, New York, New Jersey, and Pennsylvania. In addition, information was posted across a number of social media websites, particularly in parent and learning disability support groups and on relevant academic and educational listservs. In total, 157 individuals completed the online survey. Out of the 157 participants who completed the survey, 68 were excluded from analysis. Sixty-seven of these individuals were excluded because they had had a child with Autism Spectrum Disorder and one participant was excluded for not completing demographic data needed to determine socioeconomic status. The response percentage of individuals who qualified for the study was 56%, for a total of 88 participants included in the data analysis. When using a 95% confidence interval, the margin of error calculated with the sample size of 88 is +/- 10.4% ("Research tools, n.d."). Measures Three scales were used to conduct this study: (a) Hollingshead's Four Factor Index of Social Status (1975), the Parenting Sense of Competence scale (PSOC; 1978), and The Perceived Stress Scale-10 (PSS-10; 1983), as well as a number of demographic questions were used to conduct the study. The demographic questions (Appendix B) were reviewed to describe the sample and to ensure that each subject met inclusion criteria. The Hollingshead's Four Factor Index of Social Status (Appendix A) was scored to determine socioeconomic status and the scores on the Perceived Stress Scale (Appendix C) and the Parenting Sense of Competence Scale (Appendix D) were determined to measure, in turn, stress and self-efficacy. Social status. The Hollingshead (1975) Four Factor Index of Social Status is a survey that was designed to measure social statuses of individuals based on four domains–marital status, employment status, educational attainment, and occupational prestige (see Appendix A). Though little data is available regarding the inter-rater reliability of socioeconomic status measures in general, some data are available describing the relationships between the Hollingshead Four Factor Index and other established measures of socioeconomic status. Gottfried (1985) compared the Hollingshead Four Factor Index of Social Status with the Revised Duncan Socioeconomic Index (Stevens & Featherman, 1981) and the Siegel Prestige Scale (Siegel, 1971) and found that the Hollingshead correlated .87 with the Duncan index and .73 with the Siegel scale. Additionally, Hollingshead found a significant correlation between his measure and an early measure of social status based on the National Opinion Research Center (NOR; Cirino et al., 2002). The scoring of the Hollingshead Four Factor Index is as follows: education is rated on a 7-point scale that lists highest grade completed (i.e., 7=graduate/professional or 1= less than 7th grade). Occupation is rated on a 9-point scale (i.e., 9=higher executive or 4=smaller business owners; see Appendix G for the full occupation list). Parental sense of competence. Gibaud-Wallston and Wandersman (1978) developed the Parenting Sense of Competence scale (PSOC; Appendix D), to assess the beliefs, values and perceived skills of parents. It is made up of two subscales: Parental Self-Efficacy and Parental Satisfaction. The parental satisfaction section looks at anxiety, motivation and frustration, and the Efficacy section looks at competence, capability levels, and problem-solving abilities in the parental role. The self-efficacy subscale consists of eight items and the satisfaction subscale consists of seven. Both subscales utilize a 6-point Likert scale, ranging from Strongly Disagree ("6") to Strongly Agree ("1"). Items include, for example, "The problems of taking care of a child are easy to solve once you know how your actions affect your child, an understanding I have acquired;" "Even though being a parent could be rewarding, I am frustrated now while my child is at his/her present age." Of note, nine items (#'s 2, 3, 4, 5, 8, 9, 12, 14, and 16) are reverse coded, meaning that a high score on these items is not indicative of having a sense of competency. The range of possible scores is 17-102. Johnston and Mash (1989) provided construct validation of the PSOC, with a sample of more than 500 subjects, as well as sufficient internal consistency reliability for the Parental Self-Efficacy subscale (Cronbach's alpha = .76). Parental stress. The Perceived Stress Scale-10 (PSS-10) measures parental stress (Cohen et al., 1983). The PSS-10 is a 10-item instrument used to assess the degree to which individuals assess situations in his or her life as uncontrollable, overloading, unpredictable, and generally stressful. It was designed for use on community samples, with individuals who at least had junior high school educations. Each item asks about thoughts and feelings during the last month, which helps determine levels of stress. Questions include, for example: "In the last month how often have you been upset because of something that happened unexpectedly?" "In the last month, how often have you felt that you were unable to control the important things in your life?" "In the last month, how often have you felt nervous and 'stressed'?" The PSS-10 consists of 10 items and utilizes a 4-point Likert scale, ranging from "Never" (0) to "Very Often" (4). The positively stated items (4, 5, 7, and 8) are reverse scored (0=4, 1=3, 2=2, 3=1, and 4=0), and the remaining items are straight scored. The scores are then added together to determine a total stress score. The highest possible stress score on this measure is 40 and the lowest possible stress score is zero. For this scale, higher total scores indicated higher levels of stress. The PSS-10 has shown relative item invariance to gender, race, and education, making it applicable to a wide range of subjects (Cole, 1999). Cohen and Williamson (1988) reported high internal consistency alphas, ranging from .75 to .86 for the PSS-10, as well as a test-retest reliability of .85 (see Appendix C for instrument questions). Procedures In order to address the above stated research question, this study used the Hollingshead Four Factor Index of Social Status (see Appendix A), Demographic Questions (see Appendix B), Perceived Stress Scale (see Appendix C) and Parent Sense of Competency Scale (see Appendix D). The questions from the three scales were transferred into online questionnaire form which allowed individuals to make a response selection with the click of a button. A recruitment letter (see Appendix E) was distributed on social media, on a large academic listserv, in public spaces, and in the waiting areas of 12 of urban and rural health centers. The letter directed interested participants to the study's website where they were given the opportunity to read over the informed consent (see Appendix F) and click "submit" if they agreed to participate. From there, participants were given specific directions to fill out demographic information and the three questionnaires. The link to the study materials was active for approximately one month during which data from 157 participants across socioeconomic status was collected for analysis. Of these initial responses, 88 complete protocols met criteria for participation and were included in the data analysis. Sampling and selection. Participants for the proposed study were 36-56 years of age (the current Gen X age range) and were parents of children under the age of 17 who had IEPs or 504 accommodations, or who were actively seeking such accommodations. In order to determine the number of participants needed for the proposed study, an a priori power analysis was conducted. The output from the analysis suggested that for a medium effect size (Cohen f 2 = 0.15) of a liner regression, using an alpha of 0.05 and a power of 0.80, the desired sample size was 55 participants. In order to address the possibility that data could be skewed towards the upper class with the use of surveys online only, I consulted a study on technology use by income groups conducted the Pew Research Center. According to research conducted by the Pew Research Center, in December 2012, 73% of adults who made under $30k annually had Internet access (Madden, 2013). Similarly, 90% of individuals who made $30k-$50k, 95% who made $50k -$75k and 99% who made over $75k had internet access (Madden, 2013). Additionally, while some differences remain in internet usage by socioeconomic status, class related gaps have closed dramatically in the last 15 years and the most pronounced growth has been in lower income households and those with lower levels of education (Perrin & Duggan, 2015). For example, for households who made less than $30k annually, use of the Internet had risen 40% between 2000 and 2015 (Perrin & Duggan, 2015). The Pew research studies indicated that the majority of adults, regardless of socioeconomic status had access to the Internet and that access continued to increase yearly. This high level of access suggested that using social media for data collection would likely not skew results based on socioeconomic status and privilege. Ethical recruiting procedures. Participants were recruited via social media, word of mouth and through a large academic listserve. Via these outlets, a survey link within a recruitment letter was shared, inviting individuals to participate in my study. Participants were given the option to ignore the post or to follow the link to the survey. In the recruitment letter, the source of the referral was shared, but emphasis was placed on the voluntary nature of participation. Participants were notified that if interested, they could provide their contact information in a separate email to be entered into a raffle to win a $50 Amazon gift card as a token of appreciation for participation. Potential participants were also provided with the contact information of the primary investigator should they have any further questions (see Appendix F). Informed consent. The informed consent page of the survey (see Appendix F) explained that by clicking "submit" at the bottom of the page, participants were providing their informed consent. The informed consent went to Antioch University New England Institutional Review Board (IRB) and was approved. The IRB included (a) research purposes; (b) procedures (demographic information, questions on stress, questions on parental self-efficacy); (c) potential benefits; (d) possible risks; (e) a statement on confidentiality; (f) voluntary participation; (g) procedures for withdrawing from the study at any time; and (h) the contact information for the investigator in case the participants had any further questions. An important feature of online research is the anonymity it affords. According to Joinson (2003), this type of research is similar to the "strangers on a train" phenomenon (as cited in Rodham & Gavin, 2006, p. 95), wherein individuals are more comfortable disclosing personal details to a stranger. Joinson (2003) goes on to state that the "cost of divulging information via the Internet (i.e., to a stranger) is significantly reduced" (as cited in Rodham & Gavin, 2006, p. 95). In addition, the Internet may give individuals an opportunity to express themselves at their convenience, and share more freely. Data collection. Data collection occurred through the use of an online data collection website, surveymonkey.com. Participants were directed to the first page that included informed consent, contact information, and a description of the study (see Appendix F). After obtaining written consent, participants were asked to move to the next page of the online survey and begin the study. Data included demographic data, socioeconomic scores and scores from the Perceived Stress Scale and Parenting Sense of Competence Scale. Data safeguards. In order to safeguard the data collected during the study, questionnaires were accessed through the website surveymonkey.com which required a password for log in. Since consent was given once each participant clicked "submit," no further identifying information was required. Once study data were exported into an excel spreadsheet, protocols were saved on a password protected computer. In addition, each participant was assigned a unique ID number to further insure anonymity. In the event that an individual was interested in the gift card raffle or was interested in the results of the study, they were prompted to contact the investigator separately, via email. A list of individuals interested in the raffle drawing was collected on a password protected word document and destroyed after the raffle had been drawn. The information collected for the study was used solely for the purposes stated. Data analysis. To answer the proposed research question— to what extent does socioeconomic status moderate the relationship between parental stress and parental self efficacy?—the following data analysis was used. Analysis of the data begin with quantifying socioeconomic information, using the Hollingshead (1975) Four Factor Index of Social Status. By consulting Baron and Kenny's (1986) article on moderator-mediator variable distinction in social psychological research, I determined that socioeconomic status was to be used as the moderator variable. Baron and Kenny state, "in general terms, a moderator is a qualitative (e.g., sex, race, class) or quantitative (e.g., level of reward) variable that affects the direction and/or strength of the relation between an independent or predictor variable and a dependent or criterion variable" (p. 1174). Baron and Kenny go on to explain how a given variable may "function as a mediator to the extent that it accounts for the relation between the predictor and the criterion. Mediators explain how external physical events take on internal psychological significance. Whereas moderator variables specify when certain effects will hold, mediators speak to how or why such effects occur" (p. 1176). In adherence to this moderator-mediator distinction, socioeconomic status was used to measure the direction and strength of the relationship between parental stress and parental self-efficacy. In the present study, parental stress was the predictor variable (independent), parental-self efficacy was the outcome variable (dependent), and socioeconomic status was the moderator variable. Data from the Perceived Stress Scale and the Parenting Sense of Competence Scale was organized using surveymonkey.com and exported into an excel spreadsheet. Using SPSS Statistics computer software for statistical analysis, I tested the following basic assumptions before running a linear regression: 1. Variables are normally distributed 2. There is an assumption of a liner relationship between the independent and dependent variables 3. Variables are measures without error and 4. There is assumption of homoscedasticity Once the assumptions were checked and met, a moderational regression was run to determine if socioeconomic status moderated the relationship between parental stress and parental self-efficacy. The data were analyzed using the output of the moderational regression analysis. Results This chapter presents findings from surveys completed by 88 Generation X parents who have a child under age 17 with a learning disability. Participants were asked a series of questions used to determine socioeconomic status (see Appendix A) and demographic questions such as age, race, and marital status to gather other descriptive statistics (see Appendix B). In addition, parents were asked specific questions about stress (see Appendix C) and parenting efficacy (see Appendix D). Analyses of the socioeconomic status, stress and parenting measures were used to address the following research questions: (a) What is the role that socioeconomic status plays in the relationship between parental stress and self-efficacy for parents of children with learning disabilities? and (b) How does socioeconomic status have a differential effect on self-efficacy in stressed parents of children with learning disabilities? Based on these research questions, the following hypotheses were proposed: Hypothesis 1: Parents with higher levels of SES and higher levels of stress will have higher levels of self-efficacy. Hypothesis 2: Parents with lower levels of SES and higher levels of stress will have lower levels of self-efficacy. Descriptive Statistics General demographic data were collected and are as follows: of the total number of individuals included in the sample, most respondents (91%) were mothers and significantly fewer (9%) were fathers [Table 1]. In terms of marital status, most (91%) were married or in a domestic partnership while only 8% reported that they were divorced or legally separated, 1% reported that they were single, and none reported that they were widowed [Table 2]. Participants were also asked about their approximate total family income. Of the total sample, the majority of participants (37%) reported earning over $125,0007. In contrast, 27% reported earning between $86,000 and $125,000, 19% reported earning between $61,000 and $80,000, 10% reported earning between $41,000 and $60,000, and 7% reported earning up to $40,000 [Table 3]. When asked an open ended question about race, 90% of participants identified as White or Caucasian, 7% identified as Other or chose not to answer, 1% identified as Hispanic, 1% identified as Native American, and 1% identified as French Canadian [Table 4]. In regards to child disability diagnoses, 35% of parents reported having a child with Dyslexia/Dyscalcula and or Dysgraphia,18% reported having a child with Attention Deficit Hyperactivity Disorder and Dyslexia/Dysgraphia and/or Dyscalcula, 17% with an unspecified learning disorder; 11% with Attention Deficit Hyperactivity Disorder, 7% with Attention Deficit Hyperactivity Disorder and another disability, 4% with an Auditory Processing Disorder, 4% with Other Health Impairment and with each of the following diagnoses, 1% of parents reported having a child with Executive Functioning Disorder, Speech Apraxia, Speech and Language Disorder or Expressive Receptive Language Disorder [Figure 1]. Table 1 Gender (n=88) _______________________________________________ Table 2 Marital Status (n=88) _____________________________________________________ Table 3 Total Approximate Family Income (n=88) ________________________________________________ Table 4 Race and Ethnicity (n=88) ________________________________________________ Figure 1 Disability Demographics (n=88) 1, 1% Dyslexia/Dyscalcula/Dysgraphia Disorder Hollingshead's Four Factor Analysis of Social Status (1975) was used to determine each participant's quantitative social status score. In order to calculate this score, participants were asked about their level of occupation [Tables 5 and 7] and education [Tables 6 and 8] (for a list of occupations see Appendix G). Answers to these questions were then converted into numeric scores using a Likert scale. If participants were married or in a domestic partnership, they were also asked this information about their spouse or partner. In order to calculate the total status score for each participant, the scale value for occupation was multiplied by a weight of five (5) and the scale value for education was multiplied by a weight of three (3). Determination of total status scores were as follows: 1. If the subject was single, the status score was based on the education and occupation of the individual. 2. If the subject was married, the status score was determined by summing the education and occupation scores of the two spouses/partners and dividing them by two. 3. If the subject was divorced but working, the score was determined by the subject's education and occupation 4. If the subject was divorced (or widowed) and receiving support payments (or estate payments), the status score was determined by the education and occupation on the supporting spouse. 5. If the subject was retired, the status score was determined by the education and occupation of the person before he or she retired. Once the total status score was determined for each participant, the information was exported into an excel spreadsheet and organized, in order, from highest status score to lowest status score. These scores ranged from 19.5 to 61, with the lower number representing a lower socioeconomic status. The mean Hollingshead score was 43.9 and the median score was 46.2 [Table 9]. Table 5 Occupation of Sample (n=88) ________________________________________________________________ Table 6 Education of Sample (n=88) ______________________________________________________________________________ Table 7 Occupation of Spouse (n=80) __________________________________________________________________ Table 8 Education of Spouse (n=80) _____________________________________________________________________________ Table 9 Total Descriptive Statistics of Hollingshead Four Factor Index (n=88) _______________________________________ Perceived stress scale. The 10 PSS items were scored on a 5 point Likert-scale ranging from 0 (never) to 4 (very often). Four items (4,5,7 and 8) were reverse coded. On the PSS, possible scores range from a minimum score of 0 to a maximum score of 40. Higher scores indicate a higher level of stress. Of the 88 parents who participated in the study, the range of scores was between 1 and 34 and the mean PSS score was 20.05 (SD= 5.99) [Table 10]. Parent sense of competence scale. The 17 PSOCS items were scored on a 6 point Likert-scale ranging from 1 (strongly agree) to 6 (strongly disagree). Nine items, 2, 3, 4, 5, 8, 9, 12 and 14 were reverse coded. The scores on this scale can range from 17 to 102 with the higher scores indicating a higher parenting sense of competency. Of the 88 parents who participated, the range of PSOCS scores were between 44 and 87 and the mean score was 67.29 (SD=10.67) [Table 10]. Table 10 Means and Standard Deviations of PSS and PSOC (n=88) _____________________________________________________________________________ Interscale correlations between stress, socioeconomic status, and self-efficacy. Before a moderated multiple regression was conducted to determine the interaction effect of stress, socioeconomic status and self-efficacy, a number of basic correlations were conducted. First, a Pearson correlation was run to determine the relationship between stress and self efficacy. For this correlation, the significance level was set at 0.01. The correlation indicated a significant, negative correlation between stress (PSS) and self-efficacy (PSOCS) (r= -.543, p< .000). This significant negative correlation indicated that the more stress a parent had, the less self-efficacy they reported [Figure 2]. Second, a Pearson correlation was run to determine the relationship between socioeconomic status (Hollingshead Four Factor Index) and self-efficacy (PSOCS). It was determined that there was no significant correlation at either a significance threshold 0.01 or 0.05, (r= .070, p=258), suggesting that socioeconomic status alone has no impact on parental self-efficacy [Figure 3]. Third, a Pearson correlation was conducted to determine the relationship between stress (PSS) and socioeconomic status (Hollingshead Four Factor Index). This relationship was determined to be significantly negatively correlated at the 0.05 level (r= -.217, p=.021). This negative correlation indicated that as respondents' socioeconomic status increased, their level of stress decreased. Table 11 Pearson Correlations Among the Hollingshead Four Factor Index of Social Status, Perceived Stress Scale and Parent Sense of Competence Scale __________________________________________________________________________ Note. N=88. SES= Hollingshead Four Factor Index of Social Status; PSS= Perceived Stress Scale; PSOCS= Parent Sense of Competence Scale. correlation is significant at p<.05. correlation is significant at p<.01 Moderated multiple regression analysis. After looking at the Pearson correlation matrix of the three measures to detect directionality and magnitude of correlations, one moderated multiple regression analysis was used to test if in fact socioeconomic status moderated the relationship between parental stress and parental self-efficacy. Of note, for the purpose of this study examining independent variables of different scales, B coefficients (or raw regression coefficients) were used. These coefficients were used instead of Beta coefficients, as there is no need to analyze the relative contribution of the independent variable. The following B coefficients represent the independent contributions of each independent variable to the prediction of the dependent variable. The multiple regression analysis showed that stress was a significant predictor of self-efficacy: Stress b= -.9908, t(82)= -6.26, p=.001. Socioeconomic status was not a predictor of self-efficacy: socioeconomic Status b= -.0523, t(82)=-.5775, p=.565. The interaction between socioeconomic status and stress was not significant: interaction b= .0010, t(82)= .0697, p=.9446. The model summary was also consulted to determine if the overall model was significant. At the 0.001 level, the regression analysis showed that stress, socioeconomic status and their interaction did not have any overall significant effect on selfefficacy, F (3, 82) =17.27 p=.001, R 2= .29. In regards to the conditional effect of stress on self-efficacy, the effect did not change at low, medium, or high levels of the moderator (socioeconomic status). Specifically, at low levels of socioeconomic status, the effect was -1.0007. At medium levels of socioeconomic status, the effect was -.9908 and at high levels of socioeconomic status, the effect was -.9809 [Table 12]. Table 12 Conditional Effects of Stress on Self-Efficacy ______________________________________________________________________________ Significant at the .01 level Summary. Results of the above analyses indicate that stress had a negative correlation with both socioeconomic status and self-efficacy. Thus, as socioeconomic status increases, stress decreases. Similarly, as stress increases, parental self-efficacy decreases. There was no significant correlation between socioeconomic status and parental self-efficacy. In addition, socioeconomic status does not moderate the relationship between stress and self-efficacy: stress is significantly correlated with self-efficacy at all levels of socioeconomic status. Discussion The purpose of this study was to determine the relationships among socioeconomic status, stress, and self-efficacy for Generation X parents who have a child with a learning disability. The primary goal of the study was to shed light on the impact socioeconomic status and stress can have on parents' belief in their ability to succeed in advocating for their children. A feeling of self-efficacy can significantly impact all elements of parenting, but may be particularly important for the advocacy that is often needed to get sufficient services and supports for children with learning challenges. In this section, I discuss a number of possible factors which influenced the results of this study including: parental wealth, Generation X cohort effect, and parental education. In addition, a number of limitations of the study were noted including: the assignment of an occupation score, homogeneity of the sample in regards to race and socioeconomic status, and specificity of the scales used. Results of this exploration highlight four noteworthy outcomes: 1. There is a significant negative correlation between stress and self-efficacy 2. There is a significant negative correlation between socioeconomic status and stress. 3. There is no correlation between socioeconomic status and self-efficacy. 4. Socioeconomic status does not moderate the relationship between stress and selfefficacy. Findings Self-efficacy is described as the self-evaluation of one's ability to successfully execute actions necessary to reach desired outcomes (Bandura 1986). If considering self-efficacy through the lens of the Transactional Model of Stress and Coping (Lazarus & Cohen, 1977), one might expect self-efficacy to be a mode by which individuals cope with stressful events successfully. Results of the present study suggest that there is in fact, a significant relationship between stress and self-efficacy; however, this relationship is negatively correlated. In other words, the more stressed the individual is, the less able they are to believe in their ability to manage and reach desired outcomes. In terms of this study, the present results indicate that the more stressed Generation X parents are, the less likely they feel they can successfully execute actions necessary to help their children with learning disabilities. Based on an extensive review of current literature, it appears that a number of studies and popular press focus on the significant stress Generation X parents are facing due to increased educational demands placed on children. Additionally, authors such as Clarida & Fandos (2013) have discussed the significant educational benefits conferred on children with involved parents. In particular, there is a strong positive association between parental engagement and academic performance (Hara & Burke, 1998). However, past research has not considered the erosive influence of stress on a parent's ability to become involved in child educational advocacy. Results of the present study suggest that it is important both educationally and clinically, to understand better obstacles that exist for parents to become active and involved in their children's education. Indeed, these data indicate that the more stressed Generation X parents are, the less self-efficacy they feel they have. It is quite possible that more affluent parents are highly stressed, albeit for reasons that may be different than for their less privileged peers. For example, the work of several researchers (e.g., Levine, 2016; Luthar, 2013) has suggested that affluent parents suffer from more stress and anxiety than previously believed; we know much more about the stressors attendant to poverty. Even so, I might have found a two-tailed correlation between stress and socioeconomic status. That is to say, stress could have been higher for Generation X parents on the extreme ends of the socioeconomic scale. In contrast, results from the current study indicated a negative correlation between stress and socioeconomic status in Generation X parents. These results suggest that the higher socioeconomic status Generation X parents have, the less stress they have. I did not explore wealth alone as a variable; I took into account socioeconomic status, which is made up of occupation and level of education. Unlike previous studies that noted a positive correlation between income and stress, results of the current study using a broader indictor of SES. I found that parents with higher levels of education and associated white collar occupations, have less stress. It is well known that educational status is a major predictor of health outcomes. According to Thoits (2010), individuals with lower levels of education are at a greater risk of exposure to stress and may be less likely to have buffers that reduce stress such as social support and high self-esteem. I suggest that similarly, educational status of Generation X parents is likely a predictor of parental stress as well. Based on the findings of the current study, it is argued that perhaps level of education has a greater impact on stress than money alone. Individuals with education benefit not only from the resources that schooling brings them and their families, but also from health related characteristics. Researchers Ross and Mirowsky (2008), used survey data from Illinois to address the question of whether community socioeconomic status impacts health more than individual socioeconomic status alone. They found that while individual SES explained most of the variation (about 60%), neighborhood SES had a significant impact as well. Clinically, it is vital to understand the impact that stress and socioeconomic status has on parents and their families. People with low socioeconomic status tend to live in communities that also have characteristics such as crime, unemployment, less funded schools and fewer resources in general. As a result, poor people may have more stress for both individual and community reasons. Interestingly, while the present study notes a relationship between stress and selfefficacy, and socioeconomic status and stress, there seems to be no correlation between selfefficacy and socioeconomic status. Considering Max Weber's (1968) collectivist theory may help to understand the present findings. Weber suggested that competition for power and prestige is particularly strong within classes. Perhaps it is not stronger self-efficacy that drives more affluent Gen Xers to fight so hard for their children but rather intense competition within the social class. A second possible explanation for a lack of relationship between socioeconomic status and self-efficacy of Gen X parents is related to cohort effect. Researcher Thomas (2010) found that Generation X parents were overly involved in the lives of their children because their own parents were either uninvolved or absent from their childhoods. Perhaps the motivation to advocate for their children did not come from a higher level of self-efficacy, but rather from an internal pressure or stress to be more involved in the lives and education of their children than their Baby Boomer parents were. Lower SES increases stress, but importantly, it does not appear to be particularly associated with a parent's sense of self-efficacy. Lastly, findings from the current study did not note any specific moderation of socioeconomic status in the relationship between stress and self-efficacy. These results are in contrast to my expectations based on the current literature and particularly interesting in light of the other findings of this study. While it has been determined that the more stress Generation X parents face, the less self-efficacy they have and the higher the socioeconomic status they have the less stress they have, there is no clear link between socio economic status and self-efficacy. It is hypothesized that education may be the buffer that Generation X parents have which increase their coping and decrease their stress. Perhaps, it is also education that moderates stress and self efficacy. The Hollingshead measure I used may not be sufficiently sensitive to tease out the elements of influence that comprise a definition of SES. Additional studies would need to be completed to address these unanswered questions. Strengths and Limitations Strengths. The current study involved the investigation of the relationship between stress and self–efficacy in Generation X parents. The measures used in this study have been shown to be valid and reliable tools. Though unpublished, the Hollingshead Four Factor Index of Social Status has amassed approximately 5,000 citations in the Web of Science database since 1994 (Adams, 2011). The Perceived Stress Scale is one of the most popular tools for measuring stress and has been shown to be a valid and reliable measure. The Parent Sense of Competence Scale was developed and tested by Gibaud-Wallston (1977) and is one of the most frequently used measures to assess parent's assessment of their parenting ability (Cooklin et al., 2012; Dunn et al. 2012). Since its creation, the PSOCS has correlated highly with other measures of parental attitudes such as the Maternal Attitude Scale (Cohler et al., 1970) and the Personal Feelings Scale (Wessman and Ricks, 1966). Additionally, the original proposed study suggested that an N=55 would allow for a valid and reliable sample size; however, with significant outreach, the total sample size for the current research study was N=88. The margin of error calculated with the sample size of 88 and a response rate of 56% was +/- 10.4%. This was a significant decrease in margin of error from the originally proposed +/-13.1%, based on the same 56% response rate and 95% confidence interval. I believe that conducting this research was useful in helping to fill in some of the gaps in current generational and educational research. Additionally, it confirmed many of my expected findings. However, I was surprised to learn that socioeconomic status did not moderate the relationship between stress and self-efficacy. While there are many areas of inquiry that could strengthen future comparable studies—including a more diverse sample—I would be interested in exploring answers to some of the questions that the findings of this study raised. For example, if decreasing stress can help increase self-efficacy, what else can help parents believe in their ability more? If parents feel more self-efficacious, it is also seems likely that they will cope with stress more effectively. Similarly, I was also very interested to learn that while higher levels of socioeconomic status are negatively correlated with stress, there is no relationship between socioeconomic status and self-efficacy. I believe replicating this study but using income as a moderator instead of socioeconomic status would be useful to help answer the question of whether or not money or education is a stronger moderator between stress and self-efficacy. Limitations. Though the Hollingshead Four Factor Index of Social status is considered by many to be the most widely used measure of social status, the measure categorizes occupations based on the United States Census from the 1970s. As a result, many current occupations such those in the Information Technology field are not categorized and must be approximated. In addition, as Adams (2011) points out, many occupations in Hollingshead's categorization have shifted. For example, Hollingshead categorized a stock/bond salesman in the same category as primary school teacher; today, the income and social regard of these two occupations has altered significantly. Since socioeconomic status is determined in part, by occupation, there is no way to adjust for this limitation while still using the Hollingshead Four Factor Index. For the purposes of this study, any occupation that was not noted in the Hollingshead job list was highlighted, a best-fit determination was made, and each individual with that particular occupation was coded with the same number. For example, a number of participants noted their occupation as "police officer" or "law enforcement." The Hollingshead job list did not include this occupation and so "military" was determined to be the best fit and each individual was given a score of 4. These scores were then double checked to assure consistency. Though measures were taken to ensure consistent scoring, determinations needed to be made which may have influenced the Hollingshead scores in ways he would not have originally intended. As a result, it is possible, for example, that the range of SES scores could have been larger or smaller based on the numeric value given to each occupation not noted on the original Hollingshead list. Recruiting participants for this study was particularly challenging. Even with aggressive recruitment both on social media and in person, I captured a relatively small sample size. Despite best efforts to advertise the study in predominantly black and Hispanic neighborhoods, of those who participated in the study, a very large majority identified as Caucasian or White. This significantly limited the race/ethnic diversity of the study. Although the goal of this study was to identify differences based on socioeconomic status and not race, the predominantly homogeneous race sample (89.77% Caucasian or White) must be noted as a limitation of this study. It is also important to consider the skew of the sample toward higher SES. While scores from the Hollingshead Four Factor index ranged from a low score of 19.5 to a high score of 61, the mean socioeconomic score was 43.9 and the mode score was 48. These numbers suggest that while on the surface the range of scores gave a good picture of socioeconomic status, the trend was generally towards individuals with higher socioeconomic status. As a result, the results of this study likely underrepresented Generation X parents with lower socioeconomic status. Although a review of the relevant literature supported the hypothesis that socioeconomic status might play an important role, the results of this research also indicated that socioeconomic status actually has no mediating effect on the relationship between stress and self-efficacy. For that reason, I looked to determine if any other patterns emerged associated with higher levels of stress (i.e., Do parents who had children diagnosed with a specific learning disability have more stress than others? or Do mothers have more parental stress than fathers?). Unfortunately, I did not note any patterns and so an area for future research might be better understanding why stress and self-efficacy are correlated for Gen X parents of children with learning disabilities. Another noteworthy limitation of the study has to do with the specific population studied. Although the individuals who participated in the study were Generation X parents with a child who has a learning disability, not enough information is available to determine whether or not the stress these parents reported is in greatest part the result of having a child with a learning disability. Of note, when analyzing the data, I sorted responses by stress level to determine if parents of children with one specific type of disability appeared to be more stressed than another but noted no clear pattern. For future studies, finding a way to more specifically understand the cause of parental stress, and its association with the extent of a child's disability, would be important. Perhaps adding a qualitative piece to this exploration would allow parents to discuss their own experiences with stress and self-efficacy as it particularly relates to their child's learning and behavioral challenges. Moreover, the scale used to determine self-efficacy focused more broadly on the stress inherent in being a parent. It did not explore the specific challenges of parenting a child with a learning disability. Therefore, it should be noted that the negative correlation between stress and self-efficacy doesn't precisely describe the stress related to having a child with a learning disability but rather addresses parental stress in general. Directions for Future Research Is parenting more stressful for Gen X parents than for the generations that preceded them? The current research opens this question to greater inquiry. According to demographers, some of the most noteworthy characteristics of Gen Xers have to do with their parenting style. Characteristics such as helicopter parenting are closely associated with their efforts at corrective experiences from their own lonely childhoods. While it is important for future research to better understand the specific etiology of Gen X parenting stress, clinicians should be aware of the high baseline level of stress of Gen Xers across the socioeconomic spectrum. It is inevitable that parental stress also has an effect on the emotional well-being children. For future studies, more aggressive recruitment should be conducted in minority communities. For example, attempting to make connections in the special education sector of New York City public schools know as District 75 may lead to capturing the voice of minority participants. Similarly, cultural differences may have played an outsized role in determining the sample of the current study. Although existing literature suggests that individuals across the SES spectrum have access to the internet, allowing them to complete an internet based study, it is possible that an online survey such as this may present both racial and cultural obstacles for diverse participants (i.e., word choice). Additionally, since the Hollingshead Four Factor Index relies heavily on level of education to determine socioeconomic status, I may have overlooked the salience of the relationship between education and willingness to participate in research. It's possible, for example, that other strategies, including face-to-face interviews or paper surveys might have yielded a more diverse sample. Future research might consider what type of research most participants would have been willing to complete to better diversify the sample. Concluding Remarks The topic of stress and self-efficacy in parents has implications for generations to come. Until we have more equitable distribution of special education resources, therapists and child advocates alike should work to support underserved and under-educated Generation X parents to gain knowledge about the special education system. For example, resources such as those offered by state run Parent Training Information Center (PTI) or Community Parent Resource Centers (CPRC) should be readily available and consistently utilized. These services exist in every state, are numerous, and are often free; yet, they are rarely discussed and as a result parents of children with disabilities consistently struggle to fight for services. These centers provide information via phone, email or website as well as conduct workshops, conferences and seminars for parents. They even provide information to teachers and other professionals who work with children with disabilities (PTIs and CPRCs; Resources for Parents, 2011). While schools offer varying levels of navigational help to parents, stress poses additional challenges for parents who may not feel competent to speak out for a child in the special educational system. Further, while the stressors of affluence merit exploration, more privileged children continue to have unfair access to educational resources; the greater need is to improve advocacy services for historically underserved and over stressed populations such as minority groups and the very poor; further argument for the continued funding of programs such PTI and CPRC. Additionally, for educators who interact with parents, it is important to recognize signs of stress and understand that parents who are particularly stressed may require additional support. For mental health practitioners working with parents, teaching stress management techniques will not only help decrease levels of parental stress but based on the results of this study, will likely help increase self-efficacy. While it is vital for those in power to advocate for the rights of children and families, what I have found to be the most salient part of this research is understanding the strong connection between stress and advocacy. Although it is well documented that the involvement of parents in their child's education is a vital piece of childhood success, it is not often in the forefront of parent teacher or parent clinician interactions. Parental advocacy is only successful with strong parent self-efficacy. Strong and successful parental advocacy is so important to childhood success that we must include discussions of self-efficacy and parental voice in all conversations about childhood academia. References Abrams, S. J. (2005). Unflagged SATs. Education Next. Retrieved from http://educationnext.org/unflaggedsats/ Adams, J. (2010). August b. hollingshead's four factor index of social status: From unpublished paper to citation classic. Yale Journal of Sociology, 8, 11-20. Allen, A. (2006, May 16). Flag on the field: Should colleges know when a student takes the SAT untimed? Slate. Retrieved from http://www.slate.com/articles/health_and_science/medical_examiner/2006/05/flag_on_ the_field.html Antonovsky, A. & Kats, R. (1967). "The Life Crisis History as a Tool in Epidemiologic Research". Journal of Health and Social Behavior, 8, 15-20. Bain, K. (2012). What the best college students do. United States of America: Library of Congress Cataloging. . Bandura, A. (1986). Social foundations of thought and action: A social cognitive theory Englewood Cliffs, NJ: Prentice-Hall. Baron, R. M., & Kenny, D. A. (1986). The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. Journal of Personality and Social Psychology, 51, 1173-1182. Barton, P. E., & Coley, R. J. (2007). The family: America's smallest school, policy information report. Princeton, NJ: ETS Policy Information Center. Blum, S. D. (2009). My word! Plagiarism and college culture. New York, NY: Cornell University Press. Burger, K., & Samuel, R. (2016). The role of perceived stress and self-efficacy in young people's life satisfaction: A longitudinal study. Journal Of Youth And Adolescence, doi:10.1007/s10964-016-0608-x Cirino, P. T., Chin, C. E., Sevcik, R. A., Wolf, M., Lovett, M., & Morris, R. D. (2002). Measuring socioeconomic status: Reliability and preliminary validity for different approaches. Assessment, 2, 145-155. Clarida, M. Q., & Fandos, N. P. (2013). Substantiating fears of grade inflation, dean says median grade at Harvard college is A-, most common grade is A. The Crimson. Retrieved from http://www.thecrimson.com/article/2013/12/3/grade-inflation-mode-a/ Codrington, J. & Fairchild, H. H. (2012). Special education and the mis-education of African American children: A call to action. The Association of Black Psychologists. Retrieved from http://www.abpsi.org/pdf/specialedpositionpaper021312.pdf Cohen, F. (1984). "Coping" In J.D. Matarazzo, S.M. Weiss, J.A. Herd, N.E. Miller & S.M. Weiss (eds.), Behavioral Health: A Handbook of Health Enhancement and Disease Prevention. New York: Wiley, 1984. Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24, 386-396. Cohen, S., & Williamson, G. (1988). Perceived stress in a probability sample of the United States. In S. Spacapam & S. Oskamp (Eds.), The social psychology of health. Newbury Park, CA: Sage. Cohler, B. J., Weiss, J. L., & Grunebaum, H. U. (1970). Child-care attitudes and emotional disturbance among mothers of young children. Genetic Psychology Monographs, 82(1), 3–47 Cole, S. R. (1999). Assessment of differential item functioning in the Perceived Stress Scale-10. Journal of Epidemiology and Community Health, 53(5), 319-320. Conger, R.D., K.J. Conger, G.H. Elder Jr., F.O. Lorenz & R.L. Simons (1994) Economic stress, coercive family process and developmental problems of adolescents, Child Development, 65: 541 – 61, 1994. Cooklin, A. R., Giallo, R., & Rose, N. (2012). Parental fatigue and parenting practices during early childhood: An Australian community survey. Child: Care, Health and Development, 38(5), 654–664. D'Amato, A. & Herzfeldt, R. (2008). Learning orientation, organizational commitment and talent retention across generations: A study of European managers. Journal of Managerial Psychology, 23, 929-953. DiMaggio, P. (1982, April). Cultural capital and school success: The impact of status culture participation on the grades of u.s. high school students. American Sociological Review, 47(2), 189-201. Duncan, G. J., & Murnane, R. J. (Eds.). (2011). Whither opportunity? New York: Russell Sage Foundation Press. Early, C. A. (2006). Harvard, to the highest bidder. The Harvard Crimson. Retrieved from http://www.thecrimson.com/article/2006/10/4/harvard-to-the-highest-bidder-how/ EdCentral.Org (n.d.). IDEA funding. Retrieved from http://www.edcentral.org/edcyclopedia/individuals-with-disabilitieseducation-act-funding-distribution/ Edmunds, J., & Turner, B. (2005). Global generations: Social change in the twentieth century. The British Journal of Sociology, 56, 559-577. Fierros, E. G., & Conroy, J. W. (2002). Double Jeopardy: An exploration of restrictiveness and race in special education. In D. J. Losen & G. Orfield (Eds.), Racial Inequality in Special Education, 39(40), 39-70. Cambridge, MA: Harvard Educational Press. Freedman, J. (2013, May 16). Why American colleges are becoming a force for inequality. The Atlantic. Retrieved from http://www.theatlantic.com/business/archive/2013/05/why- american-colleges-are-becoming-a-force-for-inequality/275923/ Gibaud-Wallston, J. & Wandersman, L.P., (1978, August). Development and utility of the parenting sense of competency scale. Paper presented at the meeting of the American Psychological Association, Toronto. Glanz, K., Rimer, B.K. & Lewis, F.M. (2002). Health Behavior and Health Education. Theory, Research and Practice. San Fransisco: Wiley & Sons. Golden, D. (2006). The price of admission: How America's ruling class buys its way into elite colleges- and who gets left outside the gates. New York, NY: Three Rivers Press. Gottfried, A. W. (1985). Measures of socioeconomic status in child development research: Data and recommendations. Merrill-Palmer Quarterly, 31(1), 85-92. Gross, J. (2002, September 26). Paying for a disability diagnosis to gain time on college boards. The New York Times. Retrieved from http://www.nytimes.com/2002/09/26/ education/26EXAM.html?pagewanted=2 0 Hallahan, D. P., & Kauffman, J. M. (1982). Exceptional children: Introduction to special education. Englewood Cliffs, NJ: Prentice Hall. Halstead, T. (1999, August). A politics for generation x. The Atlantic. Retrieved from http://www.theatlantic.com/magazine/archive/1999/08/a-politics-forgeneration-x/306666/ Hara, S. R., & Burke, D. J. (1998). Parent involvement: The key to improved student achievement. The School Community Journal,8, 9–19. Hill, N. E, & Craft, S. A. (2003). Parent-school involvement and school performance: Mediated pathways among socioeconomically comparable African American and Euro-American families. Journal of Educational Psychology, 96, 74–83. Hollingshead, A. B. (1975). Four factor index of social status. Department of Sociology, Yale University: New Haven, CT. Retrieved from http://psy6023.alliant.wikispaces.net/file/view/hollingshead+ses.pdf Hoorens, V. (1993). Self-enhancement and superiority biases in social comparison. In M. Hewstone & W. Stroebe (Eds.). European review of.social psychology (Vol. 4, pp. 113-140). Chiehester, England: Wiley. Hoorens, V. (1995). Self-favoring biases, self-presentation, and the self-other asymmetry. Journal of Personality, 63(4), 793-817. Hoorens. V., & Buunk. B. P. (1993). Social comparison of health risks: Locus of eon- trot, the person-positivity bias, and unrealistic optimism. Journal of Applied Social Psycholoy, 2, 291-302. Houtrow, A. J, Larson, K., Olson, L. M., Newacheck, P. W., & Halfon, N. (2014). Changing trends of childhood disability, 2001-2011. Pediatrics, 134(3), 530-538. Howe, N. (2010) Meet mr. and mrs. gen x: A new parent generation. American Association of School Administrators, 67(1), 18-23. Howe, N., & Strauss, W. (1993). 13th Gen: Abort, retry, ignore, fail?.New York, NY: Vintage Books Howe, N., & Strauss, W. (2000). Millennials rising: The next great generation. New York, NY: Vintage Books. Jacobson, L. I., Kellogg, R. W., Cauce, A. M., & Slavm, R. S. (1977). A multi- dimensional social desirability inventory. Bulletin of the Psychonomic Society, 9, 109-110. Johnson, W. (2012). Confessions of a "bad" teacher. The New York Times. Retreied from Johnston, C. & Mash, E.J. (1989). A measure of parenting satisfaction and efficacy. Journal of Clinical Child Psychology, 18(2), 167-175. Joinson AN. (2003). Understanding the psychology of internet behavior: Virtual worlds, real lives. New York, NY: Palgrave MacMillian Kilburn, D. (2015). Teaching twice: The hidden cost of America's education system. The Hill. Retrieved from http://thehill.com/blogs/congress-blog/education/232046-teaching-twicethe-hidden-cost-of-americas-education-system Kim, Y. (2009). Minority parental involvement and school barriers: Moving to focus away from deficiencies of parents. Educational Research Review, 4(2), 80-102. Koplewicz, H. S., Gurian, A., Williams, K. (2009). The era of affluence and its discontents. Journal of the American Academy of Child and Adolescent Psychiatry, 48(11), 1053-1055. Lack, D. (1947). The significance of clutch size. Ibis, 89, 302–352. Lazarus, R.S. & Cohen, J.B. (1977). "Environmental Stress". In I. Altman and J.F. Wohlwill (eds.), Human Behavior and Environment. (Vol 2) New York: Plenum. Lazarus, R. S., & Folkman, S. (1984). Stress, appraisal, and coping. New York: Springer. Levine, M. (2006). The price of privilege: How parental pressure and material advantage are creating a generation of disconnected and unhappy kids. New York, NY: Harper Collins Publishers. Levine, M. (2007). Challenging the culture of affluence. Independent School Magazine, Retrieved from http://www.nais.org/MagazinesNewsletters/ISMagazine/Pages/Challenging-the-Culture-of-Affluence-150274.aspx Lloyd, C. (2016). Grade grubbing: When parents cross the line. Retrieved from http://www.greatschools.org/students/4149-grade-grubbing-parents.gs Lupkin, S. (2012, July 19). Mom arrested for hacking school computers to change kids' grades. ABC News. Retrieved from http://abcnews.go.com/US/mom-charged-hackingschool-computers-change-childrens-grades/story?id=16812838#.UaiyPBh4K-U Luthar, S. S. (2003). The culture of affluence: Psychological costs of material wealth. Child Development, 74, 1581-1593. Luthar, S. S. (2013). The problem with rich kids. Psychology Today, 87, 62–69. Luthar, S. S., & D'Avanzo, K. (1999). Contextual factors in substance use: A study of suburban and inner-city adolescents. Development and Psychopathology, 11, 845-867. Luthar, S. S., & Latendresse, S. J. (2005). Children of the affluent: Challenges to well-being. Current Directions in Psychological Science, 14, 49-53. Luthar, S. S., & Sexton, C. (2005). The high price of affluence. In R. V. Kail (Ed.), Advances in Child Development, 32, 126-162. San Diego, CA: Academic Press. Madden, M. (2013, May 29). Technology use by different income groups. Pew Research Center. Retrieved from http://www.pewinternet.org/2013/05/29/ technology-use-by-different-income-groups/ Mann, J. (1992). Nurturance or negligence: Maternal psychology and behavioral preference among preterm twins. In J.H. Barkow, J. Cosmides, & J. Tooby (Eds.), The adapted mind: Evolutionary psychology and the evolution of culture (p. 367-390). New York: Oxford University Press Marcon, R. A. (1999). Positive relationships between parent school involvement and public school inner-city preschoolers' development and academic performance. School Psychology Review, 28, 395-412. Martin, C. A., & Tulgan, B. (2002). Managing the generational mix. Amherst, MA: HRD Press. . Miles, M. B. & Huberman, A. M. (1994). Qualitative data analysis: An expanded sourcebook Thousand Oaks, CA: Sage. Moraski, B. L. (2007). Report: Grade inflation persists. The Crimson. Retrieved from http://www.thecrimson.com/article/2007/5/9/report-grade-inflation-persists-over-half/ National Center for Education Statistics. (2015a, May). Child and youth with disabilities. Retrieved from http://nces.ed.gov/programs/coe/indicator_cgg.asp National Center for Education Statistics. (2015b, December). Comparative indicators of education in the United States and other G-20 countries: 2015. Retrieved from http://nces.ed.gov/pubs2016/2016100.pdf National Center for Learning Disabilities. (2014, November). The state of learning disabilities: Facts, trends and emerging issues. Retrieved from https://www.ncld.org/wp -content/uploads/2014/11/2014-State-of-LD.pdf New York State Archives. (2006). Federal education policy and the states, 1945-2009: A brief synopsis. States' Impact on Federal Education Policy Project. Retrieved from http://nysa32.nysed.gov/edpolicy/altformats/ed_background_overview_essay.pdf (2006, September 21). Poison ivy. Economist. Retrieved from http://www.economist.com/node/7945858 Organization for Economic Cooperation and Development (2012, September 11). Education at a glance: OECD indicators 2012. Retrieved from https://www.oecd.org/unitedstates/CN%20 -%20United%20States.pdf Palmer, B. (2005, February 23). Pressure for good grades often leads to high stress, cheating, professors say. Stanford Report. Retrieved from http://news.stanford.edu/ news/2005/february23/cheat-022305.html Perrin, A & Duggan, M. (2015, June 26). Americans' internet access: 2000-2015. Pew Research Center. Retrieved from http://www.pewinternet.org/2015/06/26/americansinternet-access-2000-2015/ Phillips, A. M. (2012). New york city charter school finds that a grade of "c" means closing. The New York Times. Retrieved from http://www.nytimes.com/2012/ 01/12/education/new-york-city-plans-to-close-a-charter-school-for-mediocrity.html PTIs and CPRCs: Resources for Parents. (2011). In parentcenterhub.org. Retrieved from http://www.parentcenterhub.org/wp-content/uploads/repo_items/bp3.pdf Rado, D. (2012, June 6). Special help starts as early as grade school-but only for select students. Chicago Tribune. Retrieved from http://articles.chicagotribune.com Reardon, S. F. (2011). The widening academic and achievement between the rich and the poor: New evidence and possible explanations. In R. J. Murnane & G. J. Duncan (Eds.), Whither opportunity? Rising inequity and the uncertain life chances of low-income children (p. 207-228). New York, NY: Russell Sage Foundation Press. Reissman, C. K. (2008). Narrative methods for the human sciences. Thousand Oaks, CA: Sage Publications. Research Tools. (n.d.). Retrieved from http://www.relevantinsights.com/research- tools#sthash.m2mLFkbw.dpbs Robson, C. (2011). Real world research: A resource for users of social research methods in applied settings (3 rd ed.). Chichester: Wiley. Rodham, K. & Gavin, J. (2006). The ethics of using the internet to collect qualitative research data. Research Ethics Review, 2(3) 92-97. Rojstaczer, S. (2002). Grade inflation at American colleges and universities. Retrieved from http://www.gradeinflation.com/figure1.png Ross, C. E. & Mirowsky, J. (2008). Neighborhood socioeconomic status and health: Context or composition? City Community, 7(2), 163-179. Roth, D. L., Snyder, C. R., & Paee, L. M. (1986). Dimensions of favorable selfpresentation. Journal of Personality and Social Psychology, 51, 867-874. Rothstein, R. (1999). Lessons; 'goals 2000' score: Failure 8, U.S. 0. New York Times. Retrieved from http://www.nytimes.com/1999/12/22/us/lessons-goals-2000-score-failure- 8-us-0.html Schugurensky, D. (Ed.). (n. d.). History of education: Selected movements of the 20th century. Retrieved from http://schugurensky.faculty.asu.edu/moments/1994goals2000.html Sessa, V. I., Kabacoff, R. I., Deal, J., & Brown, H. (2007). Generational differences in leader values and leadership behaviors. Psychologist-Manager Journal, 10, 47-74. Shepard, A. C. (2005, June 5). As for everyone! Washington Post. Retrieved from http://www.washingtonpost.com/wpdyn/content/article/2005/06/02/ AR2005060201593.html Shullman Research Center. (2014). Insights into luxury, affluence and wealth: Gen x'ers are the generation you can't afford to ignore. Shullman Luxury, Affluence and Wealth Pulse. Retrieved from http://www.shullman.net/wpcontent/uploads/downloads/2014/07/Shullman-Research-Center-July-2014-Insights- Brief-Gen-Xers-Are-the-Generation-You-Cannot-Afford-to-Ignore.pdf Siegel, P. M. (1971). Prestige in the American occupational structure. Unpublished doctoral dissertation, University of Chicago. Stevens, G., & Featherman, D. L. (1981). A revised socioeconomic index of occupational status. Social Science Research, 10, 364-395. Stossel, S. (2004, October). Crying in the kitchen over Princeton. The Atlantic. Retrieved from http:// www.theatlantic.com/magazine/ archive/2004/10/crying-in-the-kitchen-overprinceton/303527/ Tannock, R. (2014, January). DSM-5 changes in diagnostic criteria for specific learning disabilities (SLD): What are the implications? The International Dyslexia Association. Retrieved from http://dyslexiahelp.umich.edu/sites/default/files/IDA_DSM 5%20Changes.pdf Tapper, J., Morris, D., & Setrakian, L. (2006, March 30). Does loophole give rich kids more time on SAT? ABC News. Retrieved from http://abcnews.go.com/Nightline/loophole-give- rich-kids-time-sat/story?id=1787712 Taylor, P., & Gao, G. (2014, June 5). Generation x: America's neglected middle child. Pew Research Center. Retrieved from http://www.pewresearch.org/fact- tank/2014/06/05/generation-x-americas-neglected-middle-child/ Teitell, B. (2013, April 12). Parents get competitive in college. Boston Globe. Retrieved from http://www.bostonglobe.com/lifestyle/2013/04/12/getting-into-right-college-has-neverbeen-more-competitive-for-parents/5iBnaisoOf85qJKOdACE6L/story.html The Economist (2006). Poison Ivy. Retrieved from http://www.economist.com/node/7945858 The White House, Office of the Press Secretary. (2009, March 10). Remarks of the president to the United States hispanic chamber of commerce. Retrieved from https://www.whitehouse.gov/the-press-office/remarks-president-united-states-hispanic- chamber-commerce The White House, Office of the Press Secretary. (2013, August 22). Remarks by the present on college affordability. Retrieved from https://www.whitehouse.gov/the-press -office/2013/08/22/remarks-president-college-affordability-buffalo-ny Thielfoldt, D. & Scheef, D. (2004, August). Generation x and the millennials: What you need to know about mentoring the new generations. American Bar Association. Retrieved from http://apps.americanbar.org/lpm/lpt/articles/mgt08044.html Thoits, P. A. (2010). Stress and health: Major findings and policy implications. Journal of Health and Social Behavior, 51, S41– S53. Thomas, S. G. (2009). Today's tykes: Secure kids or rudest in history. Children's health on NBCnews.com. Retrieved from http://www.nbcnews.com/id/30585984/#.VvWg2OntJUQ Thomas, S. G. (2010). A teacher's guide to generation x parents: How to work with well- meaning but demanding moms and dads. Edutopia. Retrieved from http://www.edutopia.org/generation-x-parents-relationships-guide Trivers, R. L. (1974). Parent-offspring conflict. American Zoologist,14, 249-264. U.S. Census Bureau (2006-2010). American community survey. Retrieved from http://factfinder.census.gov/faces/tableservices/jsf/pages/productview.xhtml?src=bkmk U.S. Department of Education. (2015). Every student succeeds act (ESSA). Retrieved from http://www.ed.gov/essa?src=rn U.S. Office of Special Education Programs. (n. d.). History: Twenty-Five years of progress in educating children with disabilities through IDEA. Retrieved from http://www2.ed.gov/policy/speced/leg/idea/history.pdf Van Cleave, J., Gortmaker, S. L., & Perrin, J. M. (2010). Dynamics of obesity and chronic health conditions among children and youth. The Journal of American Medical Association, 3030(7), 623-630. Weber, M. (1968). Economy and society. Los Angeles, CA: University of California Press. Wessman, A., & Ricks, D. (1966). Mood and personality. New York: Holt, Rinheart, and Winston. Winnicott, D. W. (1960). The theory of the parent-infant relationship. International Journal of Psychoanalysis, 41, 585-595. Zemke, R., Raines, C., & Filipczak, B. (2000). Generations at work: Managing the class of veterans, boomers, x-ers, and nexters in your workplace. New York, NY: Amacon. Appendix A: Hollingshead Four Factor Index 1. What is your gender? _________ 2. What is your marital status (choose one) Single; Married/Domestic Partnership; Divorced or Legally Separated; Widowed 3. What is your job type? ___________ 4. What is the highest grade you've completed? A. Less than seventh grade B. Junior high school (9 th grade)C. Partial High school (10 th or 11 th grade) D. High school graduate E. Partial college (at least one year) or specialized training F. College graduate G. Graduate Degree (Masters, etc.) If you are married or in a domestic partnership, please complete the following questions about your spouse/partner: 1. What is your spouse/partner's job type: ____________________ 2. What is the highest grade your spouse/partner completed? A. Less than seventh grade B. Junior high school (9 th grade)C. Partial High school (10 th or 11 th grade) D. High school graduate E. Partial college (at least one year) or specialized training F. College graduate G. Graduate Degree (Masters, etc.) Appendix B: Demographic Questions Please answer the following questions about you: 1. Your age: ________ years 2. Your race: ______________ 3. Your Ethnicity: _____________ 4: What is your total family income per year? A. Up to $40,000 B. $40,000- $60,000 C. $60,000-$85,000 D. $85,000-$125,000 E. Over $125,000 Please answer the following questions about your child: 1. What is the age of your child diagnosed with (or for which you are actively seeking) a learning disability ( must be between 10 and 17 years of age): ____years 2. What is the gender of this child? ________________ 3. Who first noticed your child was struggling in school? _______________ 4. Does your child currently have a diagnosis or are you currently seeking out a learning disability diagnosis for your child? Yes No 5. If your child has already been diagnosed, what is your child's disability diagnosis? ___________ 6. At what age was your child formally diagnosed with this disability? _______________ 7. Who diagnosed your child with this disability (pediatrician, psychologist, school, etc.)? ___________________ 8. In your opinion, what is the overall rating you would give to describe the severity of the disability of your child? (please circle one number) 1 2 3 4 5 6 7 8 9 10 ---Mild----------------------------Moderate--------------------------Severe--- Would you like to be contacted about the results of this study when it is completed? ________YES ________NO(If yes, make sure to give your name and phone number at the top of the first page) Appendix C: Perceived Stress Scale (PSS) The questions in this scale ask you about your feelings and thoughts during the last month. In each case you will be asked to indicate your answer by circling how often you felt or thought a certain way. 0=Never 1=Almost Never 2=Sometimes 3=Fairly Often 4=Very Often 1. In the last month, how often have you been upsetbecause of something that happened unexpectedly? ........................... 0 1 2 3 4 2. In the last month, how often have you felt that you were unable to control the important things in your life? ................................................. 0 1 2 3 4 3. In the last month, how often have you felt nervous and “stressed”? ......... 0 1 2 3 4 4. In the last month, how often have you felt confident about your ability to handle your personal problems? ................................................ 0 1 2 3 4 5. In the last month, how often have you felt that things were going your way? ................................................................................... 0 1 2 3 4 6. In the last month, how often have you found that you could not cope with all the things that you had to do? ............................................ 0 1 2 3 4 7. In the last month, how often have you been able to control the irritations in your life? ............................................. 0 1 2 3 4 8. In the last month, how often have you felt that you were on top of things? 0 1 2 3 4 9. In the last month, how often have you been angered because of things that were outside of your control? ............................ 0 1 2 3 4 10. In the last month, how often have you felt difficulties were piling up so high that you could not overcome them? .................... 0 1 2 3 4 Cohen, S., Kamarck, T., & Mermelstein, R. (1983). A global measure of perceived stress. Journal of Health and Social Behavior, 24, 386-396. Cohen, S., & Williamson, G. Perceived stress in a probability sample of the United States. In Spacapan, S., & Oskamp, S. (Eds.). (1988). The social psychology of health, 31-67. Newbury Park, CA: Sage. Appendix D: Parenting Sense of Competence Scale Please rate the extent to which you agree or disagree with each of the following statements: Strongly Slightly Slightly Strongly Agree Agree Agree Disagree Disagree Disagree 1 2 3 4 5 6 ___1. The problems of taking care of a child are easy to solve once you know how your actions affect your child, an understanding I have acquired. ___2. Even though being a parent could be rewarding, I am frustrated now while my child is at his/her present age. ___3. I go to bed the same way I wake up in the morning, feeling I have not accomplished a whole lot. ___4. I do not know why it is, but sometimes when I’m supposed to be in control, I feel more like the one being manipulated. ___5. My mother was better prepared to be a good mother than I am. ___6. I would make a fine model for a new mother to follow in order to learn what she would need to know in order to be a good parent. ___7. Being a parent is manageable, and any problems are easily solved. ___8. A difficult problem in being a parent is not knowing whether you’re doing a good job or a bad one. ___9. Sometimes I feel like I'm not getting anything done. ___10. I meet my own personal expectations for expertise in caring for my child. ___11. If anyone can find the answer to what is troubling my child, I am the one. ___12. My talents and interests are in other areas, not in being a parent. ___13. Considering how long I've been a parent, I feel thoroughly familiar with this role. ___14. If being a parent of a child were only more interesting, I would be motivated to do a better job as a parent. ___15. I honestly believe I have all the skills necessary to be a good parent to my child. ___16. Being a parent makes me tense and anxious. ___17. Being a good parent is a reward in itself. Gibaud-Wallston, J. & Wandersman, L.P., (1978, August). Development and utility of the parenting sense of competency scale. Paper presented at the meeting of the American Psychological Association, Toronto Appendix E: Recruitment Letter To Whom It May Concern: I am currently recruiting participants to participate in a research project examining the experiences of Generation X parents who have children with learning disabilities or are in the process of finding out if their children have a learning disability. Antioch University New England's Human Research Committee has approved this research. In order to participate you must have been born between 1960 and 1980 and have a child between the ages of 10-17, who either has a learning disability diagnosis or is in the process of being diagnosed. In addition, you must have access to a computer with Internet and be able to complete an Internet survey for approximately 20 minutes. Your participation in this research is entirely voluntary and your personal information will be kept completely confidential. Although I will ask some personal background questions, your name and identifying information is not required. If you are interested, you will be able to enter into a raffle to win a $50 Amazon gift card as a token of appreciation for your participation in this study. Should you be interested in the raffle, you can provide your email address at the end, which will be kept separate from your survey and will remain confidential. If you are interested in participating and/or would like to learn more about this study, please visit the following link https://www.surveymonkey.com/r/parentstressstudy or contact Katherine Behar at [email protected] Sincerely, Katherine Behar, M.S. Appendix F: Informed Consent Project Title: Parent Stress Study Purpose: You are being asked to participate in a research study on stress and sense of ability among Generation X parents. This research will be looking at how stress and sense of ability is connected having a child diagnosed with a learning disability. To participate, you must have a child living in your home who has been diagnosed with a learning disability (or for which you are seeking out a learning disability) and be between the age of 10 and 17 years of age. In addition, you yourself must be born between 1960 and 1980. This study is being conducted through Antioch University. Study Procedures: You will be asked to complete the following survey. By clicking "Next" below, you will be giving your informed consent. If you agree to take part in this research study, you will be asked to complete some information about yourself. There will also be two sets of questions, which look at issues that often have to do with parenting. Some of the questionnaires may have subject matter of a sensitive nature. Please remember your answers will not be shared with anyone except the Principal Investigator. Your participation will be kept confidential. Your participation should take no more than 20 minutes of your time. You will then be able to provide your contact information for entry in a raffle for a $50 Amazon gift card. You do not have to provide your name or email address on any of the study materials so that you will remain entirely anonymous. If you do provide your email address for the raffle, it will be kept separate from your survey and will remain confidential. If you are interested in being entered into the raffle, please email me at [email protected] with the subject line "parent stress study raffle". Benefits and Risks: Participation in this study will provide you with a chance to think about your stress and ability as the parent of a child with a learning disability. In addition, you may provide understanding for researchers and therapists about parenting children with learning disabilities. Though every research study carries some risk, the risk involved in this study is considered to be minimal. You may experience slight emotional discomfort or distress by answering questions of a personal nature and thinking about your stress. Should you require any mental health treatment after the completion of this study, a list of local mental health professionals can be found on www.psychologytoday.com or by calling 1-800-662-HELP. Confidentiality: By using survey methods, I have ensured that you can answer the questions completely anonymously. Even if you choose to provide an email address for the raffle or follow-up, it will be kept separately from your responses and I do not require your name. Your email address will not be shared with anyone for any reason, should you choose to provide it. It will remain safely locked and protected, and will be destroyed after the raffle is held. Voluntary Participation/Withdrawal: Taking part in this study is voluntary. You have the right to withdraw from participation in this study at any time for any reason. Questions: If you have any questions about this study, you may contact me at the below email or phone number. In addition, you may contact my research advisor at her above contact information as well. If you have any questions about the research process or your rights as a participant, you may contact Dr. Kevin P. Lyness, Chair of the Antioch University New England Human Research Committee, (603)283-2149, or Dr. Melinda Treadwill, ANE Vice President for Academic Affairs (603) 283-2444. Would you like to be contacted about the results of this study or do you have any questions about what you just completed? Please email me at [email protected] with the subject line "parent stress study questions" Would you like to be entered into the $50 Target gift card raffle? Please email me at [email protected] with the subject line "parent stress study raffle" Principal Investigator (PI): Advisor: Martha Straus, Ph.D. [email protected] (603) 283-2187 Katherine Behar, M.S. [email protected] (xxx) xxx-xxxx Thank you for your participation, Katherine Behar Appendix G: Hollingshead Occupation List Appendix G: Continued Score 7-Smaller Business Owners, Farm Owners, Managers, Minor Professionals Actors Agricultural scientists Announcers, radio/television Appraisers, real estate Artists Buyers, wholesale/retail trade Computer programmers Credit persons Designers Entertainers, n.e.c. Funeral directors Health practitioners, n.e.c. Insurance adjusters, examiners, investigators Insurance agents, brokers, underwriters Managers, administration, n.e.c. Managers, residential building Managers, office, n.e.c. Officers, lodges, societies, unions Officers/pilots, pursers, shipping Operations/systems researchers/analysts Painters Postmasters, mail supervisors Public relations persons Publicity writers Purchasing agents, buyers, n.e.c. Real estate brokers/agents Reporters Sales managers, except retail trade Sales representatives, manufacturing industries Sculptors Social workers Stock/bond salesmen Surveyors Teachers, except college/university/secondary school Teachers, except college/university, n.e.c. Vocational/educational counsellors Writers, n.e.c. Score 6-Technicians, Semiprofessionals, Small Business Owners Administrators, except farm--allocated Advertising agents/salesmen Air traffic controllers Athletes/kindred workers Buyers, farm products Computer/peripheral equipment operators Conservationists Dental hygienists Dental laboratory technicians Department heads, retail trade Dietitians Draftsmen Embalmers Flight engineers Foremen, n.e.c. Foresters Home management advisors Inspectors, construction, public administration Inspectors, except construction, public administration Managers, except farm Opticians, lens grinders/polishers Payroll/timekeeping clerks Photographers Professional, technical, kindred workers--allocated Religious workers, n.e.c. Research workers, not special-ed. Sales managers, retail trade Sales representatives, wholesale trade Secretaries, legal Secretaries, medical Secretaries, n.e.c. Sheriffs/bailiffs Shippers, farm products Stenographers Teacher aides, except school monitors Technicians Therapists Tool programmers, numerical control Appendix G: Continued Score 5-Clerical and Sales Workers, Small Farm and Business Owners Auctioneers Bank tellers Billing clerks Bookkeepers Bookkeeping/billing machine operators Calculating machine operators Cashiers Clerical assistants, social welfare Clerical workers, miscellaneous Clerical/kindred workers--- Clerical supervisors, n.e.c. Clerks, statistical Collectors, bill-account Dental assistants Estimators, n.e.c. Health trainees Investigators, n.e.c. Key punch operators Library assistants/attendants Recreation workers Tabulating machine operators Telegraph operators Telephone operators Therapy assistants Typists Score 4-Smaller Business Owners, Skilled Manual Workers, Craftsmen, and Tenant Farmers Airline cabin attendants Automobile accessories installers Bakers Blacksmiths Boilermakers Bookbinders Brakemen, railroad Brickmasons/stonemasons Brickmason/stonemason apprentices Cabinetmakers Carpenters Carpenter apprentices Carpet installers Cement/concrete nishers Checkers/examiners/inspectors, manufacturing Clerks, shipping/receiving Compositors/typesetters Conductors, railroad Constables Counter clerks, except food Decorators/window dressers Demonstrators Detectives Dispatchers/starters, vehicles Drillers, earth Dry wall installers/lathers Duplicating machine operators, n.e.c. Electricians Electrician apprentices Electric power linemen/cablemen Electrotypers Engineers, locomotive Engineers, stationary Engravers, except photoengravers Enumerators Expediters Firemen, re protection Firemen, locomotive Floor layers Foremen, farm Forgemen/hammermen Furriers Glaziers Heat treaters/annealers/temperers Heaters, metal Housekeepers, except private household Inspectors, n.e.c. Inspectors/scalers/graders, log and lumber Interviewers Jewelers/watchmakers Job and diesetters, metal Lithographers Loom fixers Machinists Machinist apprentices Mail carriers, post office Mail handlers, except post office Managers, bar/restaurant/cafeteria Marshals, -law--enforcement Mechanics Meter readers Millers, grain/ our/feed Millwrights Molders, metal Molder apprentices Office machine operators, n.e.c. Patternmakers/model makers Photoengravers Plasterers Plasterer apprentices Plumbers/pipefitters Plumber/pipefitter apprentices Power station operators Postal clerks Practical nurses Piano/organ tuners/repairmen Pressmen, plate printers, printing trade Pressmen apprentices Projectionists, motion picture Printing trade apprentices, except pressmen Proof readers Radio operators Receptionists Repairmen Rollers, metal Sheet metal workers Sheet metal worker apprentices Stereotypers Stock clerks/storekeepers Stone cutters/carvers Structural metal workers Superintendents, building Switchmen, railroad Tailors Telephone linemen/splicers Telephone installers/repairmen Ticket/station/express agents Tile setters Tool and diemakers Tool and diemaker apprentices Weighers Welders/ flame cutters Appendix G: Continued Score 3 Machine Operators and Semiskilled Workers Animal caretakers Asbestos/insulation workers Assemblers Barbers Blasters/powdermen Boardinghouse/lodginghouse keepers Boatmen/canalmen Bottling operatives Bulldozer operators Bus drivers Canning operatives Carding, lapping, combing operatives Chauffeurs Child care workers, except private household Conductors/motormen, urban rail transit Cranemen/derrickmen/hoistmen Cutting operatives Deliverymen Dressmakers/seamstresses, except factory Drill press operatives Dyers Excavating/grading/road machine operators except bulldozer Farm services laborers, self-employed File clerks Filers/polishers/sanders/buffers Fishermen/oystermen Forklift /tow motor operatives Furnace men/smelters/pourers Furniture/wood finishers Graders/sorters/manufacturing Grinding machine operatives Guards/watchmen Hairdressers/cosmetologists Health aides, except nursing Housekeepers, private household Knitters/loopers/toppers Lathe/milling machine operatives Machine operatives, miscellaneous specified Machine Operatives, n.e.c. Meat cutters/butchers, except manufacturing Meat cutters, butchers, manufacturing Metal platers Midwives (lay) Milliners Mine operatives Mixing operatives Motormen, mine/factory/logging camp, etc. Nursing aides/attendants Oilers/greasers, except auto Operatives, miscellaneous Operatives, not specified Operatives, except transport ---allocated Orderlies Painters, construction/maintenance Painter apprentices Painters, manufactured articles Paperhangers Photographic process workers Precision machine operatives, n.e.c. Pressers/ironers, clothing Punch/stamping press operatives Riveters/fasteners Roofers/slaters Routemen Sailors/deckhands Sawyers Service workers, except private household Sewers/stitchers Shoemaking machine operatives Shoe repairmen Sign painters/letterers Spinners/twisters/winders Solders Stationary firemen Surveying, chainmen/rodmen/axmen Taxicab drivers Textile operatives, n.e.c. Transport equipment operatives---allocated Truck drivers Upholsterers Weavers Welfare service aides Enlisted members of the armed services (other than noncommissioned officers) Score 2 Unskilled Workers Bartenders Busboys Carpenter's helpers Child care workers, private household Construction laborers, except carpenters' helpers Cooks, private household Cooks, except private household Crossing guards/bridge tenders Elevator operators Food service, n.e.c., except private household Freight/materials handlers Garage workers/gas station attendants Garbage collectors Gardeners/groundskeepers, except farm Hucksters/peddlers Laborers, except farm---allocated Laborers, miscellaneous Laborers, not specified Laundry/dry cleaning operatives, n.e.c. Lumbermen/craftsmen/woodchoppers Meat wrappers, retail trade Messengers Office boys Packers/wrappers, n.e.c Parking attendants School monitors Waiters Warehousemen, n.e.c Score 1 Farm Laborers/Menial Service Workers Occupational Title Attendants, personal service, n.e.c. Attendants, recreation/amusement Baggage porters/bellhops Bootblacks Chambermaids, maids, except private household Cleaners/charwomen Dishwashers Farm laborers, wage workers Farm laborers/farm foremen/kindred workers---allocated Janitors/sextons Laundresses, private household Maids/servants, private household Newsboys Personal service apprentices Private household workers---allocated Produce graders/sorters, except factory/farm Stock handlers Teamsters Vehicle washers/equipment cleaners Ushers, recreation/amusement Appendix H: Parenting Sense of Competency Scale Permission Hello, I am requesting permission to use the parenting sense of competency scale by Charlotte Johnston and Eric Marsh for my dissertation. While I saw that Taylor& Francis offers the reuse of this scale for a dissertation, my dissertation will appear in the following places, so I wanted to make sure that would also be ok. a. Proquest Dissertations and Theses Database (Proquest is a Print on Demand Publisher) b. Ohiolink Electronic Theses and Disssertations Center (Ohiolink ETD Center is an open access archive) https://etd.ohiolink.edu/ http://www.proquest.com/products-services/pqdt.html c. AURA: Antioch University Repository and Archive (AURA is an open access archive) http://aura.antioch.edu/ D. Print I plan to use the scale in the exact form that I am attaching with this email Thanks in advance, Katherine Behar Dear Ms. Behar, I am sending our gratis permission for the use of our article figure in your dissertation. It is acceptable use for printing and posting to open access archives. Thank you. Mary Ann Muller – Permissions Coordinator, US Journals Division Appendix I: Parenting Sense of Competence Scale Permission Hi Dr. Johnston, My name is Katherine Behar and I am a doctoral student at Antioch University. I am writing to request permission to reuse the Parenting Sense of Competence Scale in my dissertation. My dissertation will appear in the following places: http://www.proquest.com/products-services/pqdt.html a. Proquest Dissertations and Theses Database (Proquest is a Print on Demand Publisher) b. Ohiolink Electronic Theses and Disssertations Center (Ohiolink ETD Center is an open access archive) https://etd.ohiolink.edu/ D. Print c. AURA: Antioch University Repository and Archive (AURA is an open access archive) http://aura.antioch.edu/ Attached please find a copy of the re-typed index, exactly as a plan to include it in my study. Please let me know if there are any changes necessary to the re-typed index or anything else that I should do to gain permission to use this measure. Thanks in advance, Katherine Behar Dear Katherine, Thank you for your interest in the Parenting Sense of Competence Scale. Our version of the scale is in the public domain, so you are free to copy and use it. The attached materials include two articles describing our work with the scale, a mother and father version of the measure along with scoring instructions, and a list of references to articles that have employed the measure. The original scale was developed by Gibaud-Wallston and Wandersman and presented at an APA conference in 1978. To the best of my knowledge, these authors have not continued work with the scale. Best of luck with your research. I'd appreciate if you could send me a copy of your results when they are available. Thank you, Charlotte Johnston, Ph.D. Appendix J: Permission to Reprint Hollingshead's Four Factor Index of Social Status Permission Hi Dr. Smith, My name is Katherine Behar and I am a doctoral student at Antioch University. I am writing to request permission to reuse Hollingshead's Four Factor Index of Social Status in my dissertation. My dissertation will appear in the following places: http://www.proquest.com/products-services/pqdt.html a. Proquest Dissertations and Theses Database (Proquest is a Print on Demand Publisher) b. Ohiolink Electronic Theses and Disssertations Center (Ohiolink ETD Center is an open access archive) https://etd.ohiolink.edu/ D. Print c. AURA: Antioch University Repository and Archive (AURA is an open access archive) http://aura.antioch.edu/ Attached please find a copy of the re-typed index, exactly as a plan to include it in my study. Please let me know if there are any changes necessary to the re-typed index or anything else that I should do to gain permission to use this measure. Thanks in advance, Katherine Behar Hello Katherine, Yes this is OK. We get quite a few requests to use this index. Our policy is to make it available free to any valid researcher. You can also adapt as you see fit. Good luck with your research and thank you for asking for permission. Philip Smith (Chair, Yale Sociology)	<urn:uuid:f42d9455-71cd-4359-972d-e04795baa57e>	CC-MAIN-2019-26	https://aura.antioch.edu/cgi/viewcontent.cgi?article=1352&context=etds	2019-06-27T01:00:00Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560628000609.90/warc/CC-MAIN-20190626234958-20190627020958-00286.warc.gz	341,930,524	35,481	eng_Latn	eng_Latn	0.952123	eng_Latn	0.997156	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "unknown", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "unknown", "unknown", "unknown", "eng_Latn", "eng_Latn", "unknown", "unknown", "unknown", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1040, 1521, 2209, 3658, 3677, 3693, 3710, 5716, 7835, 9995, 11937, 14079, 16012, 17942, 19779, 21878, 24781, 25967, 28105, 30775, 32921, 34049, 36069, 38844, 40683, 42119, 44132, 46371, 48081, 50120, 52110, 54026, 55972, 58033, 60824, 63022, 64042, 66132, 68449, 70177, 72002, 73913, 75912, 78035, 79984, 82050, 84196, 86234, 88312, 89968, 91885, 91957, 92043, 92141, 92226, 93118, 94200, 94303, 94419, 94524, 94639, 95678, 97284, 99025, 99548, 101123, 102990, 106287, 107587, 109589, 111112, 113155, 115237, 117264, 119367, 121210, 122672, 124297, 125824, 127501, 129013, 130610, 132324, 133943, 135548, 137163, 138793, 140409, 141297, 142329, 143883, 145984, 148024, 149583, 152599, 153870, 153912, 156082, 159118, 162780, 163930, 165674, 166999 ]
This memo serves as a quarterly update for Vermont’s action plan. (Grant# 1LICMS330824) The original plan was submitted on October 2, 2014. Plan Review Dates: \| \| Q1 (Jan-Mar) – Due Apr 15 \| Q2 (Apr-Jun) – Jul 15 \| \|-------\|---------------------------\|------------------------\| \| X \| Q3 (Jul-Sep) – Due Oct 15 \| Q4 (Oct-Dec) – Jan 15 \| Type of Plan: \| \| Proactive to Address Trend \| Did Not Meet Projections \| \|-------\|----------------------------\|--------------------------\| \| X \| Other: Admin CAP \| \| Administration CAP State of Vermont’s Money Follows the Person grant is currently working on a plan to reduce its administration CAP percentage. This CAP percentage is calculated using the formula below: \[ \text{Administration Expenses} \over (\text{Administration Expenses} + \text{Service Expenditures}) \] The current overall administration CAP percentage through September 30, 2015 is 31%. Since the start of CY14 this overall percentage has been reduced from 40% (a reduction of 23% overall). The average quarterly administration CAP has been reduced from 45% for the first two years of the grant to 21% for the past year. The chart below depicts the trends of both of these measurements. The chart below illustrates the cumulative administration CAP percentage for Vermont's MFP grant. Based on current projections, this overall value will be 24% by the end of CY19. There are three areas that the State of Vermont is currently working on to improve the administration CAP percentage: - Eliminate all conferences, marketing and community outreach events - Identify ways of increasing the usage of unused services of a participant’s care plan - Research the contributing factors to Vermont’s current de-enrollment rate (43%) Eliminate all conferences, marketing and community outreach events: All budgets have been modified to eliminate all of these types of events. In addition, we have been working on ways to reduce travel expenses by the use of state fleet vehicles instead of employee’s vehicles for grant travel. Identify ways of increasing the usage of unused services of a participant’s care plan: We are currently running data that compares actual services provided to a participant’s authorized care plan. Once completed, the MFP quality team will be working with the participant and the agencies providing the care to understand the barriers being faced in fulfilling all of the care plan hours. Some preliminary research has cited the following barriers that can be addressed: 1) lack of staff in remote areas; 2) client refusal of all allocated care hours; 3) Off-hour coverage not available; 4) Adult Day accessibility (transportation, capacity or convenience) etc. Research the contributing factors to Vermont’s current de-enrollment rate (43%): The chart below illustrates Vermont’s de-enrollment and re-institutionalization rates over the life of the grant. The overall de-enrollment rate (43%) although on an overall upward trend has been steadily decreasing for the past two quarters. The overall re-institutionalization rate is on an overall downward trend. The overall de-enrollment rate is illustrated in the table below: \| Status \| Count \| % of Total \| \|----------------------\|-------\|------------\| \| Deceased / De-enrolled \| 63 \| 43% \| \| Graduated \| 83 \| 57% \| \| Grand Total \| 146 \| \| The table below identifies the reasons for de-enrollment. We are performing a case study review of each participant to identify possible areas of improvement for the transition and community sustainability processes currently in use in Vermont. Research the contributing factors to Vermont’s current de-enrollment rate (43%) (cont): \| Reason \| Count \| % of Total \| \|---------------------------------------------\|-------\|------------\| \| Lost Qualified MFP Housing \| 3 \| 5% \| \| Lost Medicaid Coverage \| 3 \| 5% \| \| Lost Clinical Eligibility \| 6 \| 10% \| \| Voluntary Withdrawal \| 4 \| 6% \| \| Deceased \| 17 \| 27% \| \| Return to Nursing Facility \| 30 \| 48% \| \| Grand Total \| 63\| \| Note: Current re-institutional rate is 30 out of 146 participants or 21%. Once the initial review of each participant’s case file is complete, we are planning to use these findings to stimulate brainstorm sessions with the transition coordinators, case managers, home health agencies and discharge planning professionals. Our goal is to identify improvement projects that can be undertaken to help reduce Vermont’s overall de-enrollment rate going forward. Vermont’s 1115 Waiver plan (Choices for Care) has been actively working with nursing facility residents who want to receive their services in the community since 2006. During the period from 2005 until the MFP grant started in 2012, Vermont had reduced the average NH Medicaid population from 2,100 to about 1,750 residents per day. Since the inception of the MFP grant this number of residents has continually declined to approximately 1,600 residents per day. As a result of the success of the 1115 Waiver, the participants that we have been transitioning are more clinically complex. In addition, the culture in Vermont is very person centered and we believe that if a person wishes to receive their services in a community they should be given that opportunity. We do not restrict participation in the MFP grant based on the probability of success. Our participants are counseled in the challenges of such a transition and the associated risks. Additional Action Plan Details In addition to the Administration CAP Action Plan, there are items that Vermont is working on as a result of the CMS site visit on July 14 to 16, 2014. 1. Vermont has not submitted the required Service File programmatic report for any quarters since we started. We are working with our IT staff and HP (MMIS vendor) to develop a sustainable system to produce this report. 2. Improve the current system for all MFP programmatic requirements. The effort around this task is two-fold: a. All reports, except for the Semi-annual reports, have been audited and any discrepancies have been reconciled. We are in progress of completing the current Semi-Annual report as well as verifying previously submitted reports. We expect to have this effort completed by the December 31, 2015 deadline. The primary reason for the delinquency of these reports was a turnover of key report creation personnel during calendar year 2014. b. The state of Vermont is currently in the process of replacing its eligibility and MMIS systems. The replacement of these legacy systems is critical to optimizing and automating the current MFP reporting system. The MFP reporting team will be working with the IT development teams to ensure that MFP needs are being represented in the new systems. The initial implementation of these systems will start in late 2017. Authorizations: Director (Adult Services Division) Megan Tierney-Ward 11/3/15 Project Officer (Project Officer -CMCS) Jeffrey D. Clopein Acting Director (Division of Community Systems Transformation) Michael R. Smith	<urn:uuid:27508b23-94a9-4539-83f3-9ea1728962f9>	CC-MAIN-2017-39	http://asd.vermont.gov/sites/asd/files/documents/MFP%20Action%20Plan%20Oct2015.pdf	2017-09-22T20:37:14Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818689192.26/warc/CC-MAIN-20170922202048-20170922222048-00621.warc.gz	30,846,816	1,535	eng_Latn	eng_Latn	0.995337	eng_Latn	0.996338	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 1273, 2112, 3721, 5842, 7442 ]
ST JUDE THE APOSTLE FEAST OF ALL SAINTS 1 ST NOVEMBER Recently Deceased Robert Hanna Bethany Support Group Upcoming events Irish Hospice Foundation – Information Evening for the Public about Bereavement. Venue Alexander Hotel , Dublin 2 Date Thursday 5 th November from 5.30pm to 8pm Keynote Speaker Jane Mc Kenna (Founder of the Laurel Lynn Children's Hospice Foundation) For further information ph 087 1038431 Our November Mass for Deceased Parishioners will take place this Monday 2 nd November at 7.30pm Anniversaries Mary Agnes Barrins Rosanna Kershaw Catherine & James Kelly Dan O' Leary Danny Flood Deceased members of Lough & Brosnahan Families Eva Houston Kathleen Grimes Tomás Joyce Christina Kennedy Liam Walsh Andrew & Leo Morrin Michael Mallon Kathy Hawkins Weekly Mass Times This Week Daily Mass Monday to Friday at 9.30am Saturday at 10.00am Weekend Mass Times Vigil Sat 6.30pm Sunday Morning 10.00am & 11.30am Towards Peace is a new spiritual support service designed for those who have experienced sexual, physical, emotional or spiritual abuse by Catholic Church personnel in Ireland. Support is also available for family members of abuse survivors. The vision of Towards Peace is to provide a safe supportive space, where people who have been affected by abuse in a Church context can be accompanied as they seek their own experience of spiritual peace, one step at a time. Towards Peace provides spiritual support through one-to-one spiritual direction sessions, with a qualified spiritual companion. Up to nine sessions are offered and there is no cost. For more information, please visit www.towardspeace.ie, phone 01 505 3028 or email [email protected]. Please note there will be no Monday evening adoration this week due to our Annual Mass for Deceased Parishioners which takes place at 7.30pm The Miscarriage Association of Ireland Annual Service of Remembrance takes place on Sunday 8 th November at 3.00pm is St. Teresa's Church Donore Ave, off South Circular Road Tuesday 3-4pm Divine Mercy Holy Hour Medugorje Prayer group will hold their monthly meeting on Tuesday at 8pm in Parish Centre all are welcome The Missionary Sisters of St. Peter Claver Annual Sale of Work will be held on this Sunday 1 st November at St. Joseph's Parish Hall- Terenue from 10.00am to 3pm if you wish to donate goods ph 4909360 This Friday is the First Friday of the Month Mass on the day will be offered for all those who names are on our Parish Altar List of the Dead Adoration will take place on Friday from 10.00am to 4.30pm Poppy Bríd Sherman W.O.R.K. residents association will hold their AGM on Mon 2 nd November at 7.30pm in Faugh's Gaa Club 25 game of Cards every Thursday at 9pm in St Jude's GAA Club all welcome. Internet help for seniors available every Tuesday morning in St Jude's Gaa Club as part of the Mens Shed Group The Cosy Corner Café located in our Pastoral Centre is open Monday to Friday from 8am to 3pm for breakfast , lunch and tasty treats they are open each Sunday morning from 9.30am to 2.30pm for Breakfast and tasty treats why not drop in and savour some of their delicious homemade treats. 40 th Jubilee Celebration Events from now to December Tallaght Community School Reunion Class of 1985 A class reunion for past pupils of Tallaght Community School who sat their Inter Cert in 1983 or Leaving Cert in 1985 is being organised for November 20 th from 8.30pn in the Spawell Complex. Admission €10 to cover room and food. More information can be obtained on the TCS Reunion Class of 1985 Facebook page. Please spread the word. November Altar Lists of the Dead are now available in the Church Porch please take one home and return with the names of all deceased members of your family & friends who you would like remembered at our Mass on the First Friday of each month. We Welcome into our Christian Community the following children who were baptised here this month 10 th November local pilgrimage to the Shrine of St Jude in Whitefriar St Church for Mass & Novena to St Jude at 8pm. Buses will be available for €3 return if you wish to join our pilgrimage please book your space on bus in parish office by Friday 6 th November Lucy Kate O'Sullivan Max Alessandro Di Sabantonio Eimear Louise Keogh Parish Office open Mon to Fri 8.30am to 1pm & after all Masses on Sun Morning Email [email protected] Buses will leave from outside school at 7.15pm ------------------------------------------- 40 hours Adoration of the Blessed Sacrament will take place from 8.00am on Friday 20 th November to Midnight on Saturday 21 st Nov. 5 th December Jubilee Mass will take place at 6.30pm Chief Celebrant Archbishop Diarmuid Martin www.stjudesparish.net ph 4600127	<urn:uuid:debe6d09-b731-4f5a-9d29-52448545d958>	CC-MAIN-2021-31	http://stjudesparish.net/newsletters/1st_November_2015.pdf	2021-07-28T15:59:21+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-31/subset=warc/part-00247-a23f1677-939c-4b0d-b187-713170151123.c000.gz.parquet	41,597,762	1,133	eng_Latn	eng_Latn	0.990451	eng_Latn	0.990451	[ "eng_Latn" ]	false	rolmOCR	[ 4765 ]
A Two-Spot Sensor for Measurement of Dissipation by Means of Laser-Doppler Velocimetry* JOHN TROWBRIDGE Woods Hole Oceanographic Institution, Woods Hole, Massachusetts YOGI AGRAWAL Sequoia Scientific, Inc., Redmond, Washington (Manuscript received 2 January 2003, in final form 10 November 2003) ABSTRACT An estimate of the dissipation rate for mechanical energy in a turbulent flow can be obtained by computing the variance of the temporal derivative of the fluid velocity measured at a single point. This technique is not suited to conventional laser-Doppler velocimetry because of inherent lower bounds on noise in the velocity measurements, which biases the dissipation estimates. A two-spot technique, described by George and Lumley, overcomes this difficulty. In this technique, laser-Doppler measurements of velocity are obtained at two points, which are separated in the spanwise direction by a distance larger than the size of the optical scatterers but smaller than the Kolmogorov scale. The covariance of the temporal derivative of the velocities measured at the two points provides an unbiased estimate of the dissipation, because the velocities at the two points are essentially identical, while the two noise records are uncorrelated. An oceangoing sensor based on this technique has been developed, and its success is demonstrated by experiments in the near-boundary region of a laboratory channel flow, where measurements of shear production provide a standard for evaluation of the dissipation estimates. 1. Introduction An estimate of the dissipation rate for mechanical energy in a turbulent flow can be obtained from a point measurement of velocity by using \[ \epsilon = 15\nu \left( \frac{\partial u_1}{\partial x_1} \right)^2, \] provided that the dissipative motions are isotropic (Taylor 1935) and the frozen-turbulence hypothesis is valid (Taylor 1938; Lumley 1965), so that $ \partial u_1 / \partial x_1 $ can be approximated by $-U_1^{-1} \partial u_1 / \partial t$. Here, $ \epsilon $ is the dissipation rate, $ \nu $ is the kinematic viscosity, $ t $ is time, $ \mathbf{x} = (x_1, x_2, x_3) $ is the position vector (with $ x_1 $ in the streamwise direction), $ \mathbf{U} = (U_1, 0, 0) $ is the mean velocity, $ \mathbf{u} = (u_1, u_2, u_3) $ is the fluctuating velocity, and an overbar denotes a mean value. Use of (1) to obtain estimates of dissipation from velocity measurements requires that the scale of the measurement volume be smaller than the Kolmogorov scale $ \eta = (\nu^3 / \epsilon)^{1/4} $, and that the sample rate be larger than approximately $ U_1 / \eta $ (George and Lumley 1973). In the ocean, (1) has been used to estimate dissipation from measurements of velocity obtained from heated films (e.g., Grant et al. 1962), which sense variations in the rate of heat transfer to determine velocity fluctuations, and from shear probes (e.g., Osborn 1974; Oakey 1982; Oakey and Elliot 1982), which sense flow-induced deflections of a small beam to determine velocity fluctuations. These techniques require calibrations of the relationship between the fluid velocity fluctuations and the quantity that is actually measured. Oceanic estimates of dissipation based on (1) have also been obtained from acoustic travel time and acoustic Doppler measurements of fluid velocity (e.g., Shaw et al. 2001; Trowbridge and Elgar 2001) by means of inertial-range spectra; in addition, dissipation estimates have been obtained from range-gated pulse-to-pulse coherent Doppler sonar measurements (Veron and Melville 1999), which produce wavenumber spectra directly and do not require use of the frozen-turbulence hypothesis. These acoustic measurements often have sample volumes and sample rates insufficient to resolve the dissipative fluid motions, so that the resulting estimates of dissipation are indirect and dependent on a semiempirical model. * Woods Hole Oceanographic Institution Contribution Number 10844. Corresponding author address: Dr. John Trowbridge, Applied Ocean Physics and Engineering, Woods Hole Oceanographic Institution, 98 Water Street, MS 12, Woods Hole, MA 02543. E-mail: [email protected] Oceanic measurements of dissipation have recently been obtained by means of particle-image velocimetry (PIV) (Doron et al. 2001), which requires no empirical calibration, resolves the dissipative scales under many conditions, and is capable of producing wavenumber spectra directly, without use of the frozen-turbulence hypothesis. However, PIV systems often require substantial hardware near the measurement region, which can produce flow disturbances in some applications. Laser-Doppler velocimetry (LDV) appears to offer an attractive alternative to other methods of measuring dissipation in the ocean, because its small sample volume and rapid sample rate can, in principle, resolve the dissipative scales under many conditions, and because use of backscatter sensors and fiber-optic cables often permits minimization of flow disturbances. However, theoretical work and laboratory measurements (George and Lumley 1973) have shown that noise that is dependent on the positions and motions of the light-scattering particles produces unacceptably large biases in dissipation estimates produced by conventional laser-Doppler velocimetry. George and Lumley (1973) also described a solution to the noise problem: two laser-Doppler velocimeters, with sample volumes separated by a distance smaller than the Kolmogorov scale, measure essentially the same velocity but have uncorrelated noise. Thus, the covariance of the two records of $\partial u_i / \partial x_j$ produces an unbiased estimate of the dissipation. Clark (1970) reported an early laboratory implementation of this technique, and van Maanen et al. (1976) described a related technique in which two laser-Doppler measurements of velocity are obtained in the same sample volume. Here we report a modern oceangoing version of a “two spot” laser dissipation sensor, based on the concept described by George and Lumley (1973). The sensor was tested in a laboratory channel, where estimates of shear production provide a standard for evaluation of the dissipation measurements. In addition, computations of a structure function $D_{11}(r_1)$, defined by $$D_{11}(r_1) = \left[ u_1(x + e_1 r_1) - u_1(x) \right]^2,$$ (e.g., Batchelor 1967) provide information about the ability of the sensor to resolve spatial scales. Here $r = (r_1, r_2, r_3)$ is the separation, and $e_1$, $e_2$, and $e_3$ are unit vectors in the $x_1$, $x_2$, and $x_3$ directions, respectively. In the following, the sensor, the laboratory measurements, and the analysis are described (section 2). Results are then presented and discussed (sections 3 and 4) and conclusions are summarized (section 5). 2. Methods a. Laser dissipation sensor The laser dissipation sensor (LDS) is a fiber-optic backscatter instrument that “looks” downward, in the $x_3$ direction, to provide independent measurements of the $x_1$ component of the velocity in two sample volumes, which are separated in the $x_2$ direction (Fig. 1). The system employs two separate diode lasers, both operating at 780 nm, each emitting approximately 150 mW of optical power. The beam from each laser is split and steered to form a parallel pair, so that the two lasers produce two parallel pairs of beams. One beam from each pair passes through a Bragg cell, which shifts its optical frequency by an amount equal to the Bragg cell drive frequency—a technique used to determine the direction of velocity. One Bragg cell operates at 38 MHz and the other operates at 43 MHz. The use of these two distinct frequency bands, each with a 1-MHz bandwidth, eliminates cross talk between the two velocity meameasurements. The beam pairs pass through a focusing lens to form the two spots (intersection regions of each pair) where the velocity is measured. The scattered light is received through the same lens, and two spots are imaged onto the tips of two multimode optical fibers, both placed at the back focal length of the receiving lens. The fibers carry the Doppler-shifted light signals to avalanche photodiode detectors (APDs). The photocurrent from the two APDs is mixed between 38.256 and 43.256 MHz and then filtered through 1-MHz bandwidth filters, thus, placing a zero Doppler shift at a 256-kHz offset frequency. Each of these signals is then sent to a separate fast Fourier transform (FFT) signal processor. The photodiode detectors are sampled at twice the maximum frequency on the FFT. Each burst is 512 points long. A peak-detecting algorithm is used to determine the frequencies of the optical signals. The peak Fourier amplitude must satisfy two criteria—it must exceed a minimum threshold, and also it must be a minimum factor (25) times the mean spectral level. These two criteria ensure that noise is not identified as velocity. Each of the FFT processors provides an 8-bit measure of velocity. The centers of the two sample volumes are separated in the $x_2$ direction by 200 $\mu$m. The sample volumes are ellipsoids with nominal dimensions of 100 $\mu$m in the $x_1-x_2$ plane and 500 $\mu$m in the $x_3$ direction. Tiny wedge prism pairs are used to form two spots at the required cross-stream spacing. A wedge prism deflects a beam by a small angle, equal to the incident angle times the excess refractive index of its material ($n - 1$). Two such prisms, placed together, can be used to add or subtract this deflection. Holding one prism fixed and rotating the other traces a circle. The diameter of the circle can be adjusted by rotating the first prism. In short, the wedge prism pair permits a change in direction of a laser beam by any angle between zero and twice the maximum deflection through one prism. In the optics employed for two spots, one pair of laser beams forms the first spot. Each beam of the second pair passes through the wedge prism pair. By adjusting the prism pair, each of the beams is deflected through a small angle [equal to $(200 \mu m)/f$, where $f$ is the lens focal length] with respect to the original pair, so that the beams emerging after entering the focusing lens meet at 200 $\mu$m from the pair forming the first spot. The imaging of the two spots on two optical fiber tips involves the use of a special fiber holder. This holder positions the tips precisely 200 $\mu$m apart. The receiving lens focal length equals that of the transmit lens so that the image of the two spots at the fiber tips has also a 200-$\mu$m separation. Alignment involves matching the fiber tip locations to the image locations of the two spots. Each of the receiving fiber is back lit (with a laser). After passing through the receive and transmit lenses, light emerging from the fiber tip (in the image plane) focuses at the desired measurement spot. Thus, the location of the measurement spots are defined by these back-lit fiber tips. Now, transmit optics are adjusted to force the beam-pair crossing at this location. The same procedure is repeated with the second fiber. It is important to note that the equal focal lengths of the two lenses ensures a one-to-one magnification of the object spots and image fiber tips. This design feature ensures that a given separation of the fiber tips results in an identical separation of the two spots. If a different magnification is employed, the corresponding change in spot separation can be achieved. To reduce the path of the laser beams in turbid water, so that signal attenuation is minimized, and to reduce flow disturbance from the sensor housing, a tapered, water-filled “snout” is fixed to the instrument housing, and the optical beams pass through the snout before entering the water. The snout is a hollow frustum of a cone (a cone whose apex is sliced off parallel to its base), with a length of 0.100 m, a diameter of 0.075 m at its wide (upward) end, and a diameter of 0.006 m at its narrow (downward) end. After the large end is slipped on to the instrument housing (which has a flat glass pressure window), the snout is filled with clean water. A thin 6-mm-diameter paralleled glass window then closes the snout at the small end. The beams emerge from this snout without suffering misalignment because the small window itself has parallel surfaces. The sensing volume is 0.030 m below the narrow end of the snout. b. Laboratory measurements Tests of the LDS were conducted in the 17-m flume (Butman and Chapman 1989) in the Coastal Research Laboratory at the Woods Hole Oceanographic Institution. The 17-m flume is a recirculating system and has a straight test section with a smooth floor, glass walls, a length of 17 m, a breadth of 0.60 m, and a depth of 0.30 m. The flow is driven by a variable-speed pump. The velocity profile is homogenized at the upstream end of the test section by a baffle. An adjustable weir downstream of the test section constrains the relationship between water depth and discharge. Hydraulic jacks beneath the test section permit adjustment of the channel slope. Previous measurements (Trowbridge et al. 1989; Fries and Trowbridge 2003) have shown that the mean velocity and Reynolds stress in the 17-m flume at positions more than 10 m from the channel entrance and within 0.1 m of the channel centerline are consistent with established semiempirical results for steady uniform channel flow (Nezu and Rodi 1986), provided that the water depth is less than one-fourth of the channel breadth. Measurements were obtained 12.8 m downstream of the entrance to the test section. The channel floor was horizontal. The depth-averaged along-channel velocity was nominally 0.2 m s$^{-1}$. The water depth at the measurement station was measured with a meter stick. The temperature and salinity of the water in the flume were measured with a platinum resistance thermometer and a conductivity sensor, respectively. To provide optical scatterers, the flume was seeded with hollow glass spheres (manufactured by SonTek, Inc.) with a diameter and specific gravity of approximately 13.5 μm and 1.4, respectively. The particle concentration by volume was approximately $10^{-4}$. The LDS was aligned with $x_1$, $x_2$, and $x_3$ in the along-channel, cross-channel, and vertical directions, respectively, so that the LDS sample volumes measured the along-channel velocity and were separated in the cross-channel direction. LDS measurements were obtained at $x_3 = 0.01$, 0.02, 0.03, 0.04, 0.06, and 0.08 m, where $x_3 = 0$ at the bottom. The sample rate was 500 Hz and the record lengths were 450 s, so that the number of samples at each height from each LDS spot was 225 000. To test for flow disturbance by the LDS snout velocity measurements were obtained with a conventional LDV. The LDV is a fiber-optic backscatter system, manufactured by Dantec Measurement Technology, which is mounted outside the flume and focused through the flume’s glass walls, so that it measures the along-channel velocity nonintrusively. The LDV sample volume is ellipsoidal with nominal dimensions of 4000 μm in the cross-channel direction and 200 μm in the along-channel and vertical directions. LDV measurements were obtained in the LDS measurement positions in two modes: one with the LDS absent (to determine the undisturbed flow) and one with LDS present but not operating (to determine the flow as influenced by the LDS). The measurements indicate that the mean along-channel velocity without and with the LDS in place differed by less than 3% (except at the lowest measurement position, where the difference was 6%), and that differences between disturbed and undisturbed inertial-range spectra were negligible. c. Analysis In preliminary analysis, velocities less than 0.08 m s$^{-1}$ or greater than 0.30 m s$^{-1}$ were identified and replaced by not-a-number (NaN), and velocities in each sample volume at each height which were more than 4 times the local standard deviation from the local mean were also identified and replaced by NaN. Only the valid measurements were used in the calculations of $U_1$, $\epsilon$, and $D_{11}$. Three estimates of dissipation based on (1) were obtained from the valid LDS measurements at each measurement height. The first estimate was obtained by computing $15\nu$ times the variance of $\partial u_1/\partial x_1$ from record A, the second was obtained by computing $15\nu$ times the variance of $\partial u_1/\partial x_1$ from record B, and the third was obtained by computing $15\nu$ times the covariance of $\partial u_1/\partial x_1$ from records A and B. Here, $\partial/\partial x_1$ was estimated according to the frozen-turbulence approximation as $-(1/U_1)\partial/\partial t$, temporal derivatives were computed by differencing the velocity records, and A and B refer to the two sample volumes of the LDS. Estimates of the shear production, defined by $-\overline{u_1u_3}\partial U_1/\partial x_3$, were used as a standard for evaluation of the dissipation estimates, because the shear production and dissipation are approximately equal in steady uniform channel flow if $x_3u_\ast/\nu > 30$ and $x_3/h < 0.4$ (Nezu and Nakagawa 1993), where $u_\ast$ is the friction velocity and $x_3 = 0$ at the channel floor. In steady uniform channel flow for $x_3 > 30\nu/u_\ast$, the Reynolds stress $-\overline{u_1u_3}$ is given by $$-\overline{u_1u_3} = u_\ast^2\left(1 - \frac{x_3}{h}\right),$$ where $h$ is the water depth, and a semiempirical expression for the mean velocity is $$U_1 = \frac{u_\ast}{\kappa}\ln(x_3) + \text{constant} + \frac{2\Pi}{\kappa}u_\ast\sin^2\left(\frac{\pi x_3}{2h}\right),$$ (Nezu and Rodi 1986), where $\kappa$ is the empirical von Kármán constant ($\kappa \approx 0.40$) and $\Pi$ is the empirical Coles parameter ($\Pi \approx 0.2$ if $hu_\ast/\nu > 1000$). The corresponding expression for the shear production is $$-\overline{u_1u_3}\frac{\partial U_1}{\partial x_3} = \frac{u_\ast^3}{\kappa x_3}\left(1 - \frac{x_3}{h}\right)\left[1 + \Pi\frac{\pi x_3}{h}\sin\left(\frac{\pi x_3}{h}\right)\right].$$ An estimate of $u_\ast$ was obtained by fitting measurements of $U_1$ to (4), and (5) was used to determine the shear production. Estimates of $D_{11}(r_1)$ were computed for a range of $r_1$ at each measurement height. A structure function was used instead of the corresponding spectrum function because drop out complicated frequency-domain computations of spectra. The estimates of structure function were obtained by computing the covariance of $u_1(x + \mathbf{e}_1r_1) - u_1(x)$ from records A and B. Here $u_1(x + \mathbf{e}_1r_1)$ was calculated according to the frozen-turbulence approximation ($r_1 = -U_1\tau$, where $\tau$ is the temporal lag), and A and B refer to the two sample volumes of the LDS, as before. These two-spot estimates of $D_{11}(r_1)$ capitalize on the same noise cancellation concept as the two-spot estimates of dissipation. The presentation of $D_{11}(r_1)$ (section 3) is normalized according to Kolmogorov scaling, in which the statistical properties of the turbulence depend only on $\epsilon$ and $\nu$ (e.g., Tennekes and Lumley 1972). In this normalized presentation of $D_{11}$, $\epsilon$ is estimated from (5), based on the assumption that shear production equals dissipation. The estimates of $D_{11}(r_1)$ are compared with three models. The first, a dissipation-range model valid for $r_1 \leq O(\eta)$, follows from (1) and (2) and is $$D_{11}(r_1) = \frac{\epsilon r_1^2}{15\nu} + O(r_1^4).$$ The second and third models (see appendix A for details) are based on the semiempirical isotropic representations of turbulence spectra proposed by Pao (1965) and Nasmyth (see Oakey 1982). Both the Pao model Fig. 2. Comparison of shear production with dissipation estimates obtained from the LDS. As explained in the text, records A and B are the two velocity records obtained from the individual LDS sample volumes. One-spot estimates of dissipation, obtained from (1) with a velocity record from a single sample volume, are between one and three orders of magnitude larger than the shear production, because of the large bias produced by noise. The two-spot estimates are consistent with the shear production, as expected, because of noise cancellation. and the Nasmyth model follow Kolmogorov scaling, and both models vary between the dissipation-range expression (6) at small $r_1/\eta$ and the inertial-range expression $$D_{11}(r_1) = \frac{54}{55} \cos\left(\frac{\pi}{3}\right) \Gamma\left(\frac{1}{3}\right) \alpha \epsilon^{2/3} r_1^{2/3},$$ (7) at large $r_1/\eta$. Here $\Gamma$ is the gamma function (e.g., Abramowitz and Stegun 1970). The isotropic Pao and Nasmyth models are expected to be valid only for $r_1 \ll x_3$. 3. Results The water depth at the measurement position was 0.138 m. The kinematic viscosity, estimated as a function of the measured temperature and salinity from an empirical relationship (Siedler and Peters 1986), was $1.10 \times 10^{-6}$ m$^2$ s$^{-1}$. The overall fractions of valid measurements (measurements identified as valid by the LDS internal processing and surviving the preliminary analysis procedure) were 0.52 and 0.35 for the two LDS sample volumes. The estimate of friction velocity obtained by fitting measurements of $U_1$ to (4) was 0.0103 ± 0.0008 m s$^{-1}$ at 95% confidence. Computations of shear production and dissipation (Fig. 2) indicate that conventional “one spot” estimates of $\epsilon$, obtained from (1) with velocity records from each of the individual LDS sample volumes, are between one and three orders of magnitude larger than the shear production. In contrast, the two-spot estimates of dissipation, obtained from (1) with velocity records from both of the LDS sample volumes, agree well with the shear production. The one-spot estimates of dissipation, presumably dominated by noise, decrease slightly with increasing height above the bottom. Plots of the structure function in the form $D_{11}(r_1)/r_1$ versus $r_1$ emphasize the contrast between the dissipation-range behavior (6), in which $D_{11}/r_1 \propto r_1$, and the inertial-range behavior (7), in which $D_{11}/r_1 \propto r_1^{-1/3}$. Plots of the structure functions at all measurement heights in this form (Fig. 3), normalized according to Kolmogorov scaling, indicate that the measured structure functions agree with (6) for small $r_1/\eta$, as expected from Fig. 2. At $r_1/\eta$ on the order of 1 to a few 10s, the measured structure functions are approximately consistent with the Pao model, provided that $r_1/x_3 \ll 1$. The measured structure functions are less consistent with the Nasmyth model. 4. Discussion The estimates of dissipation and shear production (Fig. 2) indicate success of the sensor based on the two-spot method for measuring dissipation by means of laser-Doppler velocimetry. The measured structure functions (Fig. 3) indicate consistency with the Pao model to the extent that can be expected, considering the limited separation between the Kolmogorov scale and the outer scale of the turbulence, which is proportional to... Any isotropic model of the structure function must fail at $ r_1/x_3 = O(1) $. The one-spot estimates of dissipation are roughly 3 times larger than estimates based on theoretical calculations of noise variance caused by finite transit time of particles through the sample volume and turbulent velocity gradients within the sample volume (George and Lumley 1973). The likely explanation is that noise in the LDS measurements is dominated not by the interactions between fluid velocities and optical scattering that were considered by George and Lumley (1973), but instead by electronic and optical noise. The one-spot estimates of dissipation are approximately consistent with a model in which the noise variance of the velocity measurements is constant, which produces a decay of dissipation estimates with increasing $ x_3 $ because of the inverse dependence on $ U_1 $ in the expression $ \epsilon = (15\nu/U_1^2)(\partial u_1/\partial t)^2 $, which follows from (1) and the frozen-turbulence hypothesis. A fundamental limitation on the measurement technique is imposed by the nonzero scale of the LDS sample volumes. George and Lumley (1973) considered the effect of the nonzero scale of a single sample volume. They used a Pao spectrum and considered an optical weighting function $ w(x) $ defined by \[ w(x) = \frac{1}{(2\pi)^{3/2}\sigma_1\sigma_2\sigma_3} \exp\left[-\left(\frac{x_1^2}{2\sigma_1^2} + \frac{x_2^2}{2\sigma_2^2} + \frac{x_3^2}{2\sigma_3^2}\right)\right], \] finding (with some details depending on the precise geometry) that the largest of $ \sigma_1, \sigma_2, $ and $ \sigma_3 $ must be smaller than the Kolmogorov scale $ \eta $ in order to obtain 10% accuracy in dissipation estimates. The present sensor corresponds approximately to $ \sigma_1 = \sigma_2 \approx 25 \mu m $ and $ \sigma_3 = 125 \mu m $, so that accurate measurements of dissipation are limited to $ \eta > \sigma_3 = 125 \mu m $, or $ \epsilon < 5.5 \times 10^{-3} \text{ W kg}^{-1} $, with $ \nu = 1.1 \times 10^{-6} \text{ m}^2 \text{ s}^{-1} $. A second fundamental limitation on the two-spot measurement technique is imposed by the nonzero separation of the two sample volumes. To assess this effect, a model calculation was carried out (appendix B) in which the two sample volumes are points separated in the $ x_2 $ direction by a distance $ r_2 $ and the turbulence spectrum is represented by the Pao (1965) model. The calculations (Fig. 4) indicate that $ r_2 $ must be less than approximately 1.3$ \eta $ to produce a dissipation estimate within 10% of the true dissipation. The present sensor corresponds to $ r_2 = 200 \mu m $, so that accurate measurements of dissipation are limited to $ \eta > r_2/1.3 = 154 \mu m $, or $ \epsilon < 2.4 \times 10^{-3} \text{ W kg}^{-1} $. The present measurements indicate successful measurements of dissipation values as low as $ 10^{-5} \text{ W kg}^{-1} $ (Fig. 2). A lower bound on the dissipation values that can be measured by the LDS cannot be determined from the present results. The instantaneous quantity $ (\partial u_1/\partial x_1)^2 $, estimated by computing the product of the records of $ \partial u_1/\partial x_1 $ in the two sample volumes, is not lognormally distributed, as is usually expected in flows at high Reynolds numbers (e.g., Monin and Yaglom 1975). This result indicates that instantaneous estimates of $ (\partial u_1/\partial x_1)^2 $ have a relatively large noise component. The expected value of the noise is small, so that estimates of the mean dissipation are accurate, but the high noise level in individual estimates might preclude use of the LDS for examination of the intermittency of the dissipation, unless the measurements are suitably filtered (e.g., Yamazaki and Lueck 1990). Successful oceanic applications of the LDS require dissipation rates smaller than roughly $ 2 \times 10^{-3} \text{ W kg}^{-1} $ (as noted above) and light-scattering particles of sufficient size and concentration. Intuition suggests that particles smaller than the wavelength of the optical interference pattern (approximately 10 $ \mu m $ in the present case) are required, but theory and measurements indicate that particles both smaller and larger than this limit produce modulations of the scattered light, and, therefore, meaningful Doppler measurements. In the case of the LDS, the particles should be smaller than the spot separation, so that the scattering processes in the two spots are statistically independent. Intuition suggests that successful direct measurements of dissipation require particle concentrations that are sufficient to ensure an interparticle spacing of roughly one Kolmogorov scale; in the laboratory tests reported here, the particle concentration was an order of magnitude larger than this value. Previous oceanic use of optical sensors (e.g., Agrawal et al. 1992; Trowbridge and Agrawal 1995; Doron et al. 2001) suggest that the most favorable application of the LDS will be in near-bottom or near-surface environments in the coastal ocean, where turbulence is energetic and suspended particles are abundant. 5. Conclusions An oceangoing laser dissipation sensor based on the two-spot technique described by George and Lumley (1973) has been constructed. In this technique, two sample volumes separated in the spanwise direction measure the along-stream component of the velocity, and the dissipation is computed from the covariance of the temporal derivatives of the two velocity records, which reduces the bias in the dissipation estimates that is introduced by the variability of the positions and velocities of the individual optical scatterers. The sensor has been tested in a laboratory channel, where estimates of shear production provide a standard for evaluation of the dissipation measurements. Measurements of dissipation and a structure function, which quantifies the spatial scales of the turbulence, are consistent with expectations, indicating that the sensor produces accurate estimates of the time-averaged dissipation. The sensor can produce accurate estimates of dissipation only when the Kolmogorov scale is larger than the scale of the individual sample volumes and larger than the distance by which the two sample volumes are separated, which limits applicability to dissipation rates less than approximately $2 \times 10^{-3}$ W kg$^{-1}$. Noise levels in instantaneous estimates of the squared strain rate are high, which might limit use of the sensor in studies of the intermittency of the dissipation. Successful field application of this sensor will probably occur near the surface and bottom in the coastal ocean. Acknowledgments. The National Science Foundation provided funding for this project. Chuck Pottsmith and Janet Fredericks conducted the laboratory experiment, and Janet Fredericks executed the preliminary data processing. APPENDIX A Models of the Structure Function The structure function $D_{11}(r_1)$ can be represented by $$D_{11}(r_1) = 2 \int_{-\infty}^{+\infty} [1 - \cos(k_1 r_1)] F_{11}(k_1) \ dk_1,$$ where $\mathbf{k} = (k_1, k_2, k_3)$ is the wavenumber vector and $F_{11}(k_1)$ is the longitudinal spectrum, related to the three-dimensional spectrum $E(k)$, where $k = \|\mathbf{k}\|$, by the isotropic expression $$F_{11}(k_1) = \frac{1}{2} \int_{k_1}^{+\infty} \frac{k^2 - k_1^2}{k_1^3} E(k) \ dk$$ (e.g., Batchelor 1967). The model proposed by Pao (1965) is $$E(k) = \alpha \epsilon^{2/3} k^{-5/3} \exp\left[-\frac{3}{2} \alpha (k \eta)^{4/3}\right],$$ where $\alpha$ is the empirical Kolmogorov constant. The model proposed by Nasmyth, given in tabular form by Oakey (1982), corresponds approximately to $$F_{11}(k_1) = \begin{cases} (9/55) \alpha \epsilon^{2/3} k_1^{-5/3} & \text{for } k_1 \leq k_0 \\ (9/55) \alpha \epsilon^{2/3} k_1^{-5/3} \exp\left\{\sum_{n=1}^{n=5} a_n [\log_{10}(k/k_0)]^n\right\} & \text{for } k_0 \leq k_1, \end{cases}$$ where $k_0 \eta = 0.10$, $a_1 = -2.5708$, $a_2 = 3.1029$, $a_3 = -2.2918$, $a_4 = 0.7370$, and $a_5 = -0.0856$. The inertial-range expression (7) follows from substitution of (A4) into (A1) in the limit $k, \eta \to 0$. The Pao model was calculated numerically from (A1), (A2), and (A3) and the Nasmyth model was calculated numerically from (A1) and (A4). The calculations are based on $\alpha = 1.53$. APPENDIX B Effect of Nonzero Separation of the Sample Volumes Consider a model of the LDS in which point measurements of $u_i$ are separated by a distance $r_2$ in the $x_2$ direction. The statistics of the turbulent velocity fluctuations are assumed to be isotropic. The quantity determined by computing $15\nu$ times the covariance of $\partial u_i/\partial x_1$ at the two measurement positions is not $\epsilon$, as given by (1), but is instead a quantity $\epsilon_m$, defined by $$\epsilon_m = 15 \nu \overline{\partial_{x_1}[u_i(\mathbf{x})] \partial_{x_1}[u_i(\mathbf{x} + r_2 \mathbf{e}_2)]}.$$ This quantity can be represented by $$\epsilon_m = 15 \nu \int_{-\infty}^{+\infty} dk_1 \int_{-\infty}^{+\infty} dk_2 \int_{-\infty}^{+\infty} dk_3 \ k_1^2 \phi_{11}(\mathbf{k}) \cos(k_2 r_2),$$ where $\phi_{11}(\mathbf{k})$ is a spectrum function (Batchelor 1967). The isotropic representation of $\phi_{11}(\mathbf{k})$ is $$\phi_{11}(\mathbf{k}) = \frac{E(k)}{4 \pi k^2} \left(1 - \frac{k_1^2}{k^2}\right)$$ (Batchelor 1967). After substitution of (B3) into (B2) and introduction of polar coordinates [$k_2 = \sigma \cos(\theta)$ and $k_3 = \sigma \sin(\theta)$, where $0 \leq \sigma < +\infty$ and $-\pi < \theta \leq +\pi$], the $k_2-k_3$ integral can be evaluated, and the resulting expression can be written $$\epsilon_m = \frac{15}{2} \nu \int_{-\infty}^{+\infty} k_1^2 \ dk_1$$ $$\times \int_{k_1}^{+\infty} J_0(r_2 \sqrt{k^2 - k_1^2}) E(k) \frac{k^2 - k_1^2}{k^3} \ dk,$$ where $J_0$ is a Bessel function (Abramowitz and Stegun 1970). This expression with $E(k)$ represented by the Pao model was evaluated numerically to produce Fig. 4. The ordinate in Fig. 4 is $\epsilon_m/\epsilon$. REFERENCES Abramowitz, M., and I. A. Stegun, 1970: Handbook of Mathematical Functions. National Bureau of Standards, U.S. Government Printing Office, 1046 pp. Agrawal, Y. C., E. A. Terray, M. A. Donelan, P. A. Hwang, A. J. Williams, W. M. Drennan, K. K. Kahma, and S. A. Kitaigorodskii, 1992: Enhanced dissipation of kinetic energy beneath surface waves. Nature, 359, 219–220. Batchelor, G. K., 1967: The Theory of Homogeneous Turbulence. Cambridge University Press, 197 pp. Butman, C. A., and R. J. Chapman, 1989: The 17-m flume at the Coastal Research Laboratory. Part 1: Description and user’s manual. Woods Hole Oceanographic Institution Tech. Rep. 89-10, 31 pp. Clark, W. H., 1970: Measurement of two-point velocity correlations in a pipe flow using laser velocimeters. Ph.D. thesis, University of Virginia, 151 pp. Doron, P., L. Bertuccioi, J. Katz, and T. R. Osborn, 2001: Turbulence characteristics and dissipation estimates in the coastal ocean bottom boundary layer from PIV data. J. Phys. Oceanogr., 31, 2108–2134. Fries, J. S., and J. H. Trowbridge, 2003: Flume observations of enhanced fine particle deposition to permeable sediment beds. Limnol. Oceanogr., 48, 802–812. George, W. K., and J. L. Lumley, 1973: The laser-Doppler velocimeter and its application to the measurement of turbulence. J. Fluid Mech., 60, 321–362. Grant, H. L., R. W. Stewart, and A. Moilliet, 1962: Turbulence spectra from a tidal channel. J. Fluid Mech., 12, 241–263. Lumley, J. L., 1965: On the interpretation of time spectra measured in high intensity shear flows. Phys. Fluids, 8, 1056–1062. Monin, A. S., and A. M. Yaglom, 1975: Statistical Fluid Mechanics: Mechanics of Turbulence. Vol. 2. MIT Press, 874 pp. Nezu, I., and W. Rodi, 1986: Open-channel flow measurements with a laser-Doppler anemometer. J. Hydr. Eng., 112, 335–355. ——, and H. Nakagawa, 1993: Turbulence in Open-Channel Flows. A. A. Balkema Publishers, 281 pp. Oakey, N. S., 1982: Determination of the rate of dissipation of turbulent energy from simultaneous temperature and velocity shear microstructure measurements. J. Phys. Oceanogr., 12, 256–271. ——, and J. A. Elliott, 1982: Dissipation within the surface mixed layer. J. Phys. Oceanogr., 12, 171–185. Osborn, T. R., 1974: Vertical profiling of velocity microstructure. J. Phys. Oceanogr., 4, 109–115. Pao, Y. H., 1965: Structure of turbulent velocity and scalar fields at large wavenumber. Phys. Fluids, 8, 1063–1075. Shaw, W. J., J. H. Trowbridge, and A. J. Williams, 2001: Budgets for turbulent kinetic energy and scalar variance in the continental shelf bottom boundary layer. J. Geophys. Res., 106, 9551–9564. Siedler, G., and H. Peters, 1986: Physical properties (general) of sea water. Oceanography, Vol. 3, Geophysics and Space Research, J. Sundermann, Ed., Numerical Data and Functional Relationships in Science and Technology Series, Group V, Springer-Verlag, 233–264. Taylor, G. I., 1935: Statistical theory of turbulence. Proc. Roy. Soc., A151, 421–444. ——, 1938: The spectrum of turbulence. Proc. Roy. Soc., A164, 476–490. Tennekes, H., and J. L. Lumley, 1972: A First Course in Turbulence. MIT Press, 300 pp. Trowbridge, J. H., and Y. C. Agrawal, 1995: Glimpses of a wave boundary layer. J. Geophys. Res., 100, 20 729–20 743. ——, and S. Elgar, 2001: Turbulence measurements in the surf zone. J. Phys. Oceanogr., 31, 2403–2417. ——, W. R. Geyer, C. A. Butman, and R. J. Chapman, 1989: The 17-meter flume at the Coastal Research Laboratory. Part 2: Flow characteristics. Woods Hole Oceanographic Institution Tech. Rep. 89-11, 37 pp. van Maanen, H. R. E., K. van der Molen, and J. Blom, 1976: Reduction of ambiguity noise in laser-Doppler velocimetry by a cross-correlation technique. The Accuracy of Flow Measurements by Laser Doppler Methods, Proc. LDA-Symp. Copenhagen 1975, P. Buchave et al., Eds., Copenhagen, Denmark, Technical University of Denmark, 81–88. Veron, F., and W. K. Melville, 1999: Pulse-to-pulse coherent Doppler measurements of waves and turbulence. J. Atmos. Oceanic Technol., 16, 1580–1597. Yamazaki, H., and R. Lueck, 1990: Why oceanic dissipation rates are not lognormal. J. Phys. Oceanogr., 20, 1907–1918.	<urn:uuid:248232ee-1fee-4ff5-978f-6de38d75b480>	CC-MAIN-2023-06	https://journals.ametsoc.org/downloadpdf/journals/atot/21/7/1520-0426_2004_021_1104_atsfmo_2_0_co_2.pdf	2023-02-07T15:55:51+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-06/subset=warc/part-00277-b5ddf469-bf28-43c4-9c36-5b5ccc3b2bf1.c000.gz.parquet	351,590,820	9,731	eng_Latn	eng_Latn	0.915242	eng_Latn	0.983456	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	docling	[ 4187, 7786, 13889, 19742, 23141, 28539, 33235, 37547 ]
2019 MAY NEWSLETTER HEMINGFORD CHAMBER FEATURED BUSINESS PAT'S CREATIVE * 7355 Gage Rd Hemingford Pats Creative started in 1975 with a drawer full of embroidery thread by owner Pat Buskirk. It was stationed at Pats house until 1986 when they became an independent Bernina Dealer and built the business on the family farm. Through the years Pats Creative grew to include sewing machines, lots of fabric, and a complete line of books, patterns, and notions. Pat retired and the business is now run by Sonya Buskirk and daughter Shelley. Pats Creative carries BERNINA, Janome, And HandiQuilter sewing, embroidery, and quilting machines. With over 5000 bolts of quilting cottons, Cuddle fabric, flannels, and more, they have become the largest sewing shop in the Panhandle. They have continued their bi-monthly Workshops and have many classes and seminars. Highlights each year are the Super Sale Super Bowl Weekend and the annual Fall Sale. They also host an ANNUAL Women's Sewing Weekend Retreat in Scottsbluff at the Hampton Inn. About 70 women attend. If you are looking for anything sewing related, or just want to come and see, please stop by. We are open M-F 10-5, and Sat 10-4, Closed on Sundays. And yes, we are located on our family farm at 7355 Gage Rd Hemingford…and GPS doesn't always get you here so just watch the roads…Go to CR 73 , 3 miles South to Gage, and ½ mile West, then ½ mile south down the driveway! Hope to see you. We are Pats Creative~ Your 1 Stop Sewing Shop! PINE RIDGE JOB CORPS AN ASSET TO OUR COMMUNITY! Hemingford Chamber of Commerce President Kathy Gettert and Secretary Joni Jespersen present one of five televisions to Pine Ridge Job Corps Center Director, Tammy Calamari. Directors under the leadership of creator of the project Reverend James Hoare. The Job Corps has been the catapult in setting up the Hemingford Diorama for over 10 years. Without the hard work of the Job Corps students and instructors, the Diorama was facing the possibility of not being displayed any longer. The collaborative efforts of the Minich family, HHS Shop Class and the Job Corps have helped keep this historical presentation on display each year during the Christmas season. The Hemingford Diorama was created by community members Darien Anderson and Arnold Kuhn as Art The Job Corps was given the televisions for the activity room for the students to use on their down time. The Job Corps students do a multitude of services in many communities. Additionally, one of the other large contributions they have made for our community was helping construct the new concession stand at Bobcat Field (as depicted in the photo on display at Job Corp headquarters south of Chadron). Chamber President Kathy Gettert, Job Corp Director Tammy Calamari and Chamber Secretary Joni Jespersen THANK YOU, PINE RIDGE JOB CORPS, FOR YOUR SUPPORT OF OUR COMMUNITY!!! Membership dues are as follows: Individual $25 * 1-9 employee $50 * 10-50 employee $75 * over 50 employees $100 HEMINGFORD COMMUNITY DONATION DRIVE TO FLOOD VICTIMS IN FARWELL, NE Rhonda & Dave Swanson, along with Tammy Berry at the Hemingford Ledger headed up a donation drive for the flood victims in Farwell, NE. Donations of all kinds were brought to the Ledger and on Saturday, April 13 people gathered to help load the trailer that the Swanson's had so generously brought down to be taken to Farwell. We had a wonderful amount of donations from the Hemingford and Crawford communities. Thank you so much to all who donated! What a wonderful community we live in!! Rhonda & Dave along with their friends Kathy and JayDee Smith of Crawford took the trailer full of donations to Farwell on Sunday. Rhonda said that the people there were so very happy to receive everything. They had people lined up to help unload and were unloaded in 20 minutes. She said that Michelle Woitalewicz and her husband have a large building that they have opened up and organized the items as if one were stepping into a store. Shelves that are organized and filled with donations for the people of 8 counties to come and get what they need. Marcie Thomas had made t-shirts and decals that she sold for the event and her proceeds were donated to Peru, NE. CHAMBER'S BUSINESS APPRECIATION DINNER (Pictured left) Chamber President Kathy Gettert, Chamber Member Blanche Randolph and Chamber Secretary Joni Jespersen UPCOMING EVENTS MAY 11 - Graduation/Saturday MAY 18 - City-wide Garage Sales Spring Fling Junk Jaunt – Fairgrounds MAY 26 - Alumni Banquet May 25 - Bobcats Beating Cancer – Alumni Basketball Tournament AUGUST 2 - Band on the Butte AUGUST 4 – 11th - Box Butte County Fair AUGUST 10 - Fair Parade & A Day in the Park OCTOBER 12 – Harvest Moon Fall Festival A big THANK YOU to Table Top Meats, Randolph Family and The Body Shop Dave's Pharmacy The Body Shop Westco Hemingford Community Federal Credit Union Mobius Communications New Image Hemingford Ledger Box Butte Development Hemingford Community Foundation Hemingford Dental. Box Butte General Hospital Table Top Meats Panhandle Coop Fix It Frosty JAV Enterprises LLC. Don & Joni Jespersen The Cottage Hemingford Care Center Hemingford Schools Flannel Brothers Panhandle Public Health Bank of the West Bates & Gould Rick & Patti Wobig	<urn:uuid:2e45c64d-9d31-4033-8b90-96b90f66774a>	CC-MAIN-2019-26	https://www.hemingfordevents.com/uploads/1/7/8/4/17841469/may_newsletter.pdf	2019-06-16T09:34:10Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-26/segments/1560627998084.36/warc/CC-MAIN-20190616082703-20190616104703-00282.warc.gz	763,527,735	1,249	eng_Latn	eng_Latn	0.994508	eng_Latn	0.995759	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3001, 5306 ]
ORIGINAL ARTICLE SURGICAL OUTCOMES OF GENITOURINARY FISTULAE: AN ANALYSIS OF 26 CASES Mohsin Shakil, Riaz Ahmed, Shafaq Hanif* Department of Urology, *Obs/Gyn, AJK Medical College, Muzaffarabad, Azad Kashmir, Pakistan Background: Genitourinary fistulae are known complications of prolonged labour and pelvic surgery. Successful treatment outcomes hinge on detailed evaluation of the site of fistula, appropriate timing and technique of surgery. The objective of this study was to study the presentation, aetiology, evaluation of different treatment options and treatment related complications. Methods: All patients reporting with urinary incontinence due to genitourinary fistulae were enlisted. Patients were investigated to determine the cause of fistula. Evaluation of the site and size of the fistula was done by clinical examination. IVU, EUA and urethrocystoscopy were used to develop treatment plan; treatment and follow-up to assess and document the progress including treatment result, complications and quality of life. Results: Iatrogenic injury was the leading cause in 18 post-hysterectomy fistula cases, 4 cases were post Csection, and 4 cases were after prolonged labour. There were 22 Vesico Vaginal Fistulae (VVF) and 4 cases of Uretero Vaginal fistulae. Five fistualae were treated conservatively, vaginal repair was performed in one, and extra peritoneal transvesical approach was used in 3 cases. Four patients had ureteric re-implantation (extra-vesical ureteroneocystostomy). Thirteen patients had trans-vesical transperitoneal supra-pubic repair with interposition of J-flap of omentum. Complications observed included failure to heal in 2 patients, wound sepsis 6 cases, and 1 patient required re-exploration for a retained gauze. Conclusion: Majority of the genitourinary fistulae in this study were of iatrogenic aetiology. The duration, size and location of the fistulae were the key determinant in the choice of the treatment method. Keywords: Vesicovaginal fistula, VVF, Repair, Complications, Urinary, Fistula, Incontinence Pak J Physiol 2016;12(4):27–9 INTRODUCTION Genitourinary fistulae include Vesico-Vaginal Fistula (VVF) and Uretero Vaginal Fistula (UVF). They have been a source of untold misery for women since ancient times. Prolonged labour is the primary cause of VVF in underdeveloped countries. 1,2 Developed countries have gynaecologic surgery as the major contributor. 3 Whatever the cause, the effects of uncontrolled passage of urine are devastating to the sufferer. Women not only find themselves having to manage a constantly wet body but also face social rejection. 4 The magnitude of the problem worldwide is not fully known but it is estimated to be more than 2 million with 50,000 to 100,000 new cases every year. 5 Treatment options include repair by the vaginal or abdominal route, electrocautery, fibrin glue, electrocautery and endoscopic approach, laparoscopic repair, interposition grafts or flaps. 6 Surgical repair has success rates of up to 95% while open surgical repair is the gold standard for VVF repair. 7,8 There are few studies on factors affecting outcome of surgical repair. The current study reviews factors influencing surgical repair. The results of this study would generate useful baseline database which would help the surgeons to manage these fistulae and their related complications properly. This study would report the outcome of management followed by complication rates in our local population. PATIENTS AND METHODS This retrospective study was carried out on patients presenting at District Headquarters Hospital Mirpur, and Abbas Institute of Medical Sciences (AIMS), Muzzafarabad. Total 26 patients undergoing surgery for VVF from 2001 to 2015 were included in this study. Patients with history of recurrence of fistula, multiple fistulae and radiation, small bladder size, urethral destruction, circumferential involvement and severe vaginal scarring were excluded. A detailed history was taken and the patients examined. Routine baseline investigations were ordered. An IVU was advised to evaluate functions and anatomy of urinary system and the fistula site. All patients also underwent EUA. Cystoscopic evaluation was performed to determine size and position of fistula. Decisions of conservative treatment or surgical repair via intraabdominal or vaginal route were made. Conservative treatment included continuous urinary drainage with indwelling Foley's catheter for three weeks. 9 Vaginal repairs were carried out in the lithotomy position. Standard dissection and repair techniques were employed in vaginal repairs. 10 Transvesical extraperitoneal method of vesicovaginal repair was also employed. The patient was placed in a steep Trendelenburg position, and a transvesical incision was given to visualize the fistula. The bladder mucosa adjacent to the fistula was circumscribed and excised. The bladder was dissected off the vagina. The bladder, and vaginal defects were closed separately. 11 Legueu transvesical transperitoneal method was used in most of the patients. The peritoneal cavity was accessed by laparotomy and a sagittal incision made in the bladder. This cystostomy incision was extended to the fistula. The bladder was mobilised off the vagina, and the bladder and vaginal defects were closed separately. J-flap of omentum with vascular supply was mobilised off the transverse colon and used for interposition between bladder and vagina. Bladder was drained with suprapubic and urethral catheter for ten days. 12 Antibiotic cover was also provided. Ureterovaginal fistulae were treated by ureteric reimplantation performed by the Grégoire-Lich technique of extravesical ureteroneocystostomy 13 . These patients were followed for 6 weeks at 2 week intervals. Data were analysed using SPSS-22. Descriptive statistics were applied to calculate mean and standard deviation for the age of the patients. Frequencies and percentage was calculated for the categorical variables. RESULTS Among 26 patients, the youngest patient was 23 years old while the eldest one was 57 years of age with mean age of 42.73±10.16 years. The duration of the illness at the time of treatment for patients with history of prolonged labour was 12 to 21 years; on the other hand the duration of illness in iatrogenic causes was less than 3 years. Iatrogenic injury was the leading cause in 85% of cases of and only 15% cases were due to prolonged labour. There were 22 VVF, and 4 cases UVF (Table-1). Table-1: Causes and types of fistulae Cystoscopic sizes of <1 Cm were noted in 4 cases, 13 cases had fistulae >1 Cm. Nine cases including 4 suffering from UVF and 5 from VVF, treated conservatively were not evaluated cystoscopically. Cystoscopic findings of 17 patients with VVF are given in Table-2. There were 5 patients with co-morbidities; 3 hypertensive and 2 diabetics. Table-2: Cystoscopic Sizes a location of VVF Five fistulae were treated conservatively, one was repaired through transvaginal route, extra peritoneal transvesical approach was used in 3 patients, and 4 patients had ureteric re-implantation. Thirteen patients had transvesical transperitoneal suprapubic repair with interposition of the J-flap of omentum (Table-3). Complications observed included failure to heal in 2 patients, 3 patients developed wound sepsis and 1 patient required re-exploration for a retained gauze. Table-3: Treatment and outcome DISCUSSION Genitourinary fistulae are seen mostly in childbearing age. 14,15 In developing countries, the major causative factor is obstetrical trauma. 15–19 In developed countries, most of the fistulae are due to inadvertent injury to the bladder during surgery especially hysterectomy. 20,21 This study revealed that 70% of the fistulae were posthysterectomy, 15% developed after C-section and 15% resulted from prolonged labour. This reflects the changing trends in comparison with the previous studies where 85% patients were due to the prolonged labour. 22 For proper preoperative evaluation of the fistulae to make evidence based decision about the mode of management, IVU and EUAs were performed in all the patients. IVU was found to be more valuable investigation for identification of ureteric fistulae. EUA provided opportunity to see and evaluate the size and location of the fistulae and condition of the surrounding tissue. A cystoscopic examination as a part of EUA gives additional information about the size and location of fistula with reference to bladder neck and ureteric orifices. Most of the VVF were more than 1 Cm in size and location of 94.11% was supratrigonal. Karateke et al reported more occurrence of the supratrigonal fistulae. 23 Depending on tissue condition (absence of inflammation and oedema), surgical repair was performed three to six month after the occurrence. This routine is being followed as a principle of surgery by most surgeons. 15,16,19 Some studies 9 reported reasonably good results with conservative management. Some surgeons 16,17 have reported excellent results with vaginal approach while other studies have revealed higher success rates with abdominal approach. 13,20,23 Previous studies of both transabdominal and transvaginal repair have described a success rate ranging from 77.7% to 87%. 13,18,19 Success rates of 100% with transabdominal 24 and transvaginal 16,17,25,26 repair have also been reported. The present study showed overall 92.31% success rate, which was based upon a thorough evaluation and choice of the type of management. Many other factors like general condition of the patient, size and site of the fistula, previous attempts at repair and operative facilities influence the decision. All patients with ureterovaginal fistula were managed successfully by extravesical ureteroneocystomy. In patients with VVF, the success rate in patient on conservative treatment was about 80%. Only one patient with trigonal fistula was treated with vaginal repair that healed successfully. Two of the three repaired extra peritoneal transvesical approach healed with success rate of 66% in this category. Repair in 13 patients was performed through abdominal transperitoneal approach with interposition of the omentum graft; no failure was observed in this group. Emmanuel 27 reported that prolonged obstructed labour was the commonest (55.4%) cause of fistula on 56 patients reported, and the vaginal route (71.7%) was the commonest route employed in the repair. Another study from India 28 reported 94.8% success rate in vaginal repair while 100% successful repair was achieved through abdominal repair. In spite of such results, fistula repair is still a challenging endeavour as healing requires precise evaluation and choice of treatment. Where surgery is required, the timing of the repair, appropriate decision about the route of surgery and surgical method, use of tissue interposition and postoperative care are the prerequisites of the success. And the irony of the facts is that most of fistulas treated were preventable! CONCLUSION The most common cause of vesicovaginal fistulae in this study was iatrogenic (85%) as a result of intraoperative injury during hysterectomy or Caesarean section. The transabdominal approach using omental flap interposition is more effective for the treatment of supratrigonal and large fistulae, while for the treatment of small and trigonal fistulae, the transvaginal approach is effective. Abdominal approach should be adopted as a primary method of VVF repair because of its higher success rate as compared to vaginal route. REFRENCES 1. Raut V, Bhattacharya M. Vesical fistulae –an experience from a developing country. J Postgrad Med 1993;39:20–1. 3. Hilton P. Surgical fistulae. In: Staskin D, Cardozo L (Eds). Textbook of Female Urology and Urogynecology. Oxford, UK: Isis Medical Media; 2001:691–709. 2. Sarker B, Ghoshroy S, Saha SK, Mukherjee A, Ganguly RP, Saha S. A study of genitourinary fistulae in North Bengal. J Obstet Gynecol Ind 2001;51:165–9. 4. Milicevic S, Krivokuca V, Ecim-Zlojutro V, Jakovljevic B. Treatment of vesicovaginal fistulas: an experience of 30 cases. Med Arh 2013;67(4):266–9. 6. Bose CK, Basu A, Kanjilal S, Basu S. Giant Supratrigonal Vesicocervicovaginal Report Fistula –A Case Report. Medscape General Medicine 2005;7(4):74. 5. Khawaja AR, Bashir F, Dar TI, Iqbal A, Bazaz S, Sharma AK. The 11-Years experience in vesicovaginal fistula management. J Obstet Gynecol 2014;22:200–5. 7. McFadden E, Sarah JT, Bocking A, Rachel F, Mabeya H. Retrospective review of predisposing factors and surgical outcomes in obstetric fistula patients at a single teaching hospital in Western Kenya. J Obstet Gynaecol Can 2011;33:30–5. 9. Davits RJ, Miranda SI. Conservative treatment of vesicovaginal fistulas by bladder drainage alone. Br J Urol 1991;68(2):155–6. 8. Javed A, Abdullah A, Faruqui N, Shah SS, Mehdi B, Pirzada AJ. Factors determining recurrence after vesicovaginal fistula repair. J Pak Med Assoc 2015;65:954. 10. Blandy JP, Badenoch DF, Fowler CG. Early repair of iatrogenic injury to the ureter or bladder after gynaecological surgery. J Urol 1991;146(3):761–5. 12. Legueu F. De la voie transperitoneo-vesicaleporla cure certaines fistules vesico-vaginal esoperatoires. Arch urolclin De Neker 1913;1:1–11. 11. Sahito RA, Memon MS, Shaikh F. Per abdominal repair of vbesicovaginal fistula:surgical expirience of 30 cases. MC. 2012;18:87–90. 13. Rajamaheswari N, Bharti A, Seethalakshmi K. Vaginal repair of supratrigonal fistulae –a 10 year review. Int Urogynecol J 2012;23:1675–8. 15. Hafeez M, Asif S, Hanif H. Profile and repair success of vesicovaginal fistula in Lahore. J Coll Physicians Surg Pak 2005;15:142–4. 14. Ghumro AA. Closure of simple vesicovaginal fistula at Peoples Medical College Hospital, Nawabshah. J Coll Physicians Surg Pak 1993;3:116–8. 16. Bashir A, Cheema MA, Tahir S, Khalid S, Mustansar M. Genitourinary fistulas: a two-year experience with vicryl on 20 cases. Specialist 1994;11:109–13. 18. Moudini S, Nouri M, Koutani A, Ibn Attya A, Hacimi M, Lakrissa A. Obstetrical vesicovaginal fistula: Report of 114 cases. Prog Urol 2001;11:103–8. 17. Goh JT. Genital tract fistula repair on 116 women. Aust NZJ Obstet Gynaecol 1998;38:158–61. 19. Amr MF. Vesico-vaginal fistula in Jordan. Eur J Obstet Gynaecol Reprod Biol 1998;80:201–3. 21. Tancer ML. Observations on prevention and management of vesicovaginal fistula after total hysterectomy. Surg Gynecol Obstet 1992;175:501–6. 20. Eilber KS, Kavaler E, Rodriguez LV, Rosenblum N, Raz S. Ten year experience with transvaginal vesicovaginal fistula repair using tissue interposition. J Urol 2003;169:1033–6. 22. Mubeen RA, Naheed F, Anwar K. Management of vesicovaginal fistulae in urological context. J Coll Physicians Surg Pak 2007;17(1):28–31. 24. Nesrallah LJ, Srougi M, Gittes RF. The O'Conor technique: the gold standard for supratrigonal vesicovaginal fistula repair. J Urol 1999;161:566–58. 23. Karateke. Iatrogenic vesicovaginal fistulas. J Turkish-German Gynecol Assoc 2010;11:137–40. 25. Catanzaro F, Pizzoccaro M, Cappellano F, Catanzaro M, Ciotti G, Giollo A. Vaginal repair of vesico-vaginal fistulas: our experience. Arch Ital Urol Androl 2005;77:224–5. 27. Emmanuel O, Ifeanyichukwu D, Chinwendu A, Chijioke O, Uzoma O, Uzoma M, et al. Preliminary outcome of the management of vesicovaginal fistulae at a teaching hospital in Southeastern Nigeria. Internet J Gynecol Obstet 2012;16(1):22–5. 26. Hanif MS, Saeed K, Sheikh MA. Surgical management of genitourinary fistula. J Pak Med Assoc 2005;55:280–4. 28. Rajamaheswari N, Chhikara AB, Seethalakshmi K, Bail A, Agarwal S. Trans-vaginal repair of gynaecological supratrigonal vesicovaginal fistulae: a worthy option. Urol Ann 2012;4:154–7. Address for Correspondence: Dr Mohsin Shakil, Department of Urology, AJK Medical College, Muzaffarabad, Azad Kashmir, Pakistan. Cell: +92-300-8111371 Email: [email protected] Received: 3 Jul 2016 Reviewed: 15 Sep 2016 Accepted: 6 Oct 2016	<urn:uuid:13d8268a-29b4-4b7a-bb1a-147373be485e>	CC-MAIN-2018-05	http://www.pps.org.pk/PJP/12-4/Mohsin.pdf	2018-01-17T09:03:16Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084886860.29/warc/CC-MAIN-20180117082758-20180117102758-00157.warc.gz	518,084,741	4,157	eng_Latn	eng_Latn	0.957474	eng_Latn	0.989296	[ "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 4928, 9544, 16020 ]
DEVELOPING A HERD POSTURE And removing movement Movement is intentional wether it is grazing calmly or flight. Each action of movement has a reason for its occurrence. Stimulates are the reason of movement, hunger, weather or pressure from encroachment into the flight zone or perceived pressure, they are all factors that create movement. We must have an understanding of what creates movement in order to manage it. The reaction of fear has the self-preservation reaction of fight or flight. Removing fear is our objective and promoting the instinctive reaction of the defensive posture of the herd group. This is accomplished by desensitizing and replacing fear with the Standing Solution. Developing a herd or settling cattle, gentling or leaving them over night or accustoming cattle to dog presence is all the same effort of removing the reaction of nervous movement from perceived pressure. It is about using steady movement outside of the livestocks flight zone (desensitizing). Developing the herd is the first step so that we may begin the training of predator awareness. Creating the herd reaction of Predator Awareness first begins with developing a stance where the training can begin. This method of desensitizing is the same action as the NCHA uses in settling cattle prior to each cutting class. Or if you are a rancher who works your cattle horseback and your cattle aren't exposed to people on the ground that new exposure will create fear, this same method can help you prepare and expose them. Areas that can be an issue are cattle leaving the ranch destine for sale yards, feedlots or anyplace that they may handle cattle afoot. The fear will seem as if you have wild cattle and wild cattle no matter the qaulity are less desirable. You can use this simple method to calm and expose your cattle to humans working a foot. One of the most common mistakes that defeats the effort of developing the herd stance is the direct approach. Going straight to the livestock or running to get ahead of them. These efforts create flight. Flight is what we are trying to replace with the defensive posture and the standing solution of predator awareness. Another training practice is the practice of "Pressure and Release". The pressure is applied to achieve a reaction, when the correct response happens, the pressure is released. The release is the reward. Instilling that the correct response is set to memory. The release must come quickly, with a time for the animal to realize "this is it" before continuing. The training practice of desensitizing is a long held practice of training behavior. But as with anything, done poorly, it can result in no results. Let's look at the practice of sacking out a young horse. The objective is to get the horse use to things moving around and contacting him. But done incorrectly it is just a practice of mild abuse. Without the understanding of the desired result there are no forward accomplishments. In training one of the most common mistakes is overdoing a training session. We as humans enjoy results, so we continue the action to enjoy the results. The animal only understands that the repeated effort must require a different response. It does not instill a learned behavior but it relates a bad experience. With the horse being sacked out for the first time, realize that when the horse excepts the blanket, stop. Give a moment for the horse to understand "this is it" before continuing. When we are working with animals which may be in the beginning of training "kindergarten" and we often ask for a "PHD" result. Understand that training is an progressive effort over time. Whether you are calming cattle destine for a sale or creating the stance outside, it is the same method. If it's settling or calming cattle destine for the sale, you can start in a larger pen of your corrals. Get off your horse and at the far side of the corral, walk back and forth crossing the corrals at a normal pace in a lateral pattern that applies no pressure to the stock. If movement is created stop and stand. When the movement stops walk away and begin the lateral pattern again. After several passes move the cattle to an alley. The alley should be closed at both ends. Stand at the end of alley and slowly proceed along one side. When you create the reverse parallel pressure they will pass by you following the lead animal, often at a high rate of speed. Stop and Stand, when they have passed and are standing at the end of the alley with no movement, proceed to the other end of the alley you were first destine for. Turn and slowly approach the cattle again keeping to the side of the alley, recreating the reverse parallel pressure. As the cattle are passing by stop and stand, if movement stops when you stop, continue and proceed to the end of the alley. This will need to be repeated several times, but it will effectively expose cattle to work calmly a foot. Alley work-reverse parallel pressure When we are accomplishing the goal of herd development outside on the range we don't have the luxury of a back drop such as a corral or an arena or any type of containment. Because the training is happening in large areas it may cover a considerable distance, but we are performing this training a horseback not on foot. The training in open areas takes an understanding of the cattle's response and recognizing the edge of the flight zone. The cattle Lateral movement-no pressure Will relay to you where that distance is. Depending on the cattle's disposition and sensitivity that will tell you the appropriate distance. The cattle's first reaction is a recognition of your presence which is usually an eye to eye contact, stop and stand. Depending on the cattle's sensitivity is the determining factor in proceeding or backing up. If the cattle move with eye contact then they are sensitive, back up. If they remain standing or return to grazing, proceed from side to side passing laterally to the out side edges of the furthest edge animals before turning. This movement is only movement intended for you the trainer. It should be started at a walk and after the stance is sound with no movement, your efforts can be escalated to a trot, but never a run. If this movement creates movement you must stop and increase the distance of your separation between you and the cattle and begin again. The sensitive cattle will need to be approached again (stop, back up and stand) until the response is just curiosity and a stance. Then proceed with lateral movement, if movement is created, back off again and repeat. Once the lateral movement creates no movement you may proceed by closing the distance at an diagonal approach. (This is the gather, bringing the cattle together) Your pace, as you get closer to the animals being grouped should slow and occasionally stop and start randomly. When the cattle are grouped and standing loosely the effort has been accomplished. This is a very good time to quit. The appropriate number of herd development trainings (where cattle stand calmly) prior to beginning predator awareness training is three. By developing a herd group, movement becomes an easy effort of moving a herd group versus keeping individuals grouped together. The introduction that you are arranging between the cows and the dog needs to be performed without disturbance. No other projects should be on the agenda, and no other guests present. We humans can multi-task and are comfortable with chatting while we work, but it is distracting to the animals wether it is the cows or the dogs. Both their attention should be focused on the introduction. If your cows are not accustomed to dogs, this same herd development may be used to accustom the cows to them. The control of your dog is of great importance. No yelling or loud calling should be required. When a dog is not in the working mode it's proper position should be behind the horse ready and willing to respond to a command. Once the herd posture is complete, cows are grouped, calm and standing. This is the construction phase of predator awareness. You are building a foundation that further training can be built upon. In the beginning moving forward to quickly will create cracks in that foundation. We have established the herd group and our next step will be creating movement. With the group standing quietly it requires a pressure to start the stock. By rocking your horse, short turns from left to right (it is preferred that the horses front feet are the only movement) this will usually start movement. If not, walking in a zig zag pattern works well also. This is rear pressure point pressure, this action with further training will be discouraged. Pressure point pressure is a controlled response but it's actions are rear pressure and movement. Closing mimicking a chase sequence. With further training, creating movement will begin at the lead and create movement with the reverse parallel pressure. Allowing several trainings of just establishing a herd posture, will benefit the results of the predator awareness training in the future. After creating movement and following for a short distance at least 200 yards. We will create a stop. By using forward parallel pressure out side of the flight zone (the passing zone) you will create a stop. This is most effective when done at an extended trot (do not run). If you are accompanied by a dog send him at this time and allow him to proceed to the lead. After the cattle have stopped, remove all pressure. Allow the cattle to stand. You have just effectively created the herd posture, began movement and you have successfully accomplished the first training session of predator awareness and the basic stop. You are on your way to instilling the defensive posture of your herd. Mark L. Coats	<urn:uuid:1bcec5f8-34d0-4abe-8461-d8dc1a1cc0da>	CC-MAIN-2024-51	https://rancherpredatorawareness.com/pdfs/developing-a-herd.pdf	2024-12-11T02:41:33+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-51/subset=warc/part-00270-b392068a-8e35-4497-8fab-a691b1a71843.c000.gz.parquet	456,800,698	1,934	eng_Latn	eng_Latn	0.999	eng_Latn	0.998996	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 3642, 5444, 7962, 9802 ]
Fats and oils are fundamental to creating foods people love. These key ingredients can significantly impact functionality, consumer appeal—and shelf life. Getting fats and oils right makes everything better. Confections Confectionery fats are critical structuring agents, and they provide: - Flavor Release - Melting Temperature - Shelf Life ...as well as inhibiting oil migration. The perfect confection needs the perfect fat: hard for coatings, soft for fillings, and softer for spreads. Sounds simple enough, but... AAK understands the nuances of the confectionery process. We understand why a certain blend has a certain effect; how fats interact with your other ingredients; how your processes affect your outcome…and so much more. Caramels Fats with the right melting properties can provide structure and help minimize stickiness and waxiness in soft caramels Enrobed Confections & Snack Bars Fats help create glossy coatings with satisfying snap, and help keep bloom at bay Nut Butters Fat blends provide structure to slow or even stop the liquid nut oils from separating over time Consumers choose their confections¹ based on: \| Feature \| Percentage \| \|-----------------------\|------------\| \| Indulgence \| 39% \| \| New Flavor \| 23% \| \| All-Natural Ingredients \| 22% \| Not all fats are created equal. With the versatility provided by one the broadest lines of plant-based oils & fats in the industry and over 150 years of experience, AAK answers the most demanding product development challenges, in co-development with our customers. Let’s Get Together! ¹ Chocolate Confectionery: incl. impact of COVID-19 U.S., May 2020, Mintel.	d2baf622-0b5d-4686-83ea-34c7a244a98a	CC-MAIN-2021-49	https://betterwithaak.com/wp-content/uploads/2021/09/AAK-Fats-Oils-Infographic_CONFECTIONS.pdf	2021-11-28T14:56:48+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00181-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	204,321,907	356	eng_Latn	eng_Latn	0.995149	eng_Latn	0.995149	[ "eng_Latn" ]	true	docling	[ 1707 ]
This is the author's version of a work that was submitted/accepted for publication in the following source: Hanusch, Folker (2009) Taking travel journalism seriously : suggestions for scientiﬁc inquiry into a neglected genre. In Flew, Terry (Ed.) Communication, Creativity and Global Citizenship : Refereed Proceedings of the Australian and New Zealand Communication Association Conference 2009, Queensland University of Technology, Brisbane, QLD. This ﬁle was downloaded from: http://eprints.qut.edu.au/74047/ c ⃝ Copyright 2009 [please consult the author] Notice: Changes introduced as a result of publishing processes such as copy-editing and formatting may not be reﬂected in this document. For a deﬁnitive version of this work, please refer to the published source: Taking travel journalism seriously: Suggestions for scientific inquiry into a neglected genre Folker Hanusch University of the Sunshine Coast [email protected] Dr Folker Hanusch is a former journalist and now Lecturer in Journalism at the University of the Sunshine Coast. His main research interests are in the area of news media coverage of death, journalism practice across cultures and travel journalism. Abstract The practice of travel journalism is still largely neglected as a field of inquiry for communication and journalism scholars, despite the fact that news media are increasingly focussing on softer news. Lifestyle sections of newspapers, for example, have been growing in size over the past few decades, and given corresponding cutbacks in international news reporting, particularly travel journalism is now playing a growing role in the representation of 'the Other'. While this need for research into the field has been identified before, very little actual investigation of travel journalism has been forthcoming. This paper reviews the current state of research by reviewing what studies have been conducted into the production, content and reception of travel journalism. It argues that while there does now exist a very small number of studies, these have often been conducted in isolation and with significant limitations, and much remains to be done to sufficiently explore this sub-field of journalism. By analysing what we do know about travel journalism, the paper suggests a number of possibilities in each area on how we can advance this knowledge. Above all, it contends that dated prejudices against the field have to be put to the side, and the practice of travel journalism needs to be taken seriously in order to do its growing importance justice. Keywords Travel Journalism, Lifestyle Journalism, Journalism Practice, Othering Introduction Since its inception, academic research into journalism has focussed predominantly on the field of news journalism, with scholars examining aspects of the production, content and reception of this dominant aspect of the media. Other fields, such as sports journalism, fashion journalism and travel journalism have only recently begun to attract attention as a ANZCA09 Communication, Creativity and Global Citizenship: Refereed Proceedings: http://anzca09.org serious field for research. Part of the reason for this interest is the fact that journalism has undergone somewhat of a transformation, giving rise to 'soft news' in media around the world. As far as 10 years ago, Wendy Bacon (1999:89) pointed out that there were gaps in media theory particularly "in the huge area of journalism beyond the news". This has become a particular issue in international communication research, because news media have cut back on international news reporting due to the costs involved as well as waning audience interest. However, as Fürsich and Kavoori (2001: 154) point out, "media representations of 'others' remain decisive factors in this era of globalisation". They recommend that international communication research therefore refocus and include other media genres, such as travel journalism. US travel editor Thomas Swick (2001: 65) also notes this shift when he says that "in this day of disappearing foreign bureaus, the travel section is many papers' only in-house window on the world at large". And Santos (2004: 394) even goes so far as saying that "travel writers have become socio-cultural decoders". Travel journalism in particular, with its tales from foreign lands, certainly has the potential to influence audiences' views of other cultures. It is therefore surprising perhaps, that despite its arguably increasing relevance and presence in the mass media, travel journalism is still heavily under-researched, despite a call by Fürsich and Kavoori's (2001) for more investigation some time ago. This paper will briefly review the few studies that have examined aspects of travel journalism, before making recommendations on how to extend Fürsich and Kavoori's (2001) suggestions for future research and address this gap in knowledge. Literature review Travel journalism has historically been seen as journalism's not-so-serious little brother, a view that has been held by both practitioners and scholars. Many news journalists do not take it very seriously themselves, often belittling its relevance or seriousness. The view is that "anyone can go on holidays, and anyone can write about them" (Lischke, 2007, my translation). The fact that many newspaper journalists who write travel pieces have generally not received any training in the field and have gone on all-expenses-paid assignments based on their performance as general staff may not have helped the esteem in which the field is held. The view that travel itself is supposed to be all about fun and therefore writing about is perhaps more a leisure activity than serious work doesn't help either. As travel journalist Thomas Swick (1997: 424) has pointed out, "of the special-section editors at a newspaper – travel, fashion, food, home and garden – only [travel] occupied a position that is viewed as requiring no particular expertise". Swick (1997:424) argued the field was seen as one in which anyone could work: "Not only do most people travel, most people write postcards when they do: ergo, most anyone can be a travel editor". Similarly, travel journalism as a field of scientific inquiry has suffered in that there exist very few studies taking it seriously. Travel journalism is still widely regarded as a "frivolous topic" of research (Fürsich and Kavoori, 2001), despite the increasing importance that tourism plays in today's world. In fact tourism is an immensely important component of the world economy, with tourism growing at an average 4.8 per cent of GDP worldwide between 1975 and 2000, representing a 6 per cent share of worldwide exports of goods and services in 2003 (World Tourism Organisation, 2004). In Australia the industry represents around 3.9 per cent of GDP (Australian Bureau of Statistics, 2006) and in the financial year 2006-07, tourism consumption through the Australian economy amounted to a total of $84.975 billion (Australian Bureau of Statistics, 2008). This centrality of tourism was also addressed by Fürsich and Kavoori's (2001) call for an examination of the relationship between tourism and the media. They noted five reasons why travel journalism needs to be studied more deeply: a) the boom of the tourism industry, b) tourism and its impact remains under-studied, c) leisure is a significant social practice, d) travel journalism is an important site for international communication research and e) travel journalism has special contingencies as it is a highlycharged discourse strongly affected by public relations. In addition, international communication scholar Hamid Mowlana (1997) criticised tourism research for concentrating too much on financial and economic concerns, while neglecting social issues related to the industry. While there has been considerable increase in sociological and anthropological approaches to the field as noted by Fürsich and Kavoori (2001), I will argue that despite their call for communication scholars to examine contemporary practices of travel journalism, there has still been relatively little in the way of approaches from communication studies, let alone journalism studies. Importantly, the studies that do exist, were conducted in relative isolation, almost haphazardly. This paper will review these existing studies by way of their approaches within a journalism studies context, ie. whether they examined producers of travel journalism, travel journalistic output, or whether they were concerned with its reception by the audience. Producers of travel journalism To the best of my knowledge there exists no systematic, representative study or analysis of travel journalists. This is a curious occurrence, as we do possess considerable knowledge of journalist profiles at large, with a number of studies even making international comparisons (see, for example, Weaver et al., 2007; Weischenberg et al., 2006; Weaver, 1998; Deuze, ANZCA09 : Refereed Proceedings: http://anzca09.org Communication, Creativity and Global Citizenship 2002; Donsbach and Patterson, 2004). Some of the studies, such as Weischenberg et al.'s (2006) representative survey of German journalists, did include travel journalists in their survey, however, the survey was designed to take account of wider journalistic characteristics and did not examine the special contingencies of travel journalism separately. There has been one qualitative study in the form of a Masters' degree thesis which concerns itself with German travel journalists, and which can help provide somewhat of a starting point for future investigations. In interviews with a small number of purposively selected travel journalists, Lischke (2007) arrived at four classifications, or types, of travel journalists. She argued journalists could be seen as "story-tellers", who are typical quality newspaper journalists writing on a high level and trying to be critical; "discoverers", who write mostly for general interest magazines to special travel magazines, who want to have fun on their travels and pass that on to readers; "do-gooders" who are independent and want to inform about other cultures and countries; and "service-providers" who see themselves as neutral providers of information and who mostly work for regional newspapers and don't actually travel much themselves. Importantly, Lischke noted that the lines between these categories were blurred at times, and journalists could possess more than one characteristic. While useful as a starting point for future examinations of travel journalists, Lischke's exploratory study was somewhat limited in that she interviewed only a small number of journalists (12), which did not allow for more standardised comparisons. In addition to this relatively small study, our only knowledge about travel journalists' views stems from travel practitioners who have written about their experience and the industry they work in (Austin, 1999; Eliot, 1994; Swick, 1997, 2001; Thompson, 2007). Dominant in most of these accounts has been the everlasting dispute over whether travel journalists or their publications should accept free travel, and if they did whether they should disclose this information. Most travel journalists realise that free travel or accommodation is necessary for them to do their job, but they believe they are not necessarily influenced by this as much as some might think. American travel journalist Elizabeth Austin (1999: 10) says that while it may be true "the writers of most junket-based pieces generally sing the praises of their hosts' accommodations, let's face it: Travel publications celebrate travel". She argues that stories which were paid for by the publisher themselves may even be more biased as, after all, the publisher wants an outcome for their expense. Austin further notes that many so-called "paidfor" trips have actually been purchased at large discounts. Alexander Eliot (1994: 56) also argues that travel sponsors never overtly ask for positive coverage: "Never was I asked to soften or sweeten anything I wrote, nor did any sponsor ask me for special treatment". While this agrees with Lischke's (2007) findings in her study of travel journalists, we need to ANZCA09 Communication, Creativity and Global Citizenship: Refereed Proceedings: http://anzca09.org differentiate here between overt pressure and covert pressure, or perhaps a feeling of obligation, because receiving a free trip and luxury accommodation may arguably lead a journalist to be purely positive, if only so that they may be asked back on another trip or the sponsor doesn't pull their advertising. Finding that articles which carried a disclosure contained more in-text advertising than those which didn't, Hill-James (2006: 163) even asked whether sponsor disclosure was really "openness with the audience or an ethical 'out' for journalists to provide publicity to sponsors and continue to receive 'freebies'". As we can see then, there exists very little in the way of systematic, scientific inquiry into travel journalists' values, attitudes, standards and perceptions as well as how these journalists see their role in an environment that is, perhaps more so than any other form of journalism, trapped between traditional journalistic ideals of objectivity and independence on the one hand, and the publicity expectations of tourism providers – who often finance their travels – on the other. This lack of inquiry has left us with numerous unanswered questions about the production of travel journalism content. As the next sections will show, it is generally acknowledged that media representations can have a relatively strong effect on destination images in tourists, yet very few studies have actually examined how these images are produced. Travel Journalism Content While there does exist a reasonably large body of work under the umbrella "media representations and tourism", many such studies are concerned not with news media but media such as movies, government websites and other promotional material or even tourists' use of media such as mobile phones and postcards (see for example Ateljevic and Doorne, 2002; Buchmann, 2006; Crouch et al, 2005; Dann, 2001; Fürsich and Robins, 2004; Mellinger, 1994; Selwyn, 1996). Nevertheless, the amount of research that does examine specifically travel writing or travel journalism content exceeds that of the other two areas discussed in this paper. Travel editor Thomas Swick (2001) lists seven things he thinks are wrong with travel journalism and which resonate with many of the studies cited below: 1) he believes that almost nothing is negative in travel stories, there are only positive descriptions; 2) the present is missing, stories always focus on historical aspects of the destination; 3) stories are unimaginative and too descriptive; 4) there is very little real insight; 5) stories contain very little humour; 6) they lack dialogue; and 7) people other than the writers themselves are missing in these stories. A number of Swick's concerns have been addressed in the studies that do exist, but most studies of the representation of tourism in travel journalism have been concerned with discourse analyses in order to examine how "the Other" is constructed in these tales. Very few studies have aimed to quantitatively analyse the content of travel media such as newspaper supplements. Hill-James (2006) analysed the content of three Australian newspapers' travel supplements and found, in line with anecdotal evidence as well as statements by travel journalists, that a significant amount of articles contained advertising within the text. HillJames, arguing that travel journalists needed to engage with the world and interpret it, called for travel journalists to provide readers with more interpretive accounts of destinations, rather than the uncritical trailblazing for tourist authorities that was so common in much of travel journalism. Hill-James further found that stories largely ignored locals at the destination, a finding which resonates with Hanefors and Mossberg's (2002) finding of a marginalisation of "the other" in their examination of Swedish TV travel shows. They found that travel shows were first and foremost about the presenter, not the locals at the destination. "When anyone from the destination's population actually appears, he or she is involved in the tourism industry and, if not, seems to act as a sort of silent marker, as if to lend authenticity" (Hanefors and Mossberg, 2002: 243). Incidentally, the authors also acknowledged – in line with the argument presented above – that there was an urgent need for more examination into the production side of travel journalism in order to find out why certain decisions were taken. Santos (2006), in her textual analysis of American travel writing, has also been concerned with representations of "the Other". She argued that what was regarded the best travel writing was predominantly about authors' experiences, with frequent comparisons between host and American societies, as well as patriarchal discourses: "Editorial choices for the 'best' American travel writing suggest that the most relevant and paramount stories for these particular American readers are those which provide them with reassurance regarding their own ways of living by helping them make sense of the world and their place in it" (Santos, 2006: 639). In a similar vein, Mahmood (2005) found that programs broadcast on the Travel Channel focussed primarily on the United States and Europe in their destinations, neglecting other parts of the world. In addition, Mahmood (2005: np) argues that the vast majority of programs placed "extensive focus on consumerism while almost entirely ignoring issues of culture". That meant that programs advocated "conscious over-indulgence, including the purchasing of ultra-expensive items" (Mahmood, 2005: np). In a more novel approach, Pan and Ryan (2007) analysed the framing of New Zealand in travelogues published in that country's major tourist source countries, and argued that there existed differences in the way in which male and female journalists followed certain frames differently in their reporting. Applying gender research, which has found an increasingly strong foothold in journalism and communication research, to the practice of travel journalism can certainly provide an interesting approach and component for future studies. Audience reception of travel journalism Many of the above studies of travel journalism content which were conducted within critical and cultural studies paradigms have been also concerned with the effect travel stories might have on audiences, however, few have empirically examined how audiences do react to such stories or how they might be negotiated from a communication studies perspective. In fact, most of the literature examining how tourists perceive travel literature stems from the area of tourism studies and is concerned largely with how destination images are formed among tourists (for example, Baloglu and McCleary, 1999; Beerli and Martin, 2004; Echtner and Ritchie, 2003; Gallarza, Saura and Garcia, 2002; Gartner, 1993; Gunn, 1988; Jenkins, 1999; Tasci and Gartner, 2007) Gunn (1988) talks about the first phase of the development of a destination image being the organic image, which is based on sources from outside the tourism industry, such as general news media reports but also movies and books, education and peer groups. This phase is then followed by the so-called induced image, which includes more commercial sources such as travel brochures, travel agents and guidebooks. Echtner and Ritchie (2003: 38-39) note that while the general media does not appear to have much influence on tourists' images of certain products, "destination images however seem to be derived from a much wider spectrum of information sources". Travel journalism, which is neither as independent or neutral as news reports can be, nor can it be classed as purely commercial, would probably be situated across these two types of image formation. In fact, Gartner (1993) differentiates further between the various information sources which might impact on image formation, coming up with eight classifications. News reports are classed as autonomous image formation agents, and are often seen as more powerful agents due to their higher level of credibility. Travel journalism, on the other hand, would fall into the category of covert-induced, which means information that is influenced by marketers but to the audience appears independent. This would mean that travel journalism might play an important role in the image formation stage, influencing at least those audience members who may not have heard about the destination before, or know very little about it. As tourists progress through the decisionmaking stage, they would arguably receive more information from a wider variety of sources, thus relegating the importance of one particular travel story. Nevertheless, first impressions often have lasting effects, and it would at least appear very important to research the impact that travel stories might have. Beerli and Martin (2004), in their empirical study of tourists' destination image of Lanzarote, found that indeed organic and autonomous sources significantly influenced some aspects of destination image, and called for closer collaboration from destination management organisations with the media. Further, Loda and Carrick Coleman (2005: 368) noted that the most effective way to market tourism was to generate publicity messages before advertising, as they were generally given more credibility by consumers: "publicity followed by advertising yields more potent levels of message acceptance and message response". However, they noted that there had been very little actual research in this field so far, highlighting the need for further research here. Dore and Crouch (2003) also identified this need arguing that marketing management practices had focused mainly on destination image studies, marketing strategy, conversion studies and advertising research, while neglecting the use of publicity. This was despite some destination management organisations "receiving greater annual values (as measured in terms of equivalent commercial advertising expenditure) from their publicity programmes than from their entire annual budgets" (Dore and Crouch, 2003: 137). One case in point here is Tourism Queensland's recent marketing campaign around "The best Job in the World", which, has returned an estimated $100 million in publicity and promotion, for the advertisement cost of a mere $1.7 million (Koch, 2009). One example of how media can impact on tourists' perception of a destination can be found in Mercille's (2005) study of the destination image of Tibet. He found a relatively strong influence of mass media images on what tourists expected when they visited the country for the first time. Mercille (2005: 1051) noted that "most tourists' gaze did not include signs of modernisation and Sinification, since it had been constructed by representations which did not include those signs". However, Mercille examined only the influence of movies, books and magazines rather than specifically news media let alone travel journalism content. As pointed out before, the vast majority of the above research has been undertaken from a tourism studies perspective, and mostly with the background of enabling destination ANZCA09 Communication, Creativity and Global Citizenship: Refereed Proceedings: http://anzca09.org management organisations to better target their marketing efforts. More research from an angle of how audiences negotiate these images they receive is desperately needed. In what may constitute the only study in this regard, Santos (2004) examined university students' perceptions and interpretations of leisure travel articles. She found that above all, tourists negotiated meanings of travel stories for themselves and constructed their own meaning from them and argued that rather than seeing audiences as passive receivers of structured messages, they needed to be seen as active participants. More work in this field is clearly required in order to make better sense of how audiences receive certain messages and how they negotiate them. Conclusion Eight years ago Fürsich and Kavoori (2001) called for a comprehensive analysis of travel journalism as they saw it as an increasingly important field of communication and journalism studies. Yet, as we can see from the above review, very little has happened since then. The few studies that do examine travel journalism from a communication or journalism studies perspective have often been conducted in isolation, only addressing parts of the equation. Urgent action is needed if we want to take travel journalism as a field of scientific inquiry seriously. This begins with the simple definition of what a travel journalist is. Fürsich and Kavoori (2001) base their definition on Hartley's (1996) notion that journalism purports to be true, which enables them to differentiate travel journalists from travel writers, as the latter often blur fiction and non-fiction in their accounts. This definition, which also is able to include any medium, be it TV travel shows, newspaper travel sections, travel magazines or travel websites, provides us with a very good starting point, but perhaps future studies will be able to differentiate even further, or even categorise here. After all travel journalists come from various backgrounds with various working arrangements – from permanent full-time employees, to part-timers, to freelancers, even to the celebrity (or housewife for that matter) who writes a one-off feature. To do so, empirical studies to ascertain who these producers of travel content in the mass media actually are is sorely needed. Lischke (2007) has provided some starting points, but future research needs to test and expand some of her findings. Santos (2004) has argued travel writers play an important role as cultural intermediators, and as such we need to know more about their role perceptions, values, ethics, attitudes and standards. This can even be of benefit to the tourism industry, as it may allow destination management organisations to more effectively target their publicity programs. Similarly, more in-depth analyses of the actual content which travel journalists produce is needed. This needs to occur from a variety of approaches, and should include quantitative as well as qualitative research. Fürsich and Kavoori (2001) have suggested a number of ways to examine textual representations, with combinations of approaches coming from areas such as postmodernism, nationalism, cultural imperialism and ideology and identity formation. Again, these are all important suggestions which need to be actioned in order to find out more about the role travel journalism can play. Other approaches could include quantitative analyses of which countries are most-represented in travel content or how journalists' views on certain issues are actually reflected – or not reflected – in the content they produce, or whether stories really are predominantly information- or entertainment-driven. Similarly, Mahmood (2005) found strong emphases on consumerism and high-priced items, it would be interesting to examine empirically what the average cost of featured trips is and to compare it with average incomes or average tourist expenditures. In the area of reception analysis, efforts should be undertaken to isolate travel journalism content and examine its effect on audiences. Santos' (2004) study should provide very helpful guidance here as well. Scholars need to conduct more research to validate her findings, as well as expand on theoretical frameworks. We need to find out just how strong the influence of travel journalism content can be on audiences, as well as, for example, whether it makes a difference if stories are sponsored or not. Rieder (2000) cited internal research from a US newspaper which found that readers gave no credibility to sponsored travel stories – leading that newspaper to ban all such stories. More empirical evidence should be gathered in this regard. The vast majority of existing studies have been conducted from a critical and cultural studies perspective, and this approach can be highly useful. However, I would argue that, particularly because we have very little empirical information so far to base some of these arguments on, it is equally important to conduct serious quantitative studies as well. Perhaps even more importantly, scholars will need to conduct comparative and inter-disciplinary studies, necessitated by the very nature of travel journalism spanning the disciplines of communication/journalism, advertising/marketing and business/tourism. Inter-disciplinary studies which are able to take advantage of, for example, tourism studies' knowledge of destination image will benefit immensely here. Similarly, much of travel writing is about crossing borders, and as such includes international perspectives which need to be taken account of. With journalism increasingly focussing away from hard-news to soft-news, it is high time we, as communication and journalism scholars, take these emerging forms of journalism seriously, and do not just see them, in the words of Fürsich and Kavoori (2001: 154), as "trivial cultural celebration". References Ateljevic, I., & Doorne, S. (2002). Representing New Zealand: Tourism imagery and ideology. Annals of Tourism Research, 29(3), 648-667. Austin, E. (1999). All expenses paid: Exploring the ethical swamp of travel writing. The Washington Monthly, 31(7/8), 8-11. Australian Bureau of Statistics. (2006). Australian Economic Indicators - Tourism. Retrieved 31 January, 2009, from www.abs.gov.au Australian Bureau of Statistics. (2008). Australian National Accounts: Tourism Satellite Account, 2006-07. Retrieved 31 January, 2009, from www.abs.gov.au Bacon, W. (1999). What is a journalist in a university? Media International Australia, 90, 7990. Baloglu, S., & McCleary, K. W. (1999). A model of destination image formation. Annals of Tourism Research, 26(4), 868-897. Beerli, A., & Martín, J. D. (2004). Factors influencing destination image. Annals of Tourism Research, 31(3), 657-681. Buchmann, A. (2006). From Erewhon to Edoras: Tourism and myths in New Zealand. Tourism, Culture and Communication, 6, 181-189. Crouch, D., Jackson, R., & Thompson, F. (Eds.). (2005). The media and the tourist imagination: converging cultures. London: Routledge. Dann, G. S. (2001). The self-admitted use of cliche in the language of tourism. Tourism, Culture and Communication, 3, 1-14. Deuze, M. (2002). National News Cultures: A comparison of Dutch, German, British, Australian, and U.S. journalists. Journalism and Mass Communication Quarterly, 79(1), 134149. Donsbach, W., & Patterson, T. E. (2004). Political news journalists: Partisanship, professionalism, and political roles in five countries. In F. Esser & B. Pfetsch (Eds.), Comparing political communication: Theories, case and challenges (pp. 251-270). New York: Cambridge University Press. Dore, L., & Crouch, G. I. (2003). Promoting destinations: An exploratory study of publicity programmes used by national tourism organisations. Journal of Vacation Marketing, 9, 137151. Echtner, C. M., & Ritchie, J. R. B. (2003). The meaning and measurement of destination image. The Journal of Tourism Studies, 14(1), 37-48. Eliot, A. (1994). A cure for skepticism about travel journalism. Editor & Publisher, 127(46), 56. Fürsich, E., & Kavoori, A. P. (2001). Mapping a critical framework for the study of travel journalism. International Journal of Cultural Studies, 4(2), 149-171. Fürsich, E., & Robins, M. B. (2004). Visiting Africa: Constructions of nation and identity on travel websites. Journal of Asian and African Studies, 39(1-2), 133-152. Gallarza, M. G., Saura, I. G., & García, H. C. (2002). Destination image: Towards a Conceptual Framework. Annals of Tourism Research, 29(1), 56-78. Gartner, W. (1993). Image Formation Process. Journal of Travel and Tourism Marketing, 2(2/3), 191-215. Hanefors, M., & Mossberg, L. (2002). TV travel shows - a pre-taste of the destination. Journal of Vacation Marketing, 8(3), 235-246. Hartley, J. (1996). Popular Reality: Journalism, Modernity, Popular Culture. London: Arnold. Hill-James, C. R. (2006). Citizen Tourist: newspaper travel journalism's responsibility to its audience. Unpublished MA thesis, Queensland University of Technology, Brisbane. ANZCA09 Communication, Creativity and Global Citizenship: Refereed Proceedings: http://anzca09.org Jenkins, O. H. (1999). Understanding and measuring tourist destination images. International Journal of Tourism Research, 1(1), 1-15. Koch, T. (2009). Daring Brit lands 'world's best job' on Hamilton Island. The Australian, May 7, 6. Lischke, J. (2007). Geschichtenerzähler, Entdecker, Weltverbesserer? Columbus - Magazin der Vereinigung deutscher Reisejournalisten, I/2007, 53-55. Loda, M. D., & Carrick Coleman, B. (2005). Sequence matters: A more effective way to use advertising and publicity. Journal of Advertising Research(December), 362-372. Mahmood, R. (2005). Travelling away from culture: The dominance of consumerism on the Travel Channel. Global Media Journal, 4(6). Mellinger, W. (1994). Towards a critical analysis of tourism representations. Annals of Tourism Research, 21, 756-799. Mercille, J. (2005). Media effects on image: The case of Tibet. Annals of Tourism Research, 32(4), 1039-1055. Mowlana, H. (1997). Global information and world communication (Vol. 2nd). London: Sage. Pan, S., & Ryan, C. (2007). Gender, Framing and Travelogues. Journal of Travel Research, 45, 464-474. Rieder, R. (2000). Called for travelling. American Journalism Review, 22(10), 6. Santos, C. A. (2004). Perception and Interpretation of Leisure Travel Articles. Leisure Sciences, 26, 393-410. Santos, C. A. (2006). Cultural politics in contemporary travel writing. Annals of Tourism Research, 33(3), 624-644. Selwyn, T. (Ed.). (1996). The tourist image: Myths and myth making in tourism. Chichester: John Wiley & Sons. Stamou, A. G., & Paraskevopoulos, S. (2006). Representing protected areas: a critical discourse analysis of tourism destination building in a Greek travel magazine. International Journal of Tourism Research, 8, 431-449. ANZCA09 : Refereed Proceedings: http://anzca09.org Communication, Creativity and Global Citizenship Swick, T. (1997). On the road without a Pulitzer. The American Scholar, 66(3), 423-429. Swick, T. (2001). The travel section: Roads not taken. Columbia Journalism Review, May/June. Tasci, A. D. A., & Gartner, W. C. (2007). Destination image and its functional relationships. Journal of Travel Research, 45(4), 413-425. Thompson, C. (2007). Smile when you're lying: Confessions of a rogue travel writer. New York: Henry Holt. Weaver, D. H. (1998). The global journalist: News people around the world. Cresskill: Hampton Press. Weaver, D. H., Randall, A. B., Brownlee, B. J., Voakes, P., & Wilhoit, G. C. (2007). The American Journalist in the 21st century: U.S. news people at the dawn of a new millennium. Mahwah: Lawrence Erlbaum. Weischenberg, S., Scholl, A., & Malik, A. (2006). Souffleure der Mediengesellschaft: Report über die Journalisten in Deutschland. Kosntanz: UVK. World Tourism Organisation. (2004). Tourism and the World Economy. Retrieved 31 January, 2009, from http://www.unwto.org/facts/eng/economy.htm	<urn:uuid:4b1805c4-141d-4bb1-a3d8-15d7dee45f4e>	CC-MAIN-2023-50	https://core.ac.uk/download/pdf/33492584.pdf	2023-12-01T17:47:28+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00041-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	220,158,709	7,519	eng_Latn	eng_Latn	0.921056	eng_Latn	0.996219	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 774, 3119, 6169, 9070, 12346, 15046, 17804, 20625, 23631, 26408, 29219, 30814, 32795, 34650, 35686 ]
This drawing is the property of Bradley Murphy Design Ltd. Copyright is reserved by them and the drawing is issued on the condition that it is not copied, reproduced, retained nor disclosed in any way without the express written authority or in part without the consent of Bradley Murphy Design Ltd. NOTES: 1. THIS DRAWING IS BASED ON: BMD.20.044.DR.P.001 OVERALL GENERAL ARRANGEMENT. 2. THIS DRAWING SHALL BE READ IN CONJUNCTION WITH ALL OTHER LANDSCAPE DRAWINGS AND DOCUMENTS. 3. SEE BMD.20.044.DR.P.001 FOR DETAIL. 4. DO NOT SCALE FROM THIS DRAWING. 5. ANY DISCREPANCY BETWEEN THIS DRAWINGS OR BETWEEN THIS DRAWING AND ANY OTHER INFORMATION IS TO BE REPORTED TO BMD FOR CLARIFICATION. LOCATION PLAN (NTS) SECTION C-402 SCALE - 1:100 SECTION D-402 SCALE - 1:100 A UPDATED TO LATEST LAYOUT 14.12.20 Rev Description Date Purpose of Issue PLANNING Bradley Murphy Design Ltd 6 The Courtyard Hatfield Technology Park Dark Lane Hatfield Hertfordshire CV38 8XB t: 01928 678496 e: [email protected] www.bradleymurphydesign.co.uk Client HG GROUP Project BROADWATER GARDEN, WELWYN GARDEN CITY Drawing Title LANDSCAPE SECTIONS (SHEET 2 OF 3) \| Drawn \| Checked \| Approved \| Date \| \|-------\|---------\|----------\|------\| \| RR \| MP \| RW \| 04/12/2020 \| Job No. 20.044 Scale 1:100 Sheet Size A1 Revision A Drawing Number BMD.20.044.DR.402	7871e11f-5af7-49c4-a4b1-8d9d82242081	CC-MAIN-2021-49	https://planning.welhat.gov.uk/Document/Download?module=PLA&recordNumber=96399&planId=349639&imageId=359639&isPlan=True&fileName=BMD.20.044.DR.P402A%20Detailed%20Sections%20%28Sheet%202%20of%203%29.pdf	2021-11-29T05:59:32+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2021-49/subset=warc/part-00026-eb7089cf-762b-4a3e-8cab-20b677c0d246.c000.gz.parquet	497,056,098	404	eng_Latn	eng_Latn	0.78614	eng_Latn	0.78614	[ "eng_Latn" ]	true	docling	[ 1362 ]
The Open Nursing Journal Content list available at: www.benthamopen.com/TONURSJ/ DOI: 10.2174/1874434601711010043 RESEARCH ARTICLE Patients´ Variations of Reflection About and Understanding of LongTerm Illness- Impact of Illness Perception on Trust in Oneself or Others Håkan Nunstedt, Gudrun Rudolfsson, Pia Alsen and Sandra Pennbrant University West, Department of Health Sciences, Trollhattan, Sweden Received: December 28, 2016 Revised: February 19, 2017 Abstract: Background: Patients' understanding of their illness is of great importance for recovery. Lacking understanding of the illness is linked with the patients' level of reflection about and interest in understanding their illness. Objective: To describe patients' variations of reflection about and understanding of their illness and how this understanding affects their trust in themselves or others. Method: The study is based on the "Illness perception" model. Latent content analysis was used for the data analysis. Individual, semistructured, open-ended and face-to-face interviews were conducted with patients (n=11) suffering from a long-term illness diagnosed at least six months prior to the interview. Data collection took place in the three primary healthcare centres treating the participants. Results: The results show variations in the degree of reflection about illness. Patients search for deeper understanding of the illness for causal explanations, compare different perspectives for preventing complication of their illness, trust healthcare providers, and develop own strategies to manage life. Conclusion: Whereas some patients search for deeper understanding of their illness, other patients are less reflective and feel they can manage the illness without further understanding. Patients' understanding of their illness is related to their degree of trust in themselves or others. Patients whose illness poses an existential threat are more likely to reflect more about their illness and what treatment methods are available. Keywords: Illness perception, Knowledge, Learning, Primary healthcare, Reflection, Understanding. INTRODUCTION The patient's needs for knowledge and understanding about their illness are of great importance for the patient's selfcare and recovery process [1 - 3]. The understanding the patient has about their illness may also be an important prerequisite for adherence and participation. Depending on what diagnosis the patient has, the patient's desire to know more about their illness varies. One study found that almost a quarter of the patients had received insufficient Address correspondence to this author at the University West, Department of Health Sciences, Gustava Melins Gate 2, S-461 32 Trollhattan, Sweden; Tel: +46520 223936; E-mail: [email protected] Accepted: February 20, 2017 information about their illness, self-care methods and the significance of the medication [4]. Patients often have insufficient knowledge of disease processes; want to know more about the course of their illness, and show great variations in the need for knowledge; which is at its greatest immediately following diagnosis and during relapse [5, 6]. Studies also show that patients do not understand the illness despite receiving information from and being in close contact with a specialist [7]. Several studies have underlined the importance of providing individualised information adapted to the patient's age and ability to understand [8 - 11]. Doing so can be crucial for how patients perceive, accept and understand their illness when receiving their medical diagnosis. One should encourage patients to be well-informed and to act proactively with the support of their healthcare actors [12]. Perception of One's Own Illness There is a difference between the patient's perception of their illness and the medical expression of this perception. The difference is often described in terms of illness versus disease, where 'illness' is the patient's feeling and experience of illness and 'disease' is the medical diagnosis and explanation of the illness. The distinction between illness and disease is a theoretical model which does not necessarily reflect the care and the complexity of the meeting between the patient and the healthcare provider. The patient's self-perceived state of health (illness) and the medical explanation of the disorder (disease) should be considered as a whole as the understanding of the one influences the understanding of the other [13]. Patients often interpret their experiences of bodily changes in terms of medical explanations even before they consult a doctor. According to Leventhal et al. [14], an individual's perception of factors related to their illness or symptoms influence their coping behavior. Moreover, a patient's illness perception is not static; it changes over time depending on contextual, cultural and relationship factors [15]. Illness experiences and perceptions are culturally shaped by the way the person has learned to act and think [13] and the meaning of the symptoms and illness varies depending on the patient's ethnic and cultural background [16]. Furthermore, a person's culturally determined beliefs about the cause of the illness will influence their health-related behavior [17]. Illness experiences and perceptions are also connected with biopsychosocial processes which affect the patient's ability to perceive and understand illness symptoms and to take effective action to improve their health [18]. To understand the patient's illness perception is central to healthcare providers in order to evaluate and support the patient's individual understanding of their illness and to support the patient's empowerment and self-care ability. This requires that healthcare providers see the patient's understanding of their illness as a basic and necessary resource in the care [19]. Although patients often search the Internet for information about their symptoms or illness, such 'objective' information does not always coincide with their individual understanding of the symptoms or illness. In these situations, it is important for healthcare providers to use the patient's illness perception as an additional resource when helping the patient create their individual illness perception [20]. The patient's perceptions of their health and illness are based on their individual life-world perspective. A person's 'life-world' consists of, among other things, their memories, everyday experiences, and expectations for the future. This means that one cannot draw an objective picture of the patient; instead one must focus on the patient's world as they actually perceive and live it [21]. The patient's illness perspective represents their attitudes, beliefs, experiences and perceptions of what it means to be a person with an illness in a particular context. A patient's social circumstances and the consequences of the diagnosis on their personal sphere affect how they perceive and react to the illness [13]. The patient's understanding of their illness is therefore an important factor for the planning of meaningful healthcare [8]. Illness Perception Model The illness perception model [22] illustrates how patients' illness reasoning differs in relation to the degree of trust they place in their own judgment (trust in oneself) or in other people (trust in others). Trust in oneself refers to patients who have trust in themselves and believe that they can control their illness and prevent it from becoming worse. These patients are more involved in their own healthcare, search information about their illness, and can self-manage their lives. Trust in others refers to patients who place their trust in the ability and judgment of others and have less confidence in their own ability to control the illness. These patients do not actively search more information about the illness, are less motivated to improve their own health situation, and need more help from others, such as healthcare providers and relatives. Illness reasoning comprises three dimensions with variations in terms of the patient's reflection about their illness. Patients thinking in personal terms reflect more carefully and deeply about their illness; they want deeper understanding of the illness and search for causal explanations. Patients reflecting and thinking in general terms think more about the possible underlying causes and impact of their illness; they think in terms of preventing complications and are satisfied with a more general and not particularly detailed understanding of their situation. Some patients are less reflective and have no particular thoughts about their illness; their thoughts are more superficial and sporadic, especially when the illness symptoms do not affect them, and their ideas are more predetermined and difficult to influence [22]. In their study of the illness perception of myocardial infarction patients, Alsén et al. [22] identified six variations of illness perceptions (Fig. 1). Fig. (1). Conceptual model describing variations in illness perception related to the illness reasoning of myocardial infarction patients (Alsén et al., 2008). Aim The aim of the study was to describe patients' variations of reflection about and understanding of their illness and how this understanding affects their trust in themselves or others. MATERIAL AND METHODS Design A qualitative design was used to describe patients' variations of reflection about and understanding of their illness and how this understanding affects their trust in themselves or others. The study was based on individual interviews using latent content analysis [23, 24]. This qualitative design allows to study and understand a person's subjective understanding, thoughts, processes and experiences by allowing the person to express them in their own words. This type of design is appropriate when existing research on a phenomenon is limited [25], which is why the researchers found it promising for gaining insight into patients' reflection about and understanding of their illness. Participants The participants were patients (N=11) suffering from a long-term illness that had been diagnosed at least six months prior to the time of the interview. The patients' diagnoses concerned one or more of the following conditions: arthrosis, atrial fibrillation, chronic pain, hypertension, hyperthyroidism, obstructive lung disease and type 2 diabetes. The interview inclusion criteria were: the patient must be at least 18 years of age, be capable of speaking and understanding Swedish, and have received treatment in primary healthcare for at least six months. The patients' sociodemographic variables are shown in Table 1. Table 1. Sociodemographic characteristics of the participants (N=11). (Table 1) contd..... Data Collection The participants were selected by healthcare providers at three primary healthcare centres in western Sweden. The healthcare professionals informed their patients about the study's purpose and invited them to take part in it. Consenting patients were contacted by telephone, either by the healthcare professional or by an interviewer, to schedule a time for the interview. Data collection took place from June 2013 to March 2014 through individual face-to-face interviews held in the three primary healthcare centres where the participants were being treated. The interview questions were semistructured and open-ended, and the interview guide called for interviewers to ask additional questions depending on the respondents' answers. The questions asked concerned, for instance, what understanding the respondents had about their illness, if they thought it was important for them to have understanding of their illness, or if they wanted better understanding of their illness. The interviews lasted between 28 and 75 minutes (mean 47 minutes). Ethical Considerations Approval for the study was obtained from the Regional Board of Ethics at the University of Gothenburg (Dnr 873-12). Participating patients were told that participation was entirely voluntary, and that they were free to withdraw, with no reason required, from the interview and the study at their leisure. Each patient provided written informed consent before the interview was carried out. Data Analysis The data were initially analysed inductively to identify variations of reflection about and understanding of long-term illness. The data were then sorted deductively and placed in the Illness reasoning model. The interview texts were analysed by means of qualitative content analysis using the latent variables interpreted from the text as the basis of the analysis [23, 24]. Initially, the entire recorded interview text was read repeatedly to achieve an overall understanding. In the next step, the individual texts were broken down according to their meaning-bearing units relating to the study's aim. The identified meaning units were condensed to their most significant parts. The underlying messages of the condensed meaning units were then interpreted and coded. The codes were continually adjusted to make the inductive process more rigorous [25]. The patterns found during the analysis and the coded units were sorted and subthemes were identified, which were categorised together into three main themes describing the latent meaning of the overt statements [23, 24, 25]. The transcribed interviews were reviewed by all of the researchers. After nine interviews had been conducted, the researchers together assessed whether or not the data was saturated in relation to the study's aim. Following this first assessment, two additional interviews were conducted and a second data saturation assessment was conducted and concluded that no further interviews were needed. According to Cooper and Endicott [26] between five and eight participants is usually sufficient to achieve data saturation. After the last two interviews, the researchers concluded that the material was rich in qualitative statements and corresponded to the study's aim, and that further interviews were unlikely to add any major patterns or variations to the gathered material. Table 2 provides a description of the implemented analysis process. Trustworthiness Trustworthiness can be defined as credibility, dependability, confirmability and transferability. When evaluating qualitative data, these issues must be considered [27]. In this study, credibility [25] was achieved by carrying out individual interviews choosing participants from various healthcare centres and with various illness problems and by letting participants describe how they understand their illness and how it affected their management of life. To provide a broader picture of the problem, participants with several illnesses and with rich experiences of their illness were included in the study. Credibility [28] was also achieved by conducting individual interviews in which the participants described how they understood their illness. The procedure for data analysis and creation of themes and subthemes has been described above. The analysis process was characterised by critical review by all researchers. The researchers also read all of the interviews and jointly defined the themes and subthemes to ensure the study's dependability. Confirmability [28] was achieved in the course of the analytical process by comparing the codes and subthemes with the interviews throughout the analytical process. Confirmability was also strengthened by relating our results to earlier research and by deductively sorting and placing the result in the Illness reasoning model. The unique answers of the participants and the inductive process sustain the study's confirmability. Furthermore, to meet the requirements for peer debriefing [27], in the course of the analytical process, the authors read the interviews, checking the coding of the condensed meaning units, and jointly discussed both the analysis and the results. For the sake of trustworthiness, clear descriptions of the interviewed patients' backgrounds and of the method for finding and condensing meaning units have been provided. Furthermore, examples from the interviews have been presented so that readers may judge whether this study's findings can be transferred to other settings. Table 2. Example of analysis process with sub-themes and themes. RESULTS The study participants ranged in age from 49 to 81 and were suffering from a long-term illness that had been diagnosed at least six months prior to the time of the interview. Themes and subthemes describe patients' variations of reflection about and understanding of their long-term illness. Three themes with subthemes were identified: patients actively seek knowledge of the illness for causal explanations, patients compare different perspectives to get knowledge for preventing complication of their illness and patients have trust in healthcare providers' knowledge and develop strategies to manage life. Patients Actively Seek Knowledge of the Illness for Causal Explanations When the first symptoms appeared and before the illness was diagnosed, patients tried to find out what had caused the illness and search for explanations for deeper understanding. Subsequently, despite having been informed by healthcare providers about the illness, the patients felt an additional need for deeper understanding about the illness and therefore continued to search on their own. Patients Search for Deeper Understanding About Their Illness Through Various Sources of Information Following receipt of a diagnosis and information about it, patients felt a need for more understanding of their illness. Patients therefore searched the Internet using the diagnostic name as a search keyword. Patients also searched in other sources such as magazines, brochures or, in some cases, research articles that dealt with their own illness. I've been online and read some articles … about various benchmarks and stuff … I tend to be well-read and always ask about my [test] values … so I have some control myself. Some patients were particularly active and searched the Internet for their first signs and for different possible diagnoses. Sometimes, the patient's first Internet search led to the worst possible cause of explanation for their illness. I didn't want to speculate about something I knew nothing about … One tends to think of the worst-case scenario … So I thought I should do an Internet search. Patients Try to Understand the Relationship Between Root Cause, Trigger Factor and Present State Patients felt a need to understand the connection between the root cause of their illness, its triggering factor, and their present state of health. Patients combined a clearly stated belief about what caused their illness with an active search to identify the root cause. In some cases, patients linked their signs of illness with a diagnosis and presented their thoughts during their medical consultations. Patients also asked relatives whether or not the family had a history of the possible illness, which in the affirmative could explain the symptoms by reason of possible heredity. It's in my family background. My mother got her joint problems when she was between forty and fifty years old. Sometimes, the patients speculated about the cause triggering the illness. In some cases, the diagnosis received from a healthcare provider came as a relief, as it proved to be less serious than the patient had initially feared. Patients Want Clear Information from Healthcare Providers to Better Understand the Illness The information received from healthcare providers was important for the patient as a support to better understand their illness, especially when the healthcare providers took time to provide more detailed information. Sometimes, healthcare providers did not have time to provide adequate information about the illness or other factors affecting the patient's medical condition. Most of the information that I received came from the physiotherapist. Doctors don't have much time to talk about the illness. They investigate and write out prescriptions. Sometimes, patients received a diagnosis, but no further information about its meaning. Consequently, they wished that healthcare providers would take more time to provide information on a more understandable level. The patients also wanted to have an opportunity to ask questions when they were uncertain about what the healthcare provider had actually said. No one at the healthcare centre described the illness … I can only say that I have type 2 diabetes. Patients Compare Different Perspectives to Get Knowledge for Preventing Complication of Their Illness Patients used different perspectives as references for possible underlying causes of their illness to prevent complications. The sources consisted of data on sampling, drug effects or experiences from people with the same or similar illnesses. Patients Compare Test Results and Reported Medication Effects Without Understanding the Reference Values Patients often compared their test results with reference values or described drug effects, noting that a test value was high or low, but not being capable of relating the value, and its consequences, to their illness situation. They took long-term tests and my results have been 4.9-5 the last three times, which is very low actually. Sometimes, patients described drug effects in line with the healthcare provider predictions, but without really understanding their implication. Similarly, patients often remembered the name of a drug mentioned by the healthcare provider, but had not always understood the meaning of the information provided about the drug. Patients use Experiences and Information from Other Peoples' Illness Situations and Compare them with their own Situation Patients sought experiences from people suffering from the same or similar illnesses and compared the information obtained with their own illness and life situation. One patient had created a website dedicated to the illness and built up a large online social network of people with similar problems. This network served both an informational and a confirmatory purpose as the patient and the website visitors used its discussion forum to share information and comments about healthcare providers, treatments and life situations. We are a group of people who have problems with pain that medications cannot alleviate; we are disabled in the sense that we cannot move about without feeling pain and doctors usually cannot do anything about it. Patients have Trust in Healthcare Providers' Knowledge and Develop Strategies to Manage Life As patients trusted the healthcare providers, and counted on such providers to have the right information needed for treatment and self-care measures, patients developed strategies to deal with their life situation and to endure without needing more understanding of the illness. Patients Accept and Manage Life After receiving a diagnosis of their illness, patients accepted the illness and developed strategies to manage or distance themselves from it in order not to let it affect their lives too much. The strategies enabled them to manage their illness and to have a good life despite its effects. Patients had no need to reflect more about the illness and its manifestations, and fought against the pain and became tougher when positive effects of medication or other treatment failed to occur. If physical therapy doesn't help, then one can try cortisone; if that doesn't work, then one can operate and replace the knee; but I'll keep resisting it for as long as possible. In some cases, the patient was very physically active and refused to be hindered by pain or other symptoms. In some cases, physical activities helped patients temporarily forget their illness and pain. One patient described his reasoning when helping a neighbour with roofing work. It's not that I'm afraid of heights, but I'm stiff and cannot move about freely … It [the roof] is uneven so one has move about in strange ways, making the joints hurt … But this doesn't keep me from doing work on the roof from time to time. Patients did not allow the illness to bother them too much in their daily life and strove to maintain a good quality of life. To this end, patients changed their perspective on the illness, seeing it more as a wound that would heal than as a debilitating condition. In some cases, patients had not received any direct information or instructions about the illness and did not feel any need therefore, as they actually felt quite healthy. Patients Focus on What Works Patients trusted their own strategies for dealing with their problems and lived a good life without feeling a need for more understanding of their illness. Several patients focused on what they knew worked for them considering their individual limitations. Sometimes patients put their illness to the test and challenged their symptoms, like when type 2 diabetes patients intentionally failed to maintain their prescribed diet (either by not eating or by eating sweets), often being surprised that the negative effects were not worse. We ate a good dinner … and then tested our blood glucose level … after the dinner it was only 7.8-something … nothing particularly dangerous to get worked up about … so I took a bun and a cake with the coffee ... a second test showed that the levels had not changed much. Patients have Confidence in Healthcare Providers Patients did not believe that more understanding would make them feel better. Instead, they trusted in the healthcare providers' skills and knowledge of the illness, and in their ability to correctly assess the condition. Sometimes, patients placed themselves completely in the hands of the healthcare providers and even felt that the illness offered them certain benefits. So I'll get a medical examination every year and meet NN [district nurse] once a year, even every six months … they take care of me … without the illness I wouldn't have gone to the healthcare centre. Patients felt that it was essential to have continuity in terms of the healthcare providers met, in order to not have to repeat their medical history over and over again. It was particularly important that the healthcare provider possess expert knowledge of the patient's illness. As soon as something comes up, I contact the doctor and ask what is happening and whether or not it is something to be concerned about. DISCUSSION The results of this study show that patients vary in their degree of reflection about and understanding of their illness and that this reflection and understanding are related to their degree of trust in themselves or in others (see Table 3). There are patients who have a great need for specific and deeper understanding of their illness and there are patients who have a more general rather than detailed need for understanding of their illness. There are also patients who have less need for understanding, who trust in their own ability to self-manage the illness or have confidence in the healthcare providers' expertise. Table 3. The result (themes and sub-themes) in relation to the Illness reasoning model. Some patients search for a deeper understanding of their illness and want detailed answers, ask many questions and want to know the causes of the illness. Such patients want to understand how the illness affects them and they do not simply accept that they had been diagnosed. They also have confidence in their own ability to influence their situation. Some patients try to understand the relationship between the root cause, the triggering factor and the present state when they search for understanding of the illness; these patients have trust in themselves. According to the "Illness perception" model [22], patients who are reflective in personal terms reflect more carefully and deeply about their illness, want to achieve deeper understanding of the illness, and search for causal explanations. Several studies have underlined that a patient's desire for more understanding of their illness is important for the recovery process [1 - 3]. Patients who rather reflect in general terms about their illness compare their test results and the medication effects of their illness without understanding the reference values. However, they have no need to understand the background of, for example, a test result or a blood glucose value, and they show that they have great confidence in the ability of the healthcare staff. They prefer to place their trust in others. The patients think in terms of preventing complications and are satisfied with a more general and not particularly detailed understanding of their situation. Some patients are less reflective, put their trust in others, and thus accept and manage their life. Alsén et al. [22] model shows that patients who want healthcare providers to provide clear information about their illness are reflective in general terms. They do not reflect on deeper causes or effects and are satisfied with a general understanding of their illness situation. They put faith in the knowledge of healthcare providers and do not feel they that can improve their own situation. They do not need detailed information and do not have theories about the origin of their illness. They do not let the illness bother them more than absolutely necessary in their daily life. Dahlberg and Segesten [21] believe that the patient's perception of their health and illness situation is based on their individual life-world perspective. The lifeworld consists of, among other things, the patient's memories, everyday experiences, and expectations for the future. They do not believe that drugs or other therapy can help them and they develop their own strategies to deal with the illness. When patients focus on what works for them they manifest trust in themselves. They test their way forward and find their own strategies to be able to live their life. They therefore do not want to get detailed information about their illness but rather distance themselves from it. These patients are less reflective about their illness; their reflections are more superficial and sporadic, especially when the symptoms do not affect them [22]. They also have more predetermined ideas and are more difficult to influence. They also place great trust in the healthcare providers' expertise [trust in others] and do not feel that they need to find out more on their own. There seems to be a connection between reflection, understanding and how much illness symptoms affect the patient's daily life. For example, high blood pressure does not always show symptoms in everyday life and therefore the patient does not actively search for understanding in the same way as would a patient suffering from, for instance, constant and unbearable pain. Patients whose illness poses an existential threat are more likely to reflect more about their illness and what treatment methods are available. This agrees with Kleinman's [13] observation that one should consider the patient's self-perceived state of health [illness] and the medical explanation of the disorder [disease] as an interdependent whole, and with the insight that a patient's lack of reflection and understanding of their illness can be linked to the patient's level of understanding of the illness and interest in seeking information about the illness [1, 3]. The patients in the study used reflection to understand their illness in different ways, which also affected the learning process itself and how actively they used the understanding of the illness to manage it in everyday life. This confirms the importance, noted in several studies [8 - 11] of providing individualised information that takes the patient's ability to understand the illness better into account. Limitations A limitation of this study may be that the recruitment of the participants was carried out by the healthcare providers, possibly selecting individuals who were better than others at expressing their problems, which may have influenced the study's trustworthiness. However, there was variation in the depth and duration of the illness, abilities, and verbal ability among the participants, indicating that they were a heterogeneous group with varied understanding of the illness. Other limitations were that the participants' average age was relatively high and that there were slightly fewer women than men, which may limit the transferability of the result to similar groups. Another limitation was that the study focuses only on patients with long-term illnesses, which may entail that its conclusions are only transferable to patients with similar conditions. Yet another limitation was that only Swedish-speaking people were interviewed, which may affect the transferability of the study regarding people with different ethnic or cultural backgrounds. Such aspects may be of interest for future studies. CONCLUSION This study focuses on how the patients reflect on and understand their illness and how this understanding affects their trust in themselves or others. Patients reflect on their illness at different levels, from a personal level to a more general level, and have different needs and use of understanding of their illness. Some patients do not reflect very much at all about their illness and develop their own strategies to cope with it. There are variations regarding how the reflection is used depending on the patients' level of confidence in their own ability to manage the illness, as well as regarding their reliance on the skills of others, in particular healthcare providers. There is nothing that supports the idea that more understanding of the illness always helps patients manage their daily life. This depends on how the understanding uses as knowledge in action. Patients, who want to understand more about the illness, create their own understanding, trust themselves and could use the understanding as knowledge in action and thus better understand how to manage the illness. At the same time, there are patients who have a good ability to function without having the need to know so much about the illness and is content to focus on what works. They have found other, compensatory ways to manage the illness. To enable and promote the use of understanding of the illness, the understanding provided should be tailored to the patients' needs, abilities and levels of health. The goal must always be that the patient should be able to trust in their own understanding and through this develop a better ability to manage their disease and symptoms in daily life (improved self-care ability). Special attention should be paid to patients who have a high level of trust in others in order to strengthen their trust in themselves. Clinical interventions with both patients and healthcare providers are necessary. Interventions may also contribute to the development of an assessment tool based on the "Illness perception" model in order to assess the patients' need for understanding and opportunities for managing their illness. It is also important to study other age groups (younger persons and children) and whether or not a patient's need for understanding of the illness, as well as perception of it, depends on the illness type and on for how long the patient has had the illness. CONFLICT OF INTEREST The authors have no affiliations with or involvement in any organization or entity with any financial interest or nonfinancial interest in the subject matter or materials discussed in this manuscript. ACKNOWLEDGEMENTS The authors thank the primary healthcare personals and the interviewed patients for accepting to participate in this study, as well as Patrick Reis for his editing and proofreading assistance. REFERENCES [1] Schneider A, Wensing M, Quinzler R, Bieber C, Szecsenyi J. Higher preference for participation in treatment decisions is associated with lower medication adherence in asthma patients. Patient Educ Couns 2007; 67(1-2): 57-62. [http://dx.doi.org/10.1016/j.pec.2007.01.019] [PMID: 17346917] [2] Nunstedt H, Nilsson K, Skärsäter I, Kylén S. Experiences of major depression: individuals perspectives on the ability to understand and handle the illness. Issues Ment Health Nurs 2012; 33(5): 272-9. [http://dx.doi.org/10.3109/01612840.2011.653038] [PMID: 22545633] [3] Nunstedt H, Nilsson K, Skärsäter I. The portfolio method as management support for patients with major depression. J Clin Nurs 2014; 23(11-12): 1639-47. [http://dx.doi.org/10.1111/jocn.12284] [PMID: 24127874] [4] Newcomb PA, McGrath KW, Covington JK, Lazarus SC, Janson SL. Barriers to patient-clinician collaboration in asthma management: the patient experience. J Asthma 2010; 47(2): 192-7. [http://dx.doi.org/10.3109/02770900903486397] [PMID: 20170328] [5] Kao MH, Tsai YF. Illness experiences in middle-aged adults with early-stage knee osteoarthritis: findings from a qualitative study. J Adv Nurs 2014; 70(7): 1564-72. [http://dx.doi.org/10.1111/jan.12313] [PMID: 24237307] [6] Lesnovska KP, Börjeson S, Hjortswang H, Frisman GH. What do patients need to know? Living with inflammatory bowel disease. J Clin Nurs 2014; 23(11-12): 1718-25. [http://dx.doi.org/10.1111/jocn.12321] [PMID: 24004406] [7] Field K, Ziebland S, McPherson A, Lehman R. Can I come off the tablets now? A qualitative analysis of heart failure patients understanding of their medication. Fam Pract 2006; 23(6): 624-30. [http://dx.doi.org/10.1093/fampra/cml036] [PMID: 16837480] [8] Hörnsten A, Sandström H, Lundman B. Personal understandings of illness among people with type 2 diabetes. J Adv Nurs 2004; 47(2): 174-82. [http://dx.doi.org/10.1111/j.1365-2648.2004.03076.x] [PMID: 15196191] [9] Jansen J, van Weert J, van Dulmen S, Heeren T, Bensing J. Patient education about treatment in cancer care: an overview of the literature on older patients needs. Cancer Nurs 2007; 30(4): 251-60. [http://dx.doi.org/10.1097/01.NCC.0000281735.25609.af] [PMID: 17666973] [10] Nicolaije K-A, Husson O, Ezendam N-P, et al. Endometrial cancer survivors are unsatisfied with received information about diagnosis, treatment and follow-up: a study from the population-based PROFILES registry. Patient Educ Couns 2012; 88(3): 427-35. [http://dx.doi.org/10.1016/j.pec.2012.05.002] [PMID: 22658248] [11] Woodcock H, Gillam S. A one-to-one thing is better than a thousand books: views and understanding of older people with diabetes. Qual Prim Care 2013; 21(3): 157-63. [PMID: 23968265] [12] Meyfroidt S, Aeyels D, Van Audenhove C, et al. How do patients with uncontrolled diabetes in the Brussels-Capital Region seek and use information sources for their diet? Prim Health Care Res Dev 2013; 14(3): 229-39. [http://dx.doi.org/10.1017/S1463423612000205] [PMID: 22717540] [13] Kleinman A. The Illness Narratives Suffering, Healing, and the Human Condition. New York: Basic Books 1988. [14] Leventhal H, Nerentz DR, Steele DR. Illness perception and coping with health threat. In: Baum AS, Taylor E, Singer JE, Eds. Handbook of psychology and health. Hilsdale: Erlbaum Hilsdale; vol. 4: pp. 219-52. [15] Fioretos I, Hansson K, Nilsson G. Vårdmöten Kulturanalytiska perspektiv på möten inom vården. Lund: Studentlitteratur 2013. Care Meetings. Culture-Analytical Perspectives on Meetings in Healthcare[in Swedish] [16] Good BJ, Good MJ. The meanings of symptoms; a cultural hermeneutic model for clinical practice. In: The relevance of social science for medicine. Netherland: Springer 1981; pp. 165-96. [17] Cartwright BY. Understanding Health Beliefs about Illness: A Culturally Responsive Approach. J Rehabil 2010; 76(2): 40. [18] Pender NJ, Murdaugh CL, Parsons MA. Health Promotion in Nursing Practice. 5th ed. Upper Saddle River, NJ: Prentice Hall 2006. [19] Booker S, Morris M, Johnson A. Empowered to change: evidence from a qualitative exploration of a user-informed psycho-educational programme for people with type 1 diabetes. Chronic Illn 2008; 4(1): 41-53. [http://dx.doi.org/10.1177/1742395307086695] [PMID: 18322029] [20] Stevenson FA, Kerr C, Murray E, Nazareth I. Information from the Internet and the doctor-patient relationship: the patient perspectivea qualitative study. BMC Fam Pract 2007; 8(1): 47. [http://dx.doi.org/10.1186/1471-2296-8-47] [PMID: 17705836] [21] Dahlberg K. Segesten K Hälsa och Vårdande i teori och praxis. Natur & Kultur 2010. Health and Caring in Theory and Practice[in Swedish] [22] Alsén P, Brink E, Persson LO. Patients illness perception four months after a myocardial infarction. J Clin Nurs 2008; 17(5A): 25-33. [http://dx.doi.org/10.1111/j.1365-2702.2007.02136.x] [PMID: 18298753] [23] Graneheim UH, Lundman B. Qualitative content analysis in nursing research: concepts, procedures and measures to achieve trustworthiness. Nurse Educ Today 2004; 24(2): 105-12. [http://dx.doi.org/10.1016/j.nedt.2003.10.001] [PMID: 14769454] [24] Elo S, Kyngäs H. The qualitative content analysis process. J Adv Nurs 2008; 62(1): 107-15. [http://dx.doi.org/10.1111/j.1365-2648.2007.04569.x] [PMID: 18352969] [25] Silverman D. Interpreting Qualitative Data Methods for Analyzing Talk, Text and Interaction. 3rd ed. London, England: Sage 2000. [26] Cooper S, Endacott R. Generic qualitative research: a design for qualitative research in emergency care? Emerg Med J 2007; 24(12): 816-9. [http://dx.doi.org/10.1136/emj.2007.050641] [PMID: 18029510] [27] Lincoln YS, Guba E. Naturalistic inquiry. Beverly Hills, CA: Sage 1985. [28] Morse JM. Critical Issues in Qualitative Research Methods. Thousand Oaks, CA: Sage Publications 1994. © 2017 Nunstedt et al. This is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International Public License (CC-BY 4.0), a copy of which is available at: https://creativecommons.org/licenses/by/4.0/legalcode. This license permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.	<urn:uuid:33f31074-99e0-49ba-ba55-0599b43996cc>	CC-MAIN-2017-17	https://benthamopen.com/contents/pdf/TONURSJ/TONURSJ-11-43.pdf	2017-04-26T02:09:16Z	s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917121121.5/warc/CC-MAIN-20170423031201-00391-ip-10-145-167-34.ec2.internal.warc.gz	777,672,485	8,840	eng_Latn	eng_Latn	0.929978	eng_Latn	0.99814	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2865, 8483, 10904, 14870, 19143, 23374, 27459, 31681, 36527, 41522, 42438 ]
AMBER WINCHLINE Plus ### Fiber UV stabilized high tenacity polyolefin hybrid yarn ### Construction 12-strand braided core + outer cover layer ### Specific gravity 0.93 (floating) ### Elongation Approx. 15% ### Melting point 165°C ### UV resistance Good ### Abrasion resistance Excellent ### Application Mooring, winch line, anchor line and other heavy duty applications. #### Table: Specifications \| Diameter (mm) \| Circ (inch) \| Weight/220m (kg) \| Breaking strength (t) \| LDBF MEG4 (t) \| \|---------------\|-------------\|------------------\|-----------------------\|---------------\| \| 48 \| 6 \| 291.5 \| 48 \| 43 \| \| 50 \| 6-1/4 \| 316.4 \| 52 \| 47 \| \| 52 \| 6-1/2 \| 351 \| 59 \| 53 \| \| 56 \| 7 \| 401.5 \| 65 \| 59 \| \| 60 \| 7-1/2 \| 440 \| 75 \| 68 \| \| 64 \| 8 \| 490.6 \| 86 \| 77 \| \| 66 \| 8-1/16 \| 506.9 \| 91 \| 82 \| \| 68 \| 8-1/2 \| 550 \| 95 \| 86 \| \| 72 \| 9 \| 617.1 \| 106 \| 95 \| \| 80 \| 10 \| 792 \| 130 \| 117 \| All products are produced in accordance with OCIMF and MEG4 guidelines and IACS approved.	<urn:uuid:42e38c71-3ed7-420c-8d39-ebc7965f0248>	CC-MAIN-2025-08	https://garant.eu/uploads/pdf/services/AMBER%20WINCHLINE%20PLUS.pdf	2025-02-08T16:54:48+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2025-08/subset=warc/part-00166-b184e832-acd1-425a-bab7-895830f2748a.c000.gz.parquet	252,687,319	410	eng_Latn	eng_Latn	0.897197	eng_Latn	0.897197	[ "eng_Latn" ]	false	docling	[ 1594 ]
Preserving Green Olives the Roman Way A How-To Paper 7.5.0 3/14/2015 This paper will present methods to preserve and brine fresh green olives in the Roman way using modern food safety guidelines, as part of a Roman Matron Pentathlon Theme. Contents 1.0 Introduction This how-to paper presents a synthesis of Roman olive curing/brining methods and modern scientific and culinary information. Readers will be presented with several methods to preserve fresh green olives with safe home methods based on extant Roman literature and consistent with modern food safety information. The author and helpers picked fresh green olives at Great Western War 2014, as black olives were not available at the time (Figure 1). Olives were prepared using both purely Roman methods, and Roman methods including a de-bittering step. Taste-testers preferred the olives with the initial de-bittering process. 1.1 Sources and Background Marcus Portius Cato (Cato the Elder) was a well-known Roman statesman and writer from the 2 nd -1 st century BCE. His work, De Agri Cultura was a staple of Roman agricultural reference for hundreds of years (Dalby, 2012). Marcus Terentius Varro (1 st -2 nd century BCE) was an incredibly prolific writer, including his excellent work Rerum Rusticarum Libri Tres (Three Books On Agriculture) which heavily quotes Cato (Varro and Cato, 1979). However, Rutilius Taurus Aemilianus Palladius (4 th -5 th century CE) has the best extant instructions/recipes for preservation of olives, and thus was used for the basis of this document. To ensure that the olives were preserved using modern food science standards, I consulted the University of California Davis Department of Agriculture and Natural Resources' report on methods of safe home preservation of olives (Yada and Harris, 2007). 2.0 About Olives Olives, Olea Europea, are the fruit of a small tree native to much of the Mediterranean region, as well as portions of Asia and Africa (Yada and Harris, 2007). The usage of the fruit of this tree has been recorded in human settlements as far back as 23,500 years ago (Weiss et al., 2008). It is believed that olives were cultivated as far back as 6,000 years ago (Vossen, 2007). The fruit may be picked at any stage between green (unripe) and black (ripe). These olives may then be cured or used to produce olive oil. Olives may be picked by hand or by machine; for the purposes of this document, all olives were picked by hand to accurately reproduce the conditions they would have been harvested in during Roman times. 3.0 Picking Olives Olive trees should be heavy with olives, either green or black, have healthy leaves and branches, and be accessible. It is quite simple to gather olives from a tree, all that is required is a container to hold the picked olives, a stool or ladder to reach the higher branches, and perhaps a friend or two to assist in the labor. The author found that the easiest method to pick olives involved grasping the olive branch and pulling gently downwards towards the basket, so that the olives detached from the tree and gently fell into the basket (Figures 2 and 3). Once the olives have been picked, ensure that they have good airflow, or the moisture contained in the olives will cause them to ferment, mold, or rot (Yada and Harris, 2007). If black (ripe) olives have been collected, process them as soon as possible to ensure they do not over-ripen (Varro and Cato, 1979). Over-ripe or spoiled olives are specifically warned against. Cato: When the olives are ripe they should be gathered as soon as possible, and allowed to remain on the ground or the floor as short a time as possible, as they spoil on the ground or the floor. The gatherers want to have as many windfalls as possible, that there may be more of them to gather; and the pressers want them to lie on the floor a long time, so that they will soften and be easier to mill. Do not believe that the oil will be of greater quantity if they lie on the floor. The more quickly you work them up the better the results will be, and you will get more and better oil from a given quantity. Olives which have been long on the ground or the floor will yield less oil and of a poorer quality. If possible, draw off the oil twice a day, for the longer it remains on the amurca and the dregs, the worse the quality will be. Varro: With regard to the olive harvest: the olives which can be reached from the ground or by ladders should be picked rather than shaken down, because the fruit which has been bruised dries out and does not yield so much oil. Those picked with bare fingers are better than those picked with gloves, as the hard gloves not only bruise the berry but also tear the bark from the branches and leave them exposed to the frost. Those which cannot be reached with the hand should be beaten down; but a reed should be used rather than a pole, as the heavier blow renders necessary the work of the tree-doctor. The one who is beating should not strike the olive directly; for an olive struck in this way often tears away the shoot with it, and the fruit of the next year is lost. If the olives, after being picked, lie too long in the piles, they spoil from the heat and the oil becomes rancid; hence, if you cannot work them up promptly they should be aired by moving them about in the piles. 4.0 Processing Olives Several excellent documents from Roman times address olives. In particular, Rutilius Taurus Aemilianus Palladius' manuscript De Re Rustica (On Agriculture) has lengthy sections on olives, olive trees, how to cultivate the trees, and how to preserve the olives (Palladius, 1807). There are numerous ways to process both green and black olives for eating. Of the olives, Cato writes that the table olives, the orcites, and the posea are best preserved either green or in brine, or, when bruised, in mastic oil. The black orcites, if they are covered with salt for five days after being dried, and then, after the salt has been shaken off, are exposed to the sun for two days, usually keep sound; and that the same varieties may be satisfactorily preserved unsalted in boiled must. If you take out the preserved white olives soon, while they are fresh, the palate will reject them because of the bitter taste; and likewise the black olives, unless you first steep them in salt so that they may be taken into the mouth without distaste (Varro and Cato, 1979). For a more modern take on olive preservation, the author turned to the University of California Davis Division of Agriculture and Natural Resources (ANR) (Yada and Harris, 2007). This department provides information on preservation of olives that is consistent with modern health standards and regulations. The ANR provides excellent information on several curing and storage methods that produce delicious results with appropriate modern food safety and health techniques. For the purposes of this report, a combination of Roman and modern methods were used to ensure food safety. Green olives contain high amounts of oleuropein, a bitter-tasting compound that is leached out by curing and brining processes (Yada and Harris, 2007). Water-cured olives will exhibit more bitterness than those cured by other methods (salting, drying, or lye-curing) (Yada and Harris, 2007) as the oleuropein will not be fully leached out or neutralized. De-bittered olives were preferred by taste testers who tasted the olives that resulted from this paper, as the straight-tobrine methods generally leave more oleuropin in the olive. Cato describes a de-bittering process: To season green olives: Bruise the olives before they become black and throw them into water. Change the water often, and when they are well soaked, remove water and throw into vinegar-add oil, and a half pound 1 of salt to the modius 2 of olives. 4.1 Roman Methods Palladius suggests nine different ways to preserve olives, of which seven are for green olives. We will be discussing four methods in particular. Method One: 40 Days in Brine, Recipe 1 You will let your olives, when gathered, be macerated in brine: after forty days you pour out all the brine; you will then add two parts of defrutum 3 , one part of vinegar, some mint shred small, and you will fill the vessel with olives, so that the liquor may properly cover them. Method Two: 40 Days in Brine, Recipe 2 You first put your olives whole in brine. You will take them out after forty days, and you will cut them in the middle with a sharp reed; and if you wish to have them sweet, you 1 Probably translated from Libre, which is actually 11.6 oz (Smith, 1851) 3 Grape must reduced by boiling slightly (Palladius page 295) 2 8.73 liters (Smith, 1851) ought to pour over them two parts of sapa 4 and one of vinegar; if you wish to have them of a sharper flavor, pour two parts of vinegar and one of sapa. Method Three: Salt with Herbs, Honey, Oil and Vinegar You will preserve the olives gathered from the tree immediately. You will strew rue and petroselinum 5 between them, and you will then heap on some salt mixt with cumin, You will then pour some honey and vinegar over them: lastly you will mix some of the best oil with them. Method Four: 7 Days in Brine You sprinkle water over olives, gathered with their pedicles 6 , during three days. You then put them in brine, and after seven days you put them in a vessel with equal weights of must and vinegar, and you will cover the vessel when filled so that you may leave some vent-holes. 4.2 Modern Methods To prepare the olives for curing, each olive must be pierced or cracked so that the bitter-tasting oleuropein can leach out. The ANR recommends that each olive be pierced or cracked, and that the olives be soaked for 10 or more days in water, with the water being changed every day to ensure that the olives are de-bittered. Soaking for a longer period of time will contribute further to a less bitter olive (Yada and Harris, 2007). These olives should be placed in food-grade plastic containers with a sterile plastic Ziploc type bag with water in it placed so as to ensure all the olives remain in the water and not exposed to air (Yada and Harris, 2007). After the desired period of de-bittering soak, the olives should be brined with a salt, water, and vinegar mixture. These olives must be refrigerated after brining and may be kept for up to a year in the refrigerator. Olives that are immediately brined tend to be far more bitter than ones soaked to remove oleuropin (Yada and Harris, 2007), and are less similar in taste to the lye-cured commercial olives that most modern palates prefer. 5.0 Combination of Modern and Roman Methods Following are the steps the author took to re-create Roman-style preserved olives using modern, food-safe methods. 4 Grape must reduced by 2/3 volume by boiling (Palladius page 295) 6 The stem connecting the fruit to the branch. 5 Parsley (Petroselinum segetum or Petroselinum crispum) 5.1 Initial Preparation with De-Bittering For Roman-style olives, without the de-bittering process, olives may be placed directly into brine after being washed (see Section 5.2). Non de-bittered olives will be more bitter than modern palates generally prefer as the oleuropein is largely still within the olives. De-bittering was certainly known in Roman times (Varro and Cato, 1979), and is described in Cato's writings. First, wash your olives in clean, cold water, and remove any leaves or other matter that has been accidentally included with the olives. Next, pierce, crack, or slice the olives to allow the bitter oleuropein to leach out (Figure 4). Next, place the olives in a sterile container for the water-curing process. Food-grade plastic buckets are recommended, as they are inexpensive and easy to obtain (Figure 5); for a more authentic Roman experience, ceramic vessels that have been disinfected may be used, but these MUST be disinfected very carefully before use as they may harbor bacteria or fungus that would destroy the olives and render them unsafe for consumption. Add cold water to the container until the olives float. Ensure that the olives are not exposed to air by taking a Ziploc bag, filling it with an amount of water, and floating this on top of the olives to press them into the water (Figure 6). Exposure to air will cause the olives to mold or rot. Change the water of these containers daily for 10 days. After 10 days, the olives may be brined; however, I chose to soak them for a longer period to de-bitter them more thoroughly as modern tastes prefer smooth, less bitter olives. The water changed each day will be increasingly more green in color, and the olives will become more yellow in hue. After the olives have soaked in water for your preferred period of time, they may be brined, or prepared according to the Roman recipes in section 4.1. 5.2 Finishing Methods I chose the four Roman recipes from Palladius for green olives as listed in section 4.1. Each recipe will be discussed individually. The recommended brine recipe is one cup of pickling salt and two cups of vinegar per 1 gallon of cool water (Yada and Harris, 2007). Method One: 40 Days in Brine, Recipe 1 You will let your olives, when gathered, be macerated in brine: after forty days you pour out all the brine; you will then add two parts of defrutum, one part of vinegar, some mint shred small, and you will fill the vessel with olives, so that the liquor may properly cover them. Take your de-bittered olives and place them in brine for 40 days. After 40 days, drain the brine. To make the defrutum, boil grape juice until it has been reduced by half. Add 2 parts of this to one part of vinegar (white wine vinegar is recommended by the author), and shredded fresh mint leaves to taste. Place in sterilized jars or containers (Mason jars or well-sterilized ceramic vessels with non-cork tops) and ensure that the olives are not exposed to air. Store these olives in the refrigerator for up to one year. This method produces sweetish olives with a pleasant taste of mint. Method Two: 40 Days in Brine, Recipe 2 You first put your olives whole in brine. You will take them out after forty days, and you will cut them in the middle with a sharp reed; and if you wish to have them sweet, you ought to pour over them two parts of sapa and one of vinegar; if you wish to have them of a sharper flavor, pour two parts of vinegar and one of sapa. As above, place the olives in brine for 40 days. Slice each olive with a sharp reed if available (bamboo skewers work quite well); otherwise, use a knife. To make sapa, take grape juice and boil it until only 1/3 of the original volume remains. Mix sapa and vinegar (white wine vinegar is recommended by the author) to taste per the instructions. Place in sterilized jars or containers (Mason jars or well-sterilized ceramic vessels with non-cork tops) and ensure that the olives are not exposed to air. Store these olives in the refrigerator for up to one year. These are similar to the olives above but lack mint and are a bit sweeter. Method Three: Salt with Herbs, Honey, Oil and Vinegar You will preserve the olives gathered from the tree immediately. You will strew rue and petroselinum between them, and you will then heap on some salt mixt with cumin, You will then pour some honey and vinegar over them: lastly you will mix some of the best oil with them. To make these delicious olives, take the de-bittered olives, and place them in a sterilized vessel, in layers. Take rue and parsley leaves, shredded, and strew between the layers of olives. Once you have filled the vessel to the top, use the same proportions of salt to liquid as a regular brine (one cup salt per one gallon of liquid). Add 1 teaspoon of cumin per pint of olives. The author prefers a mixture of equal amounts honey and vinegar to fill the vessel ¾ to the top, then topping the vessel off with a high quality olive oil. Store this in the refrigerator to prevent the oil from going rancid. This method produces delicious olives with a uniquely Roman flavor. Method Four: 7 Days in Brine You sprinkle water over olives, gathered with their pedicles, during three days. You then put them in brine, and after seven days you put them in a vessel with equal weights of must and vinegar, and you will cover the vessel when filled so that you may leave some vent-holes. To make this style of olives, take the de-bittered olives and brine them for seven days (The author tried the listed Roman method with green stemmed olives that had not been de-bittered and found the results inferior to de-bittered olives without stems). After a week, remove the brine and put the olives in a sterilized vessel with equal amounts of must and vinegar. The original Roman recipe requires fermentation; the vent holes allow fermentation gases to escape. If these olives are stored per modern food safety instructions, they must be stored with loose caps/covers for 70 degrees for up to 2 months; after 2 months they may have their lids/covers tightened and may be stored for up to 1 year in a cool and dark place (refrigeration is recommended) (Yada and Harris, 2007). This method produces fermented, briny olives that are reminiscent of pickled vegetables. 6.0 Conclusion This paper has presented four Roman recipes for green olives, discussed the Roman and modern ways of preservation, and presented food-safe and modern methods to reproduce these recipes. Processing and preserving green olives using modern food-safe methods combined with extant Roman recipes is simple and can be done in almost any kitchen. Each of the four methods discussed in this paper produces delicious, period olives with a uniquely Roman flavor set that are appropriate to modern palates. De-bittered olives were responded to by taste-testers more favorably than those that had not gone through the de-bittering process. Olives prepared purely according to the straight-to-brine Roman methods tended to be more bitter and the flesh of the olives was less soft. 7.0 References Dalby, Andrew (2012), Cato: On Farming, Totnes: Prospect Books. (Preface) Palladius, R. T. A., & Owen, T. (1807). The fourteen books of Palladius Rutilius Taurus Æmilianus, on agriculture. London: Printed for J. White. (pp. 295-296 and 326-329.) Smith, Sir William; Charles Anthon (1851) A new classical dictionary of Greek and Roman biography, mythology, and geography partly based upon the Dictionary of Greek and Roman biography and mythology New York: Harper & Bros. Tables, pp. 1024–30 Varro, Marcus, and Cato (1979). On Agriculture; Varro, Marcus Terentius & Cato, Marcus Portius. Cambridge, MA: Harvard University Press. Print.(pp. 107, 289-291, 297, 301) Vossen, Paul (2007). "Olive Oil: History, Production, and Characteristics of the World's Classic Oils". HortScience 42 (5): 1093–1100 (pp. 1093-1096). Weiss E, Kislev ME, Simchoni O, Nadel D, and Tschauner H. 2008. Plant-food preparation area on an Upper Paleolithic brush hut floor at Ohalo II, Israel. Journal of Archaeological Science 35 (8):2400-2414 (pp. 2400-2402). Yada S. and L. Harris. 2007. Olives: safe methods for home pickling. Publication Number: 8267. Division of Agriculture and Natural Resources, University of California. Davis, California. 26 p. (pp. 1-3, 5-7)	<urn:uuid:184c0358-1cc7-493a-b8c2-a9e2c63fb961>	CC-MAIN-2022-27	https://zenofjen.com/application/files/3315/9371/9395/Olives_HowTo.pdf	2022-06-26T08:40:49+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-27/subset=warc/part-00079-48f675b2-7fd4-43af-adb3-2a4ea7f82193.c000.gz.parquet	1,192,235,676	4,557	eng_Latn	eng_Latn	0.992262	eng_Latn	0.997474	[ "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 243, 253, 1555, 4346, 5334, 6072, 8701, 10950, 12045, 12342, 15058, 16062, 17242, 19295 ]
Reply to Golan et al.: Revisiting the Statistical Analysis of the Israeli-Palestinian Conflict Confirms That Both Sides Retaliate The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. \| Citation \| Haushofer, J., A. Biletzki, and N. G. Kanwisher. “Reply to Golan and Rosenblatt: Revisiting the statistical analysis of the Israeli- Palestinian conflict confirms that both sides retaliate.” Proceedings of the National Academy of Sciences 108 (2011): E55-E56. ©2011 by the National Academy of Sciences. \| \|---\|---\| \| As Published \| http://dx.doi.org/10.1073/pnas.1019420108 \| \| Publisher \| National Academy of Sciences (U.S.) \| \| Version \| Final published version \| \| Accessed \| Wed Oct 24 01:10:53 EDT 2018 \| \| Citable Link \| http://hdl.handle.net/1721.1/66985 \| \| Terms of Use \| Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. \| \| Detailed Terms \| \| Reply to Golan and Rosenblatt: Revisiting the statistical analysis of the Israeli–Palestinian conﬂict conﬁrms that both sides retaliate We thank Golan and Rosenblatt (1) for their comments on our analysis (2), which we address in turn. First, Golan and Rosenblatt suggest that the time series may be nonstationary (that is, the distribution of the variables in the data may change over time). Our original paper addressed this concern in two ways. First, we tested for stationarity using the standard Dickey Fuller test. The results (table S2 in ref. 2) supported the stationarity hypothesis. Second, we included year dummy variables to control for structural breaks. We chose years rather than political events for these dummy variables to avoid the arbitrariness inherent in the latter approach. Thus, nonstationarity is not a concern for our conclusions. Nevertheless, Golan and Rosenblatt answer an interesting additional question by showing that the patterns of retaliation vary across subperiods. Golan and Rosenblatt also suggest a modiﬁed model in which (i) the same lag is used for all time series, (ii) a square rootstabilizing transformation is applied to the data before analysis, and (iii) all three variables (Qassam ﬁrings and Israeli and Palestinian fatalities) are included in the equation. We ﬁnd that this alternative model does not ﬁt the data better than ours. The mean-squared prediction error of our model was 7.894 ± 1.564 (mean ± 1 SE), and the mean-squared prediction error of the model by Golan and Rosenblatt (1) is 7.717 ± 1.466; the difference in ﬁt is insigniﬁcant (t = −0.95, P = 0.34). However, we are pleased that this model conﬁrms our main result, which is that both sides retaliate. Table 1, which replicates our original analysis with the modiﬁcations suggested by Golan and Rosenblatt, conﬁrms this claim. Note that the F-tests that we use are consistent by standard results from large-sample theory (3), despite the claims of Golan and Rosenblatt to the contrary. An interesting difference between our original model and the model of Golan and Rosenblatt is that, in their analysis, Qassam attacks lead to Israeli retaliation, whereas in our model, they did not. Golan and Rosenblatt correctly say that it is more customary to ﬁ t vector autoregressions (VARs) using all predictor variables with the same number of lags, and although this does not lead to an improvement in model ﬁ t in this case, it lends weight to the view that Israel does indeed retaliate for Qassam ﬁ rings. Golan and Rosenblatt further argue that ﬁgures 2 and 3 in ref. 2 do not take the autocorrelation of the data into account. We fully agree that plots of the VAR impulse response functions are more informative. We merely showed the response functions used by Jaeger and Paserman (4) to allow comparison of our results with their results. Of course, all statistical results and conclusions of our paper were based purely on the VAR results, which control for autcorrelation. Finally, Golan and Rosenblatt point out that, by computing the proportion of events that can be attributed to retaliation based on the ﬁrst day rather than several days after an attack, our analysis provided a lower bound on the proportion of events that can be attributed to retaliation. This is correct; we chose this approach to be as conservative as possible and to avoid overstating our results. However, we are encouraged that lessconservative approaches conﬁrm our ﬁndings. Johannes Haushofer a,1 , Anat Biletzki b,c , and Nancy G. Kanwisher d,1 a Department of Economics, University of Zurich, 8006 Zurich, Switzerland; b Department of Philosophy, Tel Aviv University, Ramat Aviv, Tel Aviv 69978, Israel; c Quinnipiac University, Hamden, CT 06518; and d McGovern Institute for Brain Research, Massachusetts Institute of Technology, Cambridge, MA 02139 1. Golan D, Rosenblatt JD (2011) Revisiting the statistical analysis of the Israeli–Palestinian conﬂict. Proc Natl Acad Sci USA 108:E53–E54. 2. Haushofer J, Biletzki A, Kanwisher N (2010) Both sides retaliate in the Israeli–Palestinian conﬂict. Proc Natl Acad Sci USA 107:17927–17932. 3. Hayashi F (2000) Econometrics (Princeton University Press, Princeton). 4. Jaeger DA, Paserman MD (2008) The cycle of violence? An empirical analysis of fatalities in the Palestinian Israeli conﬂict. AER 98:1591–1604. Author contributions: J.H. and N.G.K. designed research; J.H. performed research; J.H. analyzed data; and J.H., A.B., and N.G.K. wrote the paper. The authors declare no conﬂict of interest. 1 To whom correspondence may be addressed. E-mail: [email protected] or ngk@ mit.edu. Table 1. Israeli and Palestinian retaliation for killings and Qassam attacks The table reports the test statistics for the test of the null hypothesis that the lagged coefﬁcients on the respective other variable are jointly equal to zero. The model was suggested by Golan and Rosenblatt (1) (i.e., a full 3D VAR with 11 lags of all dependent variables and a square root variance-stabilizing transformation). Signiﬁcant statistics can be interpreted as retaliation by one party for previous violence from the other side. Palestinian retaliation after killings of Palestinians by Israel includes killings of Israelis by Palestinians or Qassam attacks by Palestinians on Israel. Israeli retaliation includes killings of Palestinians by Israel after either Qassam attacks by Palestinians on Israel or killings of Israelis by Palestinians. *Signiﬁcant statistics. \|	<urn:uuid:9c1107a8-3a1f-4f55-bbbf-a04e488accb5>	CC-MAIN-2018-43	http://dspace.mit.edu/openaccess-disseminate/1721.1/66985	2018-10-24T05:10:54Z	s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583519859.77/warc/CC-MAIN-20181024042701-20181024064201-00483.warc.gz	100,142,329	1,590	eng_Latn	eng_Latn	0.988222	eng_Latn	0.987564	[ "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 1032, 5677, 6541 ]
SESSION 1: A COMMON FAITH You see, at just the right time, when we were still powerless, Christ died for the ungodly. Very rarely will anyone die for a righteous man, though for a good man someone might possibly dare to die. But God Demonstrates his own love for us in this: While we were still sinners, Christ died for us. Since we have now been justified by his blood, how much more shall we be saved from God's wrath through him! For if, when we were God's enemies, we were reconciled to him through the death of his Son, how much more, having been reconciled, shall we be saved through his life! Not only is this so, but we also rejoice in God through our Lord Jesus Christ, through whom we have now received reconciliation. Romans 5:6-11	<urn:uuid:e9277762-0df3-4f48-b774-cad89e411ea2>	CC-MAIN-2022-21	https://sjpcjax.org/wp-content/uploads/2021/08/SESSION-1.pdf	2022-05-22T07:08:47+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-21/subset=warc/part-00283-bd7ecbba-8e15-4123-ae07-d9c98ad96845.c000.gz.parquet	602,125,488	176	eng_Latn	eng_Latn	0.997733	eng_Latn	0.997733	[ "eng_Latn" ]	false	rolmOCR	[ 746 ]
Draft of piece published in the American Philosophical Association Newsletter on Philosophy and Computers, 8(1), 9-12, 2008. The Fourth Way: a Comment on Halpin's "Philosophical Engineering" Michael Wheeler Department of Philosophy University of Stirling [email protected] It is common these days to distinguish between three kinds of cognitive science or artificial intelligence: classical, connectionist, and (something like) embodied-embedded. Of course, all such attempts at neat-and-tidy categorization are undoubtedly guilty of over-simplification in one way or another. For example, researchers sometimes build models that combine aspects of more than one approach (e.g. when conventional connectionist networks are used as control systems for embodied agents). That noted, however, one method for separating out our three kinds of cognitive science, so as to understand more clearly their basic theoretical commitments, would be to identify, in a very general way, the sorts of machine that each takes to capture the fundamental character of intelligence. If we adopt this strategy, classicism will be defined by the manipulation of symbols using structuresensitive processes, connectionism by unfolding patterns of activity in neurally inspired networks of simple processing units, and embodiedembedded thinking by complete autonomous robots engaged in perceptually guided motor activity. One of the many fascinating claims in Harry Halpin's strikingly original article "Philosophical Engineering: Towards a Philosophy of the Web" (Halpin 2008) is that the Web constitutes a fourth conceptual anchor for the notion of mind as machine. Halpin's view, in short, is that the Web provides a general model of a computational machine that compels us to rethink the notion of representation, while simultaneously radicalizing our conception of cognition through a vindication of the idea that minds may be realized partly by factors located beyond the skin. In this comment on Halpin's article, I shall engage briefly with just some of the issues that confront us once we take this fourth way. With apologies for the immediate whiff of self-centredness, I shall begin by considering an argument from Halpin's paper that responds explicitly to some of my own previous work. I have been known to claim (e.g. Wheeler 2005) that any adequate account of representational explanation in cognitive science must have the consequence that while certain inner (within-the-skin) elements count as representations, most external (beyond-the-skin) elements don't. The justification for this restriction is largely methodological: it seems likely that neural states and processes do something that is, for the most part, psychologically distinctive, and we expect the concept of representation to help us explain how that something comes about. Thus the constraint at issue may be specified more carefully as what I call the neural assumption. The neural assumption states that if intelligent action is to be explained in representational terms, then whatever criteria are proposed as sufficient conditions for representation-hood, they should not be satisfied by any extraneural elements for which it would be unreasonable, extravagant, or explanatorily inefficacious to claim that the contribution to intelligent action made by those elements is representational in character. For if such illegitimate external factors qualified as representations, the claim that some neural state has a representational character would fail to single out what was special about the causal contribution to intelligent behaviour made by that state. Notice that the neural assumption, as formulated, is liberal enough to allow some external factors to qualify as representations in the sense that is relevant for cognitive-scientific explanation. However, it is clear that representations construed this way will remain largely inside the head. Halpin distances himself from this approach to representation, arguing that once our intellectual goal becomes a philosophy of the Web, as opposed to a philosophical account of how representation figures as an explanatory primitive in cognitive science, any inner-focused account of representation (such as my own) will fail to deliver what theory demands. As he puts it, the Web is "nothing if not a robustly representational system, and a large amount of research on the Web focuses on how to enable increasingly powerful and flexible forms of representations" (Halpin 2008, p.6). Thus "[w]hat we need is a notion of what a representation is, a definition that applies to both "internal" and "external" representations, not conditions for a representational explanation in cognitive science" (Halpin 2008, p.7). In other words, what a philosophy of the Web requires is a suitably generic, locationally uncommitted account of representation that, in principle, applies equally to internal representations (those located within the skin) and external representations (those located outside the skin, such as those on the Web). Without such an account, we will be unable to make sense of the Web as a representational system. In the light of this analysis, Halpin proceeds to sketch a proposal for what it is for something to be a representation. Here he draws, in part, on Smith's (1996) notion of representation via registration, according to which the distinction between subject and object, and thereby between representation and represented, emerges from the dynamics of certain physical processes in which one region of space-time tracks the behaviour of another. I will be concerned not with the plausibility of Halpin's positive proposal, but rather with the alleged need for any unitary, locationally uncommitted account of representation. For it seems to me that, from the present perspective, although we need a concept of representation that illuminates the character of representational explanation in cognitive science, plus a concept of representation that makes sense of external representations (and thereby of the Web as a representational system), there is no reason to think that it must be the same concept of representation in both cases. Indeed, there are considerations which suggest that theoretically significant differences are to be expected. For example, when external representations are used to guide intelligent behaviour, they do so via perception-action loops. Thus consider familiar cases of visual maps, whether paper or electronic. Such representations are able to direct behaviour because the agent looks at and performs an embodied spatial manipulation of the map-realizing elements (the atlas or the PDA). No such perception-action engagement with the behaviourguiding representations are present when we use neurally realized internal maps (assuming there are such things) to navigate around the world. One might expect these sorts of differences to have an impact upon the nature of the representations in question. Moreover, Halpin himself identifies certain principles that (he argues) not only characterize the external representations used by the Web, but also perhaps explain the intelligence-facilitating effects of the Web. It is hard to see how these principles (universality, inconsistency, self-description, least power and the open world – see Halpin 2008, p.9, for the details) apply to neural representations. Of course, given this pattern of divergence, we need some reason to conclude that what we call internal representations and what we call external representations are both genuine members of some overarching category of representational elements. For this, however, it is sufficient that (a) the alternative notions be linked by the vague pre-theoretical thought that, to be a representation, a state or process should play some sort of standing-in-for function, and (b) there should be some sort of family resemblance structure in play. Evidence for (b) may be found in the observation that familiar cases of external representations (e.g. mathematical symbols) plausibly share certain properties with neural representations, properties such as multiple realizability and being the bearers of consumed information. That said, Halpin's nervousness about my inner-focussed account of representational explanation in cognitive science may have an alternative source. To see this, we need to plug in the relationship that, according to Halpin, exists between the external representationalism of the Web and (what is sometimes called) the extended mind hypothesis (Clark and Chalmers 1998). In general terms, those who believe in the extended mind hold that there are conditions under which cognitive states, processes, mechanisms, architecture, and so on may be partly realized by material elements located beyond the skin. Halpin's view is that the universal information space of the Web supplies a dynamic and open-ended suite of such elements. In other words, the ways in which we store, retrieve, manipulate and transform representational structures on the Web mean that, under certain conditions, some of our cognitive traits are partly realized by those structures. Dramatic examples of such cognitive extension occur when multiple agents remotely access and update a shared map on the Web. In such cases, the "active manipulation of a representation lets [the two agents] partially share a dynamic cognitive state and collaborate for their greater collective success… via shared external representations that are universally accessible over the Web" (Halpin 2008, p.8). This changes things. If we are to make sense of the Web not only as a representational system, but as a representational system whose elements may sometimes constitute part of an agent's cognitive architecture, then one might think that the pressure in the direction of a unitary account of representation increases. After all, given that certain representational structures on the Web are now to be granted cognitive status, it seems that an adequate account of representational explanation in cognitive science will need to apply not only to familiar inner elements such as neural states and processes, but also to those external structures. In other words, any purely inner-focused account of representation is now revealed as failing to deliver what cognitive theory demands. Although, to my mind, Halpin himself does not clearly separate out the present argument from the one with which we began (which doesn't turn on the putatively cognitive status of the external representational structures), it seems to be the present argument that offers the more compelling case for the view that we need a unitary, locationally uncommitted account of representation. Halpin's analysis alerts us to the fact that once the idea of cognitive extension is on the table, the neural assumption (see above) needs to be separated out from what we might now dub the global adequacy requirement – the demand that we develop an account of representation suitable for the task of cognitive-scientific explanation. The latter is what Halpin (2008, p.7) calls the "conditions for a representational explanation in cognitive science". In my previous work I have been guilty of running together the global adequacy requirement and the neural assumption (as indicated by the discussion of the neural assumption included above). Once we pull these analytical structures apart, however, we can see that the strategy of appealing to different notions of representation – the strategy that, as we saw, made sense of external representation under a non-cognitive interpretation – will also make sense of external representation under a cognitive interpretation. To see why this is, notice first that, depending on how one carves up nature into cognitive and non-cognitive regions, an account of representation that meets the neural assumption may not meet the global adequacy requirement. Consider: if externally located representations on the Web figure as genuine parts of cognitive processes, the global adequacy requirement will not be met by an account of representation that respects the neural assumption – or at least not by that account on its own. But that, of course, is the key point. For the global adequacy requirement may be met by a varied explanatory toolkit encompassing different notions of representation designed for different explanatory tasks, such as understanding how neural states contribute to intelligent behaviour, and illuminating how external representations may figure as genuine parts of cognitive processes. What this suggests is that, with the extended mind added to the mix, and the concept of cognitive representational space expanded to include external structures, that space may reflect the same pattern of similarities and differences between internal and external representations that we identified earlier. Thus, even under a cognitive interpretation, the unitary notion of representation that Halpin seeks may be no more than a philosophical chimera. So far, I have been assuming that Halpin is right that, under certain circumstances, the Web forms part of our cognitive resources. I now want to interrogate that idea – not, I hasten to add, because I think it's obviously wrong, but because we need to be clear about what a good argument for that conclusion would look like. The first thing to note here is that the extended mind hypothesis is a view about the whereabouts of mind that is distinct not only from the position adopted by orthodox cognitive science (classical or connectionist), but also from the position adopted by any merely embodiedembedded view. To illustrate this point, we can adapt an example originally due to Rumelhart et al. (1986). Most of us solve difficult multiplication problems using pen and paper. The pen and paper system is a beyond-theskin factor that helps to transform a difficult cognitive problem into a set of simpler ones, and to temporarily store the results of intermediate calculations. For orthodox cognitive scientists and for supporters of the merely embodiedembedded view, that pen and paper system is to be conceived as a noncognitive environmental prop. It is an external tool that aids certain cognitive processes via embodied interaction, but is not itself a proper part of those processes. Of course, orthodox cognitive scientists and embodied-embedded theorists differ on how best to characterize the interactive arrangement of skin-side cognitive processes and external prop. In particular, the embodiedembedded theorist is likely to count the bodily activity involved as itself a cognitive process, as opposed to a mere output of neurally located cognition, and to trace rather less of the source of the manifest complexity of the observed behaviour to the brain, and rather more to the structured embodied interactions with the external pen and paper system. For all that, however, both of these camps think of cognition as a resolutely skin-side phenomenon. By contrast, the extended mind theorist considers the causally coupled combination of pen-and-paper resource, appropriate bodily manipulations, and in-the-head processing to be a cognitive system in its own right. We can now pinpoint the right question to ask: does Halpin's analysis indicate that certain manipulations of the Web's universal information space constitute genuine cases of cognitive extension rather than merely embodied-embedded intelligence? Halpin sometimes seem to suggest that cognitive extension results whenever an adaptive causal coupling between inner and outer elements produces an intelligent outcome. Thus recall his example of two agents whose intelligent behaviour is structured by shared remote access, via mobile telephones, to a web page containing a map. He implies that coupling considerations are sufficient for cognitive extension when he writes that "[s]ince [the two agents] are sharing the representation and their behavior is normatively successful based on its use, [they] can be said to partially share the same cognitive state" (Halpin 2008, p.8). A more sophisticated version of the coupling argument for cognitive extension emerges during Halpin's subsequent discussion of the ways in which the coupled combination of analogue organic processing with external digital computer memory enable human beings to succeed at cognitive tasks that are poorly tackled by unaided organic processing. This is a particularly striking example of the ways in which human cognition may be transformed through the integration of internal processing with external props and scaffolds that possess a different range of fundamental properties. Unfortunately, however, even given the transformative effects brought about by integrated bio-technological couplings, we don't yet have an argument for cognitive extension. As Adams and Aizawa (2008) forcefully point out, all coupling-based arguments for cognitive extension are dangerously insensitive to a crucial causal-constitutive distinction, that is, to the distinction between cognition being merely causally dependent on some factor, and to cognition being constituted by, or partly constituted by, that factor. The cognitive activities of Halpin's remote-map-using agents, as well as those of his digitally embedded brains, are surely causally dependent on external factors in ways to which traditional theorizing in cognitive science has been largely oblivious, but that is not enough to secure the cognitive status of those factors. The main alternative to coupling-based arguments for cognitive extension is what, in the literature, is known as the parity principle (Clark and Chalmers 1998). Exactly how one should formulate the parity principle remains a matter of some dispute (Clark 2007; Wheeler forthcoming), but the general idea is that if there is functional equality with respect to governing behaviour, between the causal contribution of certain internal elements and the causal contribution of certain external elements, and if the internal elements concerned qualify as the proper parts of a cognitive process, then there is no good reason to deny equivalent status – that is, cognitive status – to the relevant external elements. Halpin (2008, p.8) quotes Clark and Chalmers' original statement of the parity principle, but it is unclear to what extent he gives weight to parity considerations as opposed to issues of coupling and integration. However, because the parity principle appeals, at root, to the notion of functional equivalence and not mere coupling, it does not run roughshod over the causal-constitutive distinction. So provisionally at least, the parity-driven case for cognitive extension is on the firmer footing. In relation to Halpin's arguments, this prompts the following question: is it ever correct to say that there is functional parity between (i) the causal contributions to intelligent behaviour made by those inner factors that qualify as cognitive, and (ii) the causal contributions to intelligent behaviour made by structures on the Web? As far as I can tell, the answer to this question depends on the specific criteria that one thinks need to be satisfied for a causal contribution to count as cognitive, what Adams and Aizawa (2008) call the mark of the cognitive. Such criteria are necessary because, in order to deploy the parity principle, one must be able to isolate just those functions that inner elements perform that mark out their contribution as cognitive (e.g. the functions involved in the context sensitive storage and retrieval of information that might plausibly define the cognitive trait of memory). It is parity with respect to the realization of these particular functional roles that will establish the cognitive status of certain external elements. This introduces a complex issue that certainly cannot be settled here. It is worth noting, however, that if the extended mind theorist adopts a weak or promiscuous enough mark of the cognitive, then it will be easy enough to secure the result that cognition is extended; but the price of this success will be to welcome into the domain of the cognitive all kinds of wildly unlikely cases in a manner that ultimately casts doubt on the ability of the proposed mark to latch onto only what might be thought of as the proper objects of cognitive science. What this aspect of Halpin's project still needs, it seems, is a mark of the cognitive that allows certain external representations on the Web (such as remotely accessible maps just as they guide online intelligent behaviour) to count as cognitive, while denying that same status to 'wildly unlikely cases' (such as books in a home library or standing mobile telephone access to an Internet search engine meaning that one might dispositionally believe everything on the Web). Put in a more generic way, the problem is to find a path between the dual dangers of a kind of disproportionate elitism (excluding from the domain of the cognitive certain genuinely cognitive traits, just because they happen to be externally located) and a kind of excessive liberality (welcoming in to the domain of the cognitive certain unwanted interlopers, as a side-effect of making conceptual room for extended cognition). Halpin is not alone in facing this problem. Extended mind theorists in general have perhaps failed to realize just how much hangs on it. Nevertheless, it is a problem for Halpin, and one that, I think, he cannot ignore. My response to Halpin's arguments has necessarily been selective. I could have written another comment purely on the issues that Halpin explores towards the end of his discussion, when he turns his attention to the relationship between bio-technological intelligence and the specific case of the Semantic Web. What I hope to have made manifest, however, is the rich vein of thought that runs through Halpin's paper. For while the power of the Web as a technological innovation is now beyond doubt, the potential power of the Web to have a conceptual impact on cognitive science remains underappreciated. The second of these contributions is what I have called the fourth way, an intellectual path innovatively revealed by Halpin's article. My critical comments here do no more than point to twists and turns that, in my view, remain to be navigated as we explore that trail. The fourth way may well be the next way. References Adams, F. and Aizawa, K. 2008. The Bounds of Cognition. Malden, MA and Oxford: Blackwell. Clark A. 2007. "Curing Cognitive Hiccups: a Defense of the Extended Mind." Journal of Philosophy 104, 163-192. Clark, A. and Chalmers, D. 1998. "The Extended Mind."Analysis 58 (1), 7-19. Halpin, H. 2008. "Philosophical Engineering: Towards a Philosophy of the Web." APA Newsletter on Philosophy and Computers, 7(2): 5-11. Rumelhart, D.E., Smolensky, P., McClelland, J.L. and Hinton, G. 1986. "Schemata and Sequential Thought Processes in PDP models." In Parallel Distributed Processing: Explorations In The Microstructure Of Cognition, Vol. 2: Psychological And Biological Models, J.L. McClelland and D. Rumelhart eds. Cambridge, Mass.: MIT Press, 7-57. Smith, B. 1996. On the Origin of Objects. Cambridge Mass.: MIT Press. Wheeler, M. 2005. Reconstructing The Cognitive World: The Next Step. Cambridge, Mass.: MIT Press. Wheeler, M. Forthcoming. "Minds, Things, and Materiality." In The Cognitive Life of Things: Recasting the Boundaries of the Mind, C. Renfrew and L. Malafouris eds. Cambridge: McDonald Institute for Archaeological Research Publications.	<urn:uuid:da2aea18-c2f6-4766-b68f-1ec45441aae6>	CC-MAIN-2023-40	https://dspace.stir.ac.uk/bitstream/1893/604/1/wheeler_fourth_way_halpin_STORRE.pdf	2023-10-01T02:39:36+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-40/subset=warc/part-00154-7aa0a1e5-33a6-434b-89a2-950f294b40c1.c000.gz.parquet	244,273,981	4,534	eng_Latn	eng_Latn	0.948059	eng_Latn	0.99761	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2324, 5502, 8427, 11420, 14554, 17527, 20698, 23054, 23572 ]
ASTEC LIFESCIENCES LIMITED POLICY ON MATERIALITY OF RELATED PARTY TRANSACTIONS AND ON DEALING WITH RELATED PARTY TRANSACTIONS INDEX OF CONTENTS \| \| Section \| \| Particulars \| \| Page No. \| \|---\|---\|---\|---\|---\|---\| \| I \| \| Objective of the Policy \| \| 3 \| \| \| II \| \| Definitions \| \| 3 \| \| \| III \| \| Review & Approval by the Audit Committee \| \| 4 \| \| \| IV \| \| Determination of Materiality of Related Party Transactions \| \| 8 \| \| \| V \| \| Approval of the Board of Directors \| \| 9 \| \| \| VI \| \| Approval of the Shareholders \| \| 9 \| \| \| VII \| \| Disclosure by the Company \| \| 10 \| \| \| VIII \| \| Disclosure Obligations of Directors & Key Managerial Personnel \| \| 10 \| \| \| IX \| \| Approval for Unforeseen Related Party Transactions \| \| 10 \| \| \| X \| \| Transactions which do not require Approval \| \| 11 \| \| \| XI \| \| Related Party Transactions not approved under this Policy \| \| 11 \| \| \| XII \| \| Policy Review \| \| 11 \| \| I. OBJECTIVE OF THE POLICY: This Policy on Materiality of Related Party Transactions and on Dealing with Related Party Transactions ("the Policy" or "this Policy") is framed by Astec LifeSciences Limited ("the Company"), pursuant to the provisions of Regulation 23 and other applicable provisions of the Securities and Exchange Board of India (Listing Obligations and Disclosure Requirements) Regulations, 2015 ("the Listing Regulations") and in terms of Section 188 and other applicable provisions of the Companies Act, 2013 and the Rules framed thereunder ("the Companies Act"), including any modification(s) / amendment(s) / re-enactment(s) thereof. The Board of Directors of the Company has adopted this Policy to set forth the procedures by which transactions with Related Parties shall be reviewed for approval or ratification. The Policy is intended to ensure proper approval, disclosure and reporting of transactions between the Company and its Related Parties and its Subsidiary Companies and their Related Parties, wherever applicable. Any Related Party Transaction may be entered into by the Company in accordance with the provisions of this Policy. II. DEFINITIONS: "Arm's length transaction" means a transaction between two related parties that is conducted as if they were unrelated, so that there is no conflict of interest. "Audit Committee" or "Committee" means Committee of Board of Directors of the Company constituted under provisions of Section 177 of Companies Act, 2013 and as per Regulation 18 of Securities and Exchange Board of India (Listing Obligations and Disclosure Requirements) Regulations, 2015. "Board" means the Board of Directors of the Company. "Material Modification" shall mean an amendment to the terms of a transaction / agreement / commitment with / to a Related Party, the effect of which will be an increase over the approved limit for a transaction, by an amount more than Rs.10 (Ten) Crore in a financial year or 20% (twenty per cent) of the approved limit, whichever is higher. Provided that material modifications shall be deemed to include the following, without application of the above criteria: a) In case of a loan or deposit or any other means of funding, any deviation in the objects or purposes for which the loan or deposit was given or funding was made or received; b) In case of any other transaction or agreement, any amendment which will have an effect of: (i) deferring the consummation of such transaction or agreement by a period beyond one year from the existing approved term / period; or (ii) renewing or extending the term of the transaction or agreement for a period exceeding one year of its existing approved term / period. Provided further that any modification to the transactions / agreements entered into: a) for sale, purchase or supply of any goods or materials or availing or rendering of any services in the ordinary course of business and on arm's length basis; b) between the Company and its wholly owned subsidiary; c) transactions entered into between two wholly-owned subsidiaries of the Company, whose accounts are consolidated with the Company and placed before the shareholders at the annual general meeting for approval, shall be excluded from the applicability of above definition. "Material Related Party Transaction" means any transaction to be entered into individually or taken together with previous transactions during a financial year exceed the threshold specified in the Section IV of this Policy, dealing with Determination of Materiality of Related Party Transaction. "Related Party" means Party as defined in clause (zb) of sub-regulation (1) of Regulation 2 of the Listing Regulations. "Related Party Transaction" means transaction as defined in clause (zc) of sub-regulation (1) of Regulation 2 of the Listing Regulations. "Relative" means relative as defined under sub-section (77) of Section 2 of the Companies Act, 2013 and rules prescribed thereunder. "Transactions in the ordinary course of business" mean transactions or contracts or arrangements or activities that are connected to or necessary for the business of the Company and satisfy the following principles: (i) permitted under the Memorandum and the Articles of Association of the Company; (ii) carried on a frequent or regular basis or are usual in nature or are as per the customs or industry practice; and (iii) the terms of which are similar to those which would be otherwise applicable to transactions with unrelated parties. Transactions in the ordinary course of business shall cover the businesses of the Company and its subsidiaries and would include activities to be carried out incidental to or to facilitate the business of the Company and its subsidiaries. Any other terms and expressions used but not defined herein, shall have the same meaning as defined in the Companies Act, the Listing Regulations, and / or the rules and regulations made thereunder. III. REVIEW AND APPROVAL BY THE AUDIT COMMITTEE: 1. All Related Party Transactions and subsequent Material Modifications shall be subject to prior approval of the Audit Committee of the Company whether at a meeting or by a resolution by circulation or by any other manner as provided by the Companies Act or the rules and regulations made thereunder. Provided that only those members of the Audit Committee, who are Independent Directors, shall approve Related Party Transactions with effect from January 1, 2022. 2. The Audit Committee of the Board shall review and, if appropriate, approve Related Party Transactions. Accordingly, at the first meeting of the Audit Committee in every calendar year, management shall present to the Committee, the following information with respect to all Related Party Transactions expected to be entered into during the forthcoming financial year: a) the name of the Related Party; b) the Related Party's interest in the transactions, including the Related Party's position or ownership of or relationship with any entity that has an interest in the Related Party Transactions; c) the estimated rupee value of the Related Party Transactions; d) a general description of the transactions, including material terms and conditions; e) in case of loans, the aggregate amount of loans and the rate of interest payable on such loans; f) in case of guarantees issued, the aggregate amount of guarantees and commission to be payable on such guarantees; g) an assessment of whether the transactions are on terms that are comparable to the terms available to unrelated third parties or to employees generally (in case of appointment to any office or place of profit in the company, its subsidiary company or associate company, as per Section IV of this Policy); and h) any other material information regarding the transaction(s) or the Related Party's interest in the Related Party Transactions. 3. In determining whether to approve a Related Party Transaction, the Audit Committee will consider the following factors, among others, to the extent relevant to the Related Party Transaction: a) Whether the terms of the Related Party Transaction are fair and on arm's length basis to the Company and would apply on the same basis if the transaction did not involve a Related Party; b) Whether there are any compelling business reasons / rationale for the Company to enter into the Related Party Transaction and the nature of alternative transactions, if any; c) Whether the Related Party Transaction would affect the independence of an Independent Director; Whether the proposed transaction includes any potential reputational risk issues that may arise as a result of or in connection with the proposed transaction; d) Whether the Company was notified about the Related Party Transaction before its commencement and if not, why prior approval was not sought and whether subsequent ratification is allowed and would be detrimental to the interests of the Company; and e) Whether the Related Party Transaction would present an improper conflict of interest for any Director or Key Managerial Personnel of the Company, taking into account the size of the transaction, the overall financial position of the Director, Key Managerial Personnel or other Related Party, the direct or indirect nature of the Director's, Key Managerial Personnel's or other Related Party's interest in the transaction and the ongoing nature of any proposed relationship and any other factors the Board/Committee deems relevant. 4. After reviewing such information and being satisfied that there is a need for such approval, the members of the Audit Committee (without the participation of the Committee member(s) interested in the transaction, if any) shall approve or disapprove such transactions. 5. Omnibus approval for transactions shall be given only if it is determined by the Committee that such transactions are: a. repetitive in nature and that such approval is in (or not inconsistent with) the best interests of the Company and its shareholders; b. to be entered into by the Company on terms that are comparable to those that would be obtained in arm's length transactions with unrelated third parties; and c. in the ordinary course of business. The Audit Committee, while granting any such omnibus approvals, shall specify the following: (i) name of the Related Party; (ii) nature of transaction; (iii) period of transaction; (iv) maximum amount of transaction that can be entered into, and (v) indicative base price / current contracted price and the formula for variation in the price if any. The Audit Committee shall review, on a quarterly basis, the details of Related Party Transactions entered into by the Company, pursuant to each of the omnibus approvals given. Such omnibus approvals shall be valid for a period not exceeding 1 (one) financial year and shall require fresh approvals after the expiry of such financial year. Omnibus approval shall not be made for the transactions in respect of selling or disposing off the undertaking of the Company 6. The Company shall provide the following information, for review of the Audit Committee for approval of a proposed Related Party Transaction, other than the transactions for omnibus approval: a) Type, material terms and particulars of the proposed transaction; b) Name of the Related Party and its relationship with the Company or its subsidiary, including nature of its concern or interest (financial or otherwise); c) Tenure of the proposed transaction (particular tenure shall be specified); d) Value of the proposed transaction; e) The percentage of the Company's annual consolidated turnover, for the immediately preceding financial year, that is represented by the value of the proposed transaction (and for a Related Party Transaction involving a subsidiary, such percentage calculated on the basis of the subsidiary's annual turnover on a standalone basis shall be additionally provided); f) If the transaction relates to any loans, inter-corporate deposits, advances or investments made or given by the Company or its subsidiary: i. details of the source of funds in connection with the proposed transaction; ii. where any financial indebtedness is incurred to make or give loans, inter-corporate deposits, advances or investments: * nature of indebtedness; * tenure; * cost of funds; and iii. applicable terms, including covenants, tenure, interest rate and repayment schedule, whether secured or unsecured; if secured, the nature of security; and iv. the purpose for which the funds will be utilized by the ultimate beneficiary of such funds pursuant to the transaction. g) Justification as to why the transaction is in the interest of the Company; h) A copy of the valuation or other external party report, if any such report has been relied upon; i) Percentage of the counter-party's annual consolidated turnover that is represented by the value of the proposed transaction on a voluntary basis; j) Any other information that may be relevant. 7. No member of the Audit Committee shall participate in the review, consideration or approval of any Related Party Transaction with respect to which such member or any of his or her relatives is a Related Party. 8. If any material information with respect to such transactions shall change subsequent to the Committee's review of such transactions, management shall provide the Committee with updated information at a subsequent meeting and will get the changes approved afresh by the Committee. 9. If any additional Related Party Transactions are proposed to be entered into subsequent to the Committee's first meeting in the calendar year, the management shall present such transactions to the Committee for approval before entering into such transaction (which can be taken by calling a meeting or by resolution passed through circulation, if permitted). 10. All the Directors are required to declare and disclose their concerns or interests in any company(ies) or body(ies) corporate or firm(s) at the first Board meeting in every financial year and subsequently whenever there is any change therein. 11. Related Party Transaction to which the subsidiary of a Company is a party but the Company is not a party, shall require prior approval of the Audit Committee of the Company if the value of such transaction, whether entered into individually or taken together with previous transactions during a financial year: i. with effect from April 1, 2022, exceeds 10% (ten per cent) of the annual consolidated turnover, as per the last audited financial statements of the Company; OR ii. with effect from April 1, 2023, exceeds 10% (ten per cent) of the annual standalone turnover, as per the last audited financial statements of the subsidiary. Provided that the transactions entered into between two wholly-owned subsidiaries of the Company, whose accounts are consolidated with the Company and placed before the shareholders at the annual general meeting for approval shall be excluded from the requirement under this Clause 11. 12. The Audit Committee shall review the status of long-term (more than one year) or recurring Related Party Transactions on an annual basis. 13. If the Audit Committee determines that a Related Party Transaction is – a) A Material Related Party Transaction; or b) Not in the ordinary course of business; or c) Not on arm's length basis the Audit Committee shall place the matter before the Board for obtaining its approval, unless exempted. IV. DETERMINATION OF MATERIALITY OF RELATED PARTY TRANSACTIONS: Material Related Party Transactions shall be determined by applying the following criteria: \| Category of Transactions \| Materiality Thresholds under the Companies Act, 2013 (for transactions not in ordinary course of business and not on an arm’s length basis) \| \| \|---\|---\|---\| \| \| \| Materiality \| \| \| \| Thresholds under \| \| \| \| the Listing \| \| \| \| Regulations \| \| Sale, purchase or supply of any goods or materials \| 10% or more of turnover \| \| \| Selling or otherwise disposing of, or buying, property of any kind \| 10% or more of net worth \| \| \| Leasing of property of any kind \| 10% or more of turnover \| \| \| Availing or rendering of any services \| 10% or more of turnover \| \| \| company, its subsidiary company or associate company \| \| \|---\|---\| \| Underwriting the subscription of any securities or derivatives thereof, of the company \| 1% of net worth \| Explanation: (1) The turnover or net worth referred in the above shall be computed on the basis of the audited financial statement of the preceding financial year. (2) The threshold limits under the Companies Act, 2013 mentioned above shall apply for transaction or transactions to be entered into either individually or taken together with the previous transactions during a financial year. V. APPROVAL OF THE BOARD OF DIRECTORS: The Audit Committee shall report all Material Related Party Transactions & subsequent Material Modifications to the Board. Where approval of Board is required for any Related Party Transaction or if the Board in any case elects to reviews any such matter or it is mandatory under any law for the Board to approve the Related Party Transaction, then the considerations set forth above shall apply to the Board's review and approval of the matter, with such modification as may be necessary or appropriate under the circumstances. Any member of the Board who has any interest in any Related Party Transaction will recuse himself and abstain from discussion and voting on the approval of the Related Party Transaction. VI. APPROVAL OF THE SHAREHOLDERS: Unless exempted, the Company shall seek prior approval of shareholders for "Material RelatedParty Transactions and subsequent Material Modifications" in a general meeting in the year in which the Related Party Transaction is undertaken or by postal ballot process. The resolution shall be an ordinary resolution or such resolution as may be required by the Companies Act and the Listing Regulations and all the Related Parties (if any) will abstain from voting on such resolution irrespective of whether the concerned entity is a party to the particular transaction or not. The notice being sent to the shareholders seeking approval for any proposed Related Party Transaction shall, in addition to the requirements under the Companies Act and the Listing Regulations, include the following information as a part of the explanatory statement: 1. A summary of the information provided by the Company to the Audit Committee for approval of the proposed transaction; 2. Justification for why the proposed transaction is in the interest of the Company; 3. Where the transaction relates to any loans, inter-corporate deposits, advances or investments made or given by the Company or its subsidiary, the details as provided to the Audit Committee for approval of the transaction; 4. A statement that the valuation or other external report, if any, relied upon by the Company in relation to the proposed transaction shall be made available through the registered e-mail address of the shareholders; 5. Percentage of the counter-party's annual consolidated turnover that is represented by the value of the proposed transaction, on a voluntary basis; 6. Any other information that may be relevant. VII. DISCLOSURE BY THE COMPANY: This Policy shall be uploaded on the website of the Company and a web-link thereto shall be provided in the Annual Report of the Company. Disclosure will be made in the Company's Annual Report and to the Stock Exchanges as required under the Companies Act and the Listing Regulations. VIII. DISCLOSURE OBLIGATIONS OF DIRECTORS & KEY MANAGERIAL PERSONNEL: Every Director shall, at the beginning of the Financial Year or whenever any change occurs, provide information by way of written notice to the Company, regarding his concern or interest in the entity with specific concern to parties which may be considered as a Related Party with respect to the Company and shall also provide the list of relatives which are regarded as a Related Party as per this policy. Directors are also required to provide the information regarding their engagement with other entity during the financial year which may be regarded as a Related Party according to this Policy. Accordingly, the Company will determine whether a transaction does, in fact, constitute a Related Party Transaction requiring compliance with this Policy. The Company strongly prefers to receive such notice of any potential Related Party Transaction well in advance so that the Audit Committee / Board has adequate time to obtain and review information about the proposed transaction. IX. APPROVAL FOR UNFORESEEN RELATED PARTY TRANSACTIONS: Pursuant to Regulation 23(3) of the Listing Regulations, where the need for related party transaction cannot be foreseen and the details required to be disclosed are not available, the Audit Committee may grant omnibus approval for such transactions, subject to their value not exceeding Rs.1 Crore (Rupees One Crore Only). X. TRANSACTIONS WHICH DO NOT REQUIRE APPROVAL: Notwithstanding the foregoing, the following Related Party Transactions shall not require approval of Audit Committee: a. Any transaction involving the providing of compensation to a Director or Key Managerial Personnel in connection with his duties to the Company including the reimbursement of reasonable business and travel expenses incurred in the ordinary course of business. b. Any transaction in which the Related Party's interest arises solely from ownership of securities issued by the Company and all holders of such securities receive the same benefits pro rata as the Related Party. XI. RELATED PARTY TRANSACTIONS NOT APPROVED UNDER THIS POLICY: If a Related Party Transaction is entered into by the Company without being approved under this Policy, the same shall be reviewed by the Committee. The Committee shall evaluate the transaction and may decide such action as it may consider appropriate including ratification, revision or termination of the Related Party Transaction, to the extent permissible under the law. In connection with any review of a Related Party Transaction, the Committee has authority to modify or waive any procedural requirements of this Policy. XII. POLICY REVIEW: The Audit Committee may, for the purpose of aligning this Policy with the regulatory changes, amend any provision(s) or substitute any of the provision(s) with new provision(s) or replace the Policy entirely with a new Policy. The Board may also, based on the recommendations from the Audit Committee, make any amendments to the Policy from time. The Policy shall be reviewed by the Board at least once in every 3 (three) years and updated as may be required. In case of any amendment(s), clarification(s), circular(s) etc. issued by the relevant authorities, not being consistent with the provisions laid down under this Policy, then such amendment(s), clarification(s), circular(s), etc. shall prevail upon the provisions hereunder and this Policy shall stand amended accordingly from the effective date as laid down under such amendment(s), clarification(s), circular(s) etc. A note in relation to such changes shall be placed in subsequent meeting of the Board and the Audit Committee *******	<urn:uuid:18650790-1cf4-49b4-b4e3-fc8089e3dc90>	CC-MAIN-2022-49	https://www.astecls.com/Resources/pdf/codes-and-policies/PolicyonmaterialityofRelatedPartyTransactionanddealingwithRelatedPartyTransactionEffectivefrom1stApril2022.pdf	2022-11-29T21:32:21+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2022-49/subset=warc/part-00080-a0906200-461b-4808-9b94-6c53daf73f61.c000.gz.parquet	659,679,603	4,605	eng_Latn	eng_Latn	0.901806	eng_Latn	0.976001	[ "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 126, 945, 3737, 6421, 9434, 11883, 14364, 16182, 18125, 21003, 23285 ]
NOTICE OF CANCELLATION ALHAMBRA VILLAGE PLANNING COMMITTEE The ALHAMBRA VILLAGE PLANNING COMMITTEE meeting scheduled for Tuesday, June 25, 2024, at 6:00 p.m. has been CANCELED. For further information, please call Samuel Rogers, City of Phoenix Planning & Development Department, at 602-534-4010 or visit our website for public meeting notices and agendas at: https://phoenix.gov/cityclerk/publicmeetings/notices. Alhambra Village Information: https://www.phoenix.gov/villages/alhambra. To request a reasonable accommodation, please contact Teleia Galaviz at 602-2912559. TTY: Use 7-1-1.	<urn:uuid:2afba0cb-5d6a-49e5-ad15-f4f96605c9a7>	CC-MAIN-2024-30	https://www.phoenix.gov/cityclerksite/PublicMeetings/240625003.pdf	2024-07-18T05:40:36+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-30/subset=warc/part-00289-65338ae2-db7f-48fa-a620-71777c40d854.c000.gz.parquet	806,909,118	164	eng_Latn	eng_Latn	0.84025	eng_Latn	0.84025	[ "eng_Latn" ]	false	rolmOCR	[ 591 ]
Report to the Policy Committee. 15 TH November 2017 Agenda Item: 7 REPORT OF THE LEADER OF THE COUNCIL LOCAL IMPROVEMENT SCHEME - AN INTEGRATED FUNDING STRATEGY Purpose of Report 1. The purpose of this report is to seek approval for the opening and launch of a Local Improvement Scheme Integrated Funding Programme and Strategy 2018-21 to provide support to help Nottinghamshire communities to be vibrant and sustainable. Information and Advice 2. In line with the Council's strategic priorities – to put local people at the heart of everything it does and enable vibrant and supportive communities to grow – the Local Improvement Scheme Integrated Funding Programme and Strategy 2018-21 (Appendix 1) will contribute to supporting communities to be strong and resilient by: - Focusing on helping people to help themselves through encouraging volunteering and involvement in local organisations and charities, - Working in partnership to protect communities from crime and anti-social behaviour so people can be more confident about their safety, - Promoting healthier lifestyle choices, - Protecting and developing the local environment and heritage. Background 3. Grant Aid funding is a contribution to services/projects delivered by the Voluntary and Community Sector (VCS) that contribute to the Council's priorities. The County Council adopted a Corporate Grant Aid Strategy in 2011 to set out a transparent framework for engagement with the VCS, the allocation of Grant Aid and to: - Be Member led – ensuring that Members take a strategic lead on decision making, - Take a corporate approach – decisions are aligned to the Council's priorities, - Recognise the role of the VCS – valuing the enormous contribution made across the county, - Have centralised administration – a streamlined process for the administration of Grant Aid across the Council, - Be proportionate at all stages – simple application, 1 or 2 payments each year, simplified monitoring, - Make better use of IT – application and monitoring processes, - Have longer agreements – where possible awards to be for a period of 3 years to enable the VCS to forward plan, - Ensure that grants should contribute towards provision, not to directly purchase key services – making Grant Aid distinct from commissioning. 4. As agreed by Members, the strategy has been refreshed over the years to reflect changing corporate strategic priorities, including measures to address the budget situation. This has resulted in improved effectiveness and efficiencies. 5. The current Corporate Grant Aid programme has proven to be successful, with a wide and varied range of voluntary and community organisations having received funding and officer support. This 3 year programme ends 30 th June 2018, providing the opportunity to review the strategy and also bring the following pots of money; Corporate Grant Aid, Supporting Local Communities Fund, and Community Safety Commissioning and Initiatives Budget which the Council uses to support local communities, together into one place. The new amalgamated fund will bring together aspects of the above. Shaping the Future – Approach 6. The County Council has a strong record in supporting voluntary and community groups across Nottinghamshire and is committed to supporting local communities to help people help themselves and their communities. Building on this, the Council is bringing together its available discretionary funding in order to maximise existing resources and provide important opportunities to support local communities in making Nottinghamshire a great place to live, work, visit and relax. 7. The new Local Improvement Scheme Integrated Funding Strategy will consolidate the Council's approach to investing in and supporting local communities to be more resilient through encouraging active community support, volunteering and seeking wider funding opportunities. Consolidating these funds will remove any duplication and will ensure that targeted support for communities is provided in a single coherent strategy by: - Encouraging a more streamlined approach for the administration of discretionary grant funding, - Building on the importance to communities and people of the value and reach of this financial support, - Helping local people to feel more in control of work taking place to improve our communities through having a single point of access for funding opportunities as well as specifically targeted support, help and guidance, - Supporting Members in their roles as community leaders to respond to local ideas that bring community and economic benefit to Nottinghamshire. Key Features 8. The appendix attached to this report provides a strategy to support the best use of these funds, delivering value for money through outcomes-focused approaches which help to deliver the Council's priorities. The new Local Improvement Scheme Integrated Funding Strategy, in addition to maintaining good practice as outlined in paragraph 3 of this report, will: - Provide opportunities for communities to apply for capital and revenue funding. - Set a maximum per year for applicants for capital funding of £50,000 and £30,000 for revenue funding, with a minimum of £1,000 for each. - Maintain a 3 year funding commitment for revenue funding, subject to satisfactory monitoring outcomes. - Maintain an annual application process for capital funding, with an agreement that funding needs to be spent within 2 years of an application being awarded. - Offer an annual small grants fund to maintain support to talented athletes, with support from external clubs, and also provide opportunities for commemorating significant events for the communities of Nottinghamshire, globally, nationally and locally. - Encourage applications from partnerships of voluntary and community organisations seeking to deliver countywide activities/projects. Implementation and Communication 9. To launch the new Local Improvement Scheme Integrated Fund and encourage, receive, assess and approve applications, Committee is asked to approve the following timetable: - November 20 th 2017 – Launch of 2018-21 Local Improvement Scheme Revenue Funding Programme and 2018-19 Capital Programme, - Applications for both programmes closes on 8 th January 2018, - February 2018 – Annual Council Budget Meeting approves Fund allocation, - April 2018 – Communities and Place Committee considers applications for funding, - April 2018 – All applicants notified of decision. Unsuccessful applicants offered programme of support. 10. Appropriate communication of the Council's approach to supporting local communities and inviting applications for funding will be carried out. Other Options Considered 11. To cease providing this type of support; however the Local Improvement Scheme Integrated Funding Strategy will provide a clear focus for working with people to improve their communities by being part of well-networked communities and having the right support to play an active role in their neighbourhoods. Reasons for Recommendations 12. Maximising the impact of the Council's discretionary funding is important to achieving the Council's Strategic Priorities' ambitions. Statutory and Policy Implications 13. This report has been compiled after consideration of implications in respect of crime and disorder, data protection and information governance, finance, human resources, human rights, the NHS Constitution (public health services), the public sector equality duty, safeguarding of children and adults at risk, service users, smarter working, sustainability and the environment and where such implications are material they are described below. Appropriate consultation has been undertaken and advice sought on these issues as required. Financial Implications 14. The value of providing discretionary investment through grants for Nottinghamshire Voluntary and Community Sector (VCS) is important in supporting a diverse sector which plays a significant part in providing important services to individuals and communities across the county. The level of investment contributes to helping people to live in vibrant and supportive communities where they can be empowered to be creative, resilient, healthier and live independently for as long as possible. 15. Final funding allocations for this programme will be approved at the Council's annual budget meeting. RECOMMENDATIONS 1. To approve the Local Improvement Scheme Integrated Funding Strategy 2018-21 (see Appendix 1). 2. To launch the Local Improvement Scheme Integrated Fund, based on the timetable outlined in paragraph 9. Councillor Mrs Kay Cutts MBE Leader of the Council For any enquiries about this report please contact: Cathy Harvey, Community and Voluntary Sector Team Manager, T: 0115 977 3415 E: [email protected] Constitutional Comments (SLB 17/10/17) Policy Committee is the appropriate body to consider the content of this report. Financial Comments (SES 18/10/17) The financial implications are set out in the report. Background Papers and Published Documents None Electoral Division(s) and Member(s) Affected All For any enquires about this report please contact: Cathy Harvey 0115 977 3415	<urn:uuid:c826b389-7f49-4836-83de-4e4d7c540a45>	CC-MAIN-2024-30	https://www.nottinghamshire.gov.uk/DMS/Document.ashx?czJKcaeAi5tUFL1DTL2UE4zNRBcoShgo=jgLMRuMsyzRm0Q%2F0T8VsbcMikk7npREo7li4gy757R9UwgPNK4f7vA%3D%3D&rUzwRPf%2BZ3zd4E7Ikn8Lyw%3D%3D=pwRE6AGJFLDNlh225F5QMaQWCtPHwdhUfCZ%2FLUQzgA2uL5jNRG4jdQ%3D%3D&mCTIbCubSFfXsDGW9IXnlg%3D%3D=hFflUdN3100%3D&kCx1AnS9%2FpWZQ40DXFvdEw%3D%3D=hFflUdN3100%3D&uJovDxwdjMPoYv%2BAJvYtyA%3D%3D=ctNJFf55vVA%3D&FgPlIEJYlotS%2BYGoBi5olA%3D%3D=NHdURQburHA%3D&d9Qjj0ag1Pd993jsyOJqFvmyB7X0CSQK=ctNJFf55vVA%3D&WGewmoAfeNR9xqBux0r1Q8Za60lavYmz=ctNJFf55vVA%3D&WGewmoAfeNQ16B2MHuCpMRKZMwaG1PaO=ctNJFf55vVA%3D	2024-07-18T06:17:19+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2024-30/subset=warc/part-00122-65338ae2-db7f-48fa-a620-71777c40d854.c000.gz.parquet	794,745,985	1,711	eng_Latn	eng_Latn	0.967185	eng_Latn	0.99582	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2034, 4900, 7189, 9088, 9218 ]
1 Wednesday, 19 December 2018 2 (10.07 am) 3 MR KHAW: The next witness is -- 4 CHAIRMAN: I notice a festive air in the front row. 5 MR KHAW: Yes. 6 CHAIRMAN: I'm sorry, Mr Khaw. Please continue. 7 MR KHAW: Mr Pennicott has a tie for Christmas already. 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Also, I have been told by colleagues of Mr Lok that whenever he says, "It's okay", he usually means, "You are welcome", but I'm not sure what he said yesterday falls within the general rule of exceptions. Mr Lok, can you confirm that your full name is Lok Pui Fai? WITNESS: (In English) Correct. MR LOK PUI FAI, ANDREW (sworn in Punti) (All answers given via simultaneous interpreter except where otherwise specified) Examination-in-chief by MR KHAW MR KHAW: I understand you would like to give your evidence in Cantonese; is that correct? A. Correct. Q. For the purpose of this Inquiry, you have made one 23 witness statement. If we can have a look at H7/2187, 24 you can see your witness statement there. 25 A. Yes, I can see that. 1 Q. It's not a short statement. It consists of about 2 27 pages. 3 If we can turn to 2213, we can see that this is your 4 statement dated 13 September this year; do you see that? 5 A. That's correct. 6 Q. You confirm that you put your signature at the end of 7 this statement? 8 A. (In English) Confirm. 9 Q. You confirm that the contents of this statement are true 10 to the best of your knowledge, information and belief? 11 A. I can confirm that. 12 Q. You would like adopt the contents of your statement as 13 your evidence for the purpose of this Inquiry? 14 A. Yes. 15 MR KHAW: As you may know, the gentleman in front of me, 16 Mr Pennicott, who has a very Christmassy tie today, will 17 ask you some questions first, and then lawyers acting 18 for other parties may have some questions for you, so 19 please remain seated. 20 WITNESS: I understand. 21 Examination by MR PENNICOTT 22 MR PENNICOTT: Good morning, Mr Lok. 23 A. (In English) Good morning. 24 Q. Thank you very much for coming back today to give 25 evidence to the Commission. As Mr Khaw has indicated, Page 1 Page 2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Page 3 my name is Ian Pennicott. I have a few questions for you, not too many, and then maybe others will have questions for you as well, and of course the Chairman and the professor may also have questions. Mr Lok, could we first of all look at H7/2657. If we look at the left-hand side of this organisation chart, which is said, as you can see at the top, to be from 10 January 2012; do you see that? A. Yes, I see that. Q. If we look at the left-hand side, under the Government Engineer, then there's the Chief Engineer. Then if one goes to the right, one sees the box where it says "Senior Structural Engineer/Railway Development"; do you see that? A. Yes, I see that. Q. My understanding is that that is the position which you occupied from 12 January 2016; is that correct? 18 A. Correct. 19 Q. As I understand it, your predecessor in that position 20 was Mr Wong Wing Keung; is that correct? 21 A. Correct. 22 Q. Prior to taking up your position on 12 January 2016, 23 Mr Lok, what position did you hold prior to that date? 24 A. Prior to that, I was a senior structural engineer of the 25 Existing Buildings in the Buildings Department. So Page 4 1 Buildings Department, Existing Building Division, that 2 was the post I held before 2016. 3 Q. Yes. In that role, in that position, did you have any 4 involvement in the SCL project? 5 A. No. 6 Q. Right. So it's only since January 2016 that that 7 involvement -- that's when your involvement started? 8 A. Correct. 9 Q. All right. Can you tell me this: during Mr Wong's 10 tenure, before you took over, do you know who the 11 structural engineer was, that is Mr Wong's subordinate? 12 A. (In English) Before Mr Wong? 13 Q. No, no, when Mr Wong was there, before you took over, 14 who was the structural engineer, if you know? 15 A. For SCL, there was a colleague, a structural engineer, 16 with the next of Alex Hung. 17 Q. Right. Did he remain in post when you took over? 18 A. Let me say this. There were two posts. First, senior 19 structural engineer, it was Mr Wong Wing Keung, and then 20 I took up the post after Mr Wong Wing Keung, and 21 I became the senior structural engineer. 22 As for the structural engineer, it was Alex Hung. 23 He occupied the post of structural engineer. Then, 24 after him, it was Patrick Fan. Actually, I belonged to 25 the BO team as well, but between 2009 and 2013 I worked Page 5 1 on the XRL. 2 Q. Understood. When did Mr Patrick Fan take over from Alex 3 Hung? 4 A. Correct, yes. 5 Q. When? 6 A. It was May 2018. 7 Q. All right, very recently. 8 A. Yes. 9 Q. All right. And, as I understand it, Mr Lok, when you 10 took over, in January 2016, one of your primary duties 11 was the vetting of structural-related building 12 submissions, both of the XRL and the SCL; is that right? 13 A. Yes, mainly the structural aspect submissions. 14 Q. Right. We'll see an example of that in a short while. 15 As I understand also from your witness statement, 16 you were responsible for supervising the Pypun BSRC 17 team; is that right? 18 A. Right. 19 Q. Is this right, that you and your structural engineer 20 21 colleague, Alex Hung, as it would have been, gave instructions to Pypun as to the works that they should 22 carry out? 23 A. Right. 24 Q. Just so that we can see a typical, perhaps, example of 25 such an instruction, albeit before the time that you Page 6 1 took up your role, can we just look at K1/822, please. 2 We can see that this is a document headed "Highways 3 Department, Railway Development Office". There's 4 a reference to the consultancy agreement with Pypun and 5 the assignment number; it's obviously addressed to 6 Pypun. Then if we could see what it says -- it says: 7 "Please check and provide structural comments for 8 the following submission", and then the details are 9 given. 10 In the "Remark" column we see: 11 "Please return comments by 30 March 2015." 12 And we can see that it's signed at the bottom of the 13 page by Alex Hung. 14 A. Yes. 15 Q. Is this a typical example of an instruction to Pypun? 16 A. Yes, that is a typical example. 17 Q. Would one of these instructions be issued as a matter of 18 course for all the tasks that Pypun were required to 19 carry out with regard to analysing or providing comments 20 on submissions? 21 A. We would mainly issue an assignment form. Sometimes we 22 would make telephone calls or use emails to inform them. 23 After Pypun has received the information, they would 24 follow our instructions. Say, for example, on 25 submissions, we would make comment. If it's a site Page 7 1 visit, they would make arrangements. 2 Q. Okay. So I think the answer is that it wouldn't 3 necessarily follow that this type of relatively formal 4 instruction would be issued; there may be other means by 5 which -- 6 A. Yes, it may be by email or by telephone. 7 Q. Yes, I see. All right. 8 A. Let me add that if it's consultation submissions, we 9 10 11 12 13 14 15 16 17 18 would issue assignment form for record purpose. Q. Okay. Do you agree, Mr Lok, with Mr Yueng of Pypun when he says that the BSRC team would only carry out a specific audit, site inspection, or deal with a submission that we've just seen an example of, on the instruction of BD? A. You may put it this way. We give them instructions and then they would do what we require them to do. That is, they would only carry out site inspections, site audits and site visits upon our instructions. 19 Q. And only review and comment upon submissions if you gave 20 them the type of instruction that we've just looked at? 21 A. There are some site witness. Maybe it's done by email 22 or telephone. There may not be an assignment form. 23 Q. All right. To what extent -- obviously you can only 24 speak from your experience from January 2016 onwards, 25 Mr Lok -- but in your experience, thinking back, to what Page 8 1 extent were Pypun proactive in making suggestions to the 2 Buildings Department or to the BO team about things that 3 should be done? 4 A. Well, by "proactive", it means that we give them 5 an assignment to act in accordance with BO requirements. 6 They would ask us for all the information that were 7 relevant, to make sure that they would be able to follow 8 the BO requirements. 9 Q. All right. But there was never a question, is this 10 right, of Pypun coming to you, the BD, and saying, "We 11 think an audit should be carried out on this aspect of 12 the work", or "We think a site inspection should be 13 carried out for this reason"? Was there any of that or 14 not? 15 A. (In English) Can you repeat the question? 16 Q. Yes, sure. Was there ever, to your knowledge, 17 obviously, a situation where Pypun would come to you and 18 say, "We think a site audit ought to be carried out on 19 this aspect of the works"? 20 A. When it comes to site audits, you can refer to PNAP 21 ADM-18. There is appendix 1, listing out a number of 22 items. We would mainly follow the items. We would ask 23 Pypun to conduct the audit according to these items. 24 Q. Right, but as far as site inspections are concerned, did 25 they ever suggest to you that they ought to carry out 1 2 Page 9 an inspection under a particular contract at a particular time? Have you had any experience of that? 3 A. For site inspections, we would first look at the 4 type/nature of the site and complexity and the 5 frequency. We would look at a number of things, 6 7 8 9 10 11 12 13 14 15 16 17 18 including public safety concern, if any, if there is any concern expressed by the media, or if MTRC or Pypun has, during meetings or on other occasions, expressed a need, we would arrange for a site inspection. Q. All right. Because in your witness statement at paragraph 1(3) at page 2187 you say: "My duties include, amongst other things", and then it's (3): "providing structural advice on site matters and conducting joint site inspection with SEs if and when necessary ..." Then in paragraph 28 of your witness statement, you say: 19 "Site inspection by the BO team and the BSRC team 20 will be carried out as needed ..." 21 A. Yes. 22 Q. I was wondering how you determined whether and when 23 there was a need; when did it become necessary? 24 A. As I mentioned in paragraph 28, if there were public 25 safety issues, and if some of our colleagues might have Page 10 1 spotted areas of concern, say for example certain types 2 of work were being carried out at the site or the media 3 4 5 expressed a concern -- let me give you an example. In March 2018, in the North Approach Tunnel at the stitch joint, there was a problem. At that time, we carried 6 out one site inspection. 7 Q. Yes. So, if I've understood it, then, there's -- in 8 terms of audits, there's a fairly well-defined regime 9 within the Pypun contract and the agreement you have 10 with them about site audits, but the actual subject 11 matter of the audit would be determined by the Buildings 12 Department? 13 A. Right. 14 Q. So far as site inspections are concerned, those would be 15 needed when something, some issue or problem, was drawn 16 to your attention by your colleagues dealing with 17 a particular contract; is that a fair way of putting it, 18 Mr Lok? 19 A. Yes. 20 Q. All right. 21 Could we look at your helpful exhibit LPF-7, which 22 I think is in H10, at page 4791. 23 This, as I understand it, Mr Lok, is a list that you 24 have prepared or perhaps supervised the preparation of, 25 and it's based upon, presumably, your records? 1 A. Our records, yes. 2 Q. Yes. It's a list of site inspection, site audit and 3 site witness record in relation to contract 1112? 4 A. Yes. 5 Q. And those inspections and audits having been carried out 6 by both Pypun and the BO team? 7 A. Right. 8 Q. I think it's evident, is it not, from the records, and 9 the list that you prepared here, that there was no site 10 inspection carried out by the BO team and Pypun when the 11 EWL slab was being constructed under contract 1112? 12 A. EWL slab, according to the record, there was no 13 inspection. However, at the time of the diaphragm wall 14 being constructed, we conducted a site visit of -15 a site witness. 16 Q. Yes, certainly back in 2014, Mr Lok, the records show 17 that there was indeed a degree of focus on the diaphragm 18 walls. 19 A. Yes. 20 Q. Because the very first entry on your list, on 9 July 21 2013, was a site inspection where "checking monitoring 22 for D-wall construction" took place; yes? 23 A. Yes. 24 Q. And we also know that on 21 January 2014, item 7, there 25 was an inspection for the diaphragm wall excavation. Page 12 1 A. Yes. 2 Q. We also know, because we looked at this with Mr Yueng, 3 that there was indeed a site audit in relation to the 4 couplers on 22 and 24 January, which is also shown on 5 your chart or your list. 6 A. Yes. 7 Q. During that period and indeed a bit further on, on 8 15 July 2015, at item 30 -- this is on the next page -9 there was also a site inspection for the barrettes. 10 A. Right. 11 Q. All right. Now, in terms of site audits, we've seen the 12 13 coupler audit done in January 2014 and, as I understand it, no other audit was done on contract 1112 until April 14 of this year, when you did an audit on the 15 superstructure works; is that right? 16 A. Yes. 17 Q. So there was -- sorry -- 18 A. I'd like to take a look, because some were called hammer 19 test audits. Can I please look at the next page? 20 Q. Yes, of course. 4793. What are we looking for, 21 "hammer"? 22 A. (In English) 50- -- 23 Q. The next one, 4794. 24 A. Actually, there were some audits that were called 25 rebound hammer tests. This is to check the strength of Page 11 Page 13 1 the concrete. 2 Q. Right. I can see a couple of references, Mr Lok. There 3 is one at 51, which is the hammer test for the 4 transformer building. 5 A. Yes. 6 Q. Does that have anything to do with either of the slabs? 7 A. Not for slabs. This is really for columns and vertical 8 members. 9 Q. Understood. 10 CHAIRMAN: And 59 -- 11 MR PENNICOTT: And 54 and -- 12 CHAIRMAN: 59. 13 MR PENNICOTT: 54, 56 and 59, yes, indeed -- a number of 14 hammer tests? 15 A. Yes. 16 MR PENNICOTT: I see. 17 CHAIRMAN: What is a hammer test? 18 MR PENNICOTT: A good question, sir. 19 CHAIRMAN: Sorry, you were probably going to ask it in the 20 next question. 21 MR PENNICOTT: I might have done! 22 A. This is for testing the strength of the concrete. 23 Q. Yes. We can see -- thank you for pointing this out -- 24 that there was a hammer test for the EWL platform at OTE 25 level on 7 July 2017, so that would have been two years Page 14 1 or so -- not quite two years -- about 18 months after 2 the completion of the EWL slab. Is that the sort of 3 time lag that takes place for this sort of test, or 4 perhaps you were going to explain what it is as well? 5 A. The tests done at site audits usually followed the 6 practice note ADM-18. Hammer test is included in that 7 practice note. The EWL slab and the columns should have 8 been completed before the audit or the test could take 9 place. It would depend on the progress of the 10 construction works. We can do this only after the 11 column is completed. 12 So the time line is you need to complete the column 13 before you can do this test. 14 Q. Right. You say it's to test the strength of the 15 concrete. Is it done in a number of different locations 16 along the EWL slab, or a specific location? What 17 happens? 18 A. We would choose locations randomly, usually on the 19 columns, that we would do a random selection. In other 20 words, we don't do it on the slab but on the columns. 21 Q. Right. So when it says "Hammer test for EWL slab -- 22 platform & OTE level", is that a slight misdescription? 23 You're talking about the columns -- 24 A. Yes. 25 Q. -- on the EWL slab? 1 A. Yes. 2 Q. All right. And in terms of your own personal site 3 inspections, Mr Lok, leaving aside this year, 2018, 4 where you have obviously made a number of visits more 5 6 7 recently, for obvious reasons, I've only managed to find one reference, which is number 53 on page 4794, when you apparently carried out a general site inspection; do you 8 see that? 9 A. I can see that. 10 Q. Do you recall whether that event, that site inspection, 11 was triggered by anything in particular, or not? 12 A. My intent was to go to the site, take a walk and see the 13 progress on site. Because I took up the post in January 14 2016, I wanted to seek an understanding into the 15 condition on site. 16 Q. All right. Understood. 17 18 19 Mr Mok, I believe that you were aware, would have been aware when you took up your post, that there was a quality supervision plan, a QSP, in relation to 20 coupler installation and in relation to, in particular, 21 the rebar connections to the diaphragm walls. 22 A. I understand. 23 Q. You probably understand also that that quality 24 supervision plan was required as a condition of the 25 Buildings Department acceptance of the MTRC's proposals? Page 16 1 A. Yes. 2 Q. And what that QSP did was enhanced the supervision that 3 was required under the Code? 4 A. Yes. It is task-specific. 5 Q. Yes. It essentially identified a known risk area, would 6 you agree with that, or potential risk area? 7 A. I can only say that we have a requirement on couplers. 8 It is a BO requirement. 9 Q. Right. Do you think it would have been an ideal subject 10 matter for an audit, that is the connections of the 11 rebar to the couplers on the diaphragm wall? 12 13 A. Actually, according to PNAP ADM-18, coupler is not an audit item. 14 15 16 17 18 19 20 21 Q. Okay. So you were relying on PNAP 18? A. We mainly follow PNAP ADM-18, but at the same time, in 2014, we went to do two coupler audits. So we do not necessarily have to just follow the ADM-18. If there is a need, we can do something else. Q. All right. Just going on from there, Mr Lok, can we please look at H10/5061. On 22 January 2016, so some ten days after 22 you had taken up your post, the MTR submitted a batch of 23 documents, including a completion certificate, of the 24 diaphragm wall batch 6. That was submitted to your 25 colleague from whom we heard yesterday, Mr Humphrey Ho. Page 15 1 A. Yes. 2 Q. If we go to page H10/5073, we see that what was 3 submitted included a quality supervision report for the 4 diaphragm wall and barrettes; do you see that? 5 A. Yes, I see that. 6 Q. If you turn over the page, we see on 5074 the quality 7 supervision report is signed off by Mr Jason Wong as the 8 competent person; do you see that? 9 A. I see that. 10 Q. Then if we go to the next page, please, 5075, we see the 11 first sheet of the inspection records, or inspection 12 record summaries, which run on -- if you've got the hard 13 copy there, it will be easier -- for a number of pages 14 for each of the diaphragm wall panels; do you see that? 15 A. I see that. 16 Q. What we can see here, in relation to -- let's just focus 17 on 5075 for the moment -- if we go down, we've got EH87; 18 do you see that? 19 A. Yes. 20 Q. So we've got the panel number. We've then got each cage 21 identified, so it looks as though EH87 had 15 cages; do 22 you see that? 23 A. Yes. 24 Q. Then we've got the inspection dates of each of the 25 cages, and then the result, "Satisfactory" result; do 1 you see that? 2 A. Yes, I see that. 3 Q. As I understand it, we've got those -- those records 4 are, as we know -- sorry, this summary is taken from 5 records that we've seen, contemporary records, and 6 summarised on this sheet. 7 A. Yes. 8 Q. I think you became aware of these documents because if 9 we go to page 5148, you responded to this submission 10 yourself, Mr Lok. We can see that on page 5150. 11 A. Yes. 12 Q. In your capacity as the senior structural engineer at 13 that time. So you would have looked, as I say, at those 14 quality supervision reports? 15 A. Yes. 16 Q. In relation to your consideration of the submission, 17 that would have been done jointly with Pypun or ...? 18 A. Pypun helped us to check the as-built submissions. 19 Q. All right. But you did your own independent check 20 yourself, Mr Lok? 21 A. After Pypun has done the checking, they will give to the 22 structural engineer, Alex Hung, for checking. Then, 23 after that, he will let me sign the letter. That's the 24 process. 25 Q. Right. But would you personally review the materials, Page 17 Page 18 Page 19 1 the documents that have been submitted, such as the 2 quality supervision report? 3 A. Yes, I have read them. 4 Q. Okay. This is a sort of slightly hypothetical question, 5 Mr Lok, but can you help us with this. At some point, 6 there will need to be a BA14 submission in relation to 7 the EWL slab; do you agree? 8 A. (In English) Can you say again? 9 Q. Yes. At some time, there will need to be, from MTR, 10 a BA14 submission in relation to the EWL slab? 11 A. The EWL slab -- BA14 is in relation to the certificate 12 of completion submission, but so far it hasn't been 13 submitted yet. 14 Q. I appreciate it hasn't been submitted, but it will need 15 to be submitted at some point? 16 A. Yes, in the end it has to be submitted. 17 Q. Right. Now, in relation to the -- let's focus on the 18 EWL slab. What documents will the Buildings Department 19 expect to see in relation to the quality supervision of 20 that element of the works? 21 A. We would make reference of the appendix of the 22 acceptance letter in relation to mechanical coupler 23 requirements. It includes quality supervision report. 24 Therein, there is a statement signed by the CP 25 confirming the work that has been done, confirmation of Page 20 1 [disputed translation; may be "compliance with"] the BO 2 requirement, also confirmation of the site logbook and 3 the coupler checklist. There are also other 4 requirements, including test reports; they also have to 5 be submitted to us. 6 7 Apart from couplers, for the EWL slab as-built plan, it has to be submitted to us as well. 8 Q. Yes. I understand about the as-built plans. I'm just 9 focusing on what you would expect to see in terms of 10 quality supervision. 11 A. Right. 12 Q. And I think, broadly speaking, you would expect to see 13 14 15 16 17 18 19 20 something perhaps not too dissimilar to what we saw in relation to the diaphragm walls; is that right? A. They would give us the checklist of couplers, including quality control supervisor and contractor's quality control coordinator; those checklists would have to be given to us. MR PENNICOTT: Okay. Thank you very much. Sir, thank you very much. I have no more questions 21 for Mr Lok. 22 CHAIRMAN: Thank you very much. 23 MR SHIEH: Subject to the same caveat yesterday in relation 24 to not questioning a factual government witness on 25 matters of structure/foundation, et cetera, I have no Page 21 1 questions. 2 CHAIRMAN: Thank you. 3 MR SO: No questions from China Technology. 4 MR CONNOR: No questions from Atkins. Thank you, sir. 5 MR BOULDING: I adopt the same caveat as Mr Shieh, and on 6 that basis, no questions. 7 CHAIRMAN: Thank you. 8 MR KHAW: No re-examination. 9 MR COLEMAN: Even without a caveat, no questions. 10 CHAIRMAN: Good. Is there any -11 COMMISSIONER HANSFORD: No, nothing from me. 12 CHAIRMAN: Would I be correct to say, then -- just so that 13 I understand the position -- that Pypun carried out 14 specific audits and specific inspections, but only with 15 and under the instructions of the Buildings Department? 16 A. Right. 17 CHAIRMAN: Thank you very much indeed. I have no further 18 questions. 19 WITNESS: (In English) Thank you. 20 CHAIRMAN: Thank you, Mr Lok, and thank you for having to 21 come back today. Thank you very much. Your evidence is 22 now completed. 23 WITNESS: Thank you. 24 (The witness was released) 25 MR KHAW: Mr Chairman and Professor, that completes the Page 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 government's factual evidence. CHAIRMAN: Good. Excellent. Thank you. MR PENNICOTT: Sir, it does indeed, but subject to this caveat: that I need again, for the purposes of formality and completeness, just to say this, that three government witnesses who were going to be called are no longer going to be called, and they are to be added to the list that I read out a few days ago. They are Fan Tak Pun, whose witness statement is at H20/44018; Wong Wing Wah, whose witness statement is H20/40112; and Fung Lim Cheung, whose witness statement is at G13/10873. I should also add, again for the sake of formality, that as you will recall one of the witnesses from Atkins was also not required to be called and questioned. His name is Chan Chi Kong and his witness statement is at J6/4502. All of those witness statements will be uploaded onto the Commission's website in the usual way. CHAIRMAN: Good. Thank you. MR KHAW: Sorry, Mr Chairman, just perhaps one minor correction in relation to the transcript. It's [draft] page 20, line 12. It says: "... there is a statement signed by the CP confirming the work that has been done, confirmation of Page 23 ``` 1 BO requirement ..." 2 I believe it should be "compliance of the BO 3 requirement" instead of "confirmation of the BO 4 requirement". 5 CHAIRMAN: Thank you. Good. 6 Concerning the directions given yesterday about 7 final submissions, are there any applications or 8 concerns? 9 MR BOULDING: Sir, I have a question and a suggestion. 10 CHAIRMAN: Yes. 11 MR BOULDING: So far as the question is concerned -- and 12 I don't expect an answer today -- we would find it 13 helpful to know in due course what the order of the oral 14 submissions will be. No need for it today but in due 15 course we will need to know that. 16 CHAIRMAN: Yes. 17 MR BOULDING: We are content with the directions you have 18 handed down. So I come to my suggestion. I know how 19 busy people like you are, and you have to work on 20 trains, planes, and so on and so forth. I wonder 21 whether, in addition to 100 pages, it might be useful to 22 you to have a box file per submission with all the very, 23 very key documents in it. It's just a suggestion. 24 MR PENNICOTT: Sir, this is a matter that Mr Boulding was 25 kindly able to share with me last night. Sir, I think ``` Page 24 1 in principle it's a good idea. What I would, however, 2 encourage -- and I think this was being emphasised by 3 Mr Boulding in what he just said -- is that it really is 4 the key documents, or the key part of the transcript, 5 and it is limited to a box file. We don't, with 6 respect, want a 100-page submission turning up with 7 10 lever-arch files. It really must be key documents. 8 I think if it's limited to that, the suggestion will be 9 extremely helpful. 10 CHAIRMAN: We are both taken with that idea, because it 11 really does help us. 12 13 MR PENNICOTT: Yes. I don't think it's compulsory but if parties wish to do so. 14 15 16 17 18 19 CHAIRMAN: Absolutely, yes. We are not suggesting that they should, but it does help us because instead of having to go to a very large volume of documents and try to find out way around -- and we won't have this sort of benefit with us on a day-to-day basis -- so that would help very much. 20 COMMISSIONER HANSFORD: I assume that we don't need to 21 define the dimensions of the box? 22 MR BOULDING: A good question, Professor! 23 I'm grateful for that indication, that you find it 24 25 helpful. It also it seems to me that it will be helpful to people like myself and my learned friends, because Page 25 1 obviously we've got to read each other's submissions, 2 and if there is a box file of very, very key documents 3 that we can just look at, that will save a lot of time 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 and effort in terms of locating them. So we will proceed on that basis, sir. CHAIRMAN: Yes. MR PENNICOTT: In anticipation of you agreeing to that proposal, I took instructions from those instructing me this morning, and they have indicated that any party who should take that step of providing the box file, we would be grateful if it could be served both in hard copy and soft copy. CHAIRMAN: All right. I think today that's not too difficult. But again, there's no obligation on anybody to do this, but it would be very helpful as far as Prof Hansford and I are concerned. Any further applications? MR SHIEH: One question. At present, we are advised that the end date for all the hearings would be 29 January, which is a Tuesday. CHAIRMAN: That's right. MR SHIEH: From the time limits given by the Commission yesterday in relation to oral submissions, do I take it that the oral submissions would take place on 28th and 29th, which would be Monday and Tuesday? Page 27 1 have adjourned, and we will do so -- there's a room 2 here, so we can all meet. There's just a couple of 3 matters, or a single matter, actually, we wish to 4 discuss with counsel, purely and simply on 5 an administrative basis. It's a Commission of Inquiry. 6 Sometimes, we think that the way forward can best be 7 decided if we have the assistance of all counsel. So we 8 will gather as soon as we adjourn; all right? 9 10 11 12 There's no need for the solicitors to come. That's not in any way to say that their assistance is not always of the greatest help, but we have seating limitations and the like. 13 14 15 16 17 18 19 20 21 22 23 24 25 Page 26 Thank you very much. May I wish everybody a very good festive season and I relish the prospect of seeing you in the New Year. Thank you. (10.58 am) (The hearing adjourned until 10.00 am on Wednesday, 9 January 2019) INDEX PAGE MR LOK PUI FAI, ANDREW (sworn in Punti) ..............1 Examination-in-chief by MR KHAW ..................1 Examination by MR PENNICOTT ......................2 (The witness was released) ......................21 Page 28	<urn:uuid:96cca222-4905-4e2f-9906-de23ae380898>	CC-MAIN-2023-50	https://www.coi-hh.gov.hk/pdf/transcript_20181219.pdf	2023-12-10T23:23:16+00:00	s3://commoncrawl/cc-index/table/cc-main/warc/crawl=CC-MAIN-2023-50/subset=warc/part-00159-e565b809-b335-4c1d-90fd-54a9a2b7113d.c000.gz.parquet	763,434,306	8,359	eng_Latn	eng_Latn	0.998716	eng_Latn	0.998836	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 4657, 9514, 14123, 18754, 23447, 28219, 30623 ]
KS Dept of Health & Environment 1000 SW Jackson St, Ste 340 Topeka, KS 66612-1365 Telephone: (785) 296-1200 Fax: (785) 296-1231 Website: www.ksfhp.org www.facebook.com/ksfhp Volume 8, Issue 1, February 2013 Migrant Clinicians Network has designed this Clinician Orientation to Migration Health for new as well as seasoned clinicians who are interested in understanding more about the migrant population. The orientation is divided into a series of seven webinars which cover a wide breadth of knowledge and skills to help clinicians provide quality care to one of the most difficult to reach populations in the U.S. Each module consists of a 1-hour webinar presented by experts in the field of migration health. Accompanying the webinars are topic-specific handouts as well as links and resources for those who want even more in-depth information about the topic. Emphasis is placed on practical solutions to the difficulties that arise at the intersection of migration, poverty and health. Continuing Nursing or Continuing Medical Education credits are available. REGISTER FOR ALL 7 WEBINARS HERE Please notify billing personnel to submit bills promptly after service to facilitate timely payment. Bills with a date of service prior to 12/1/2012 should be submitted before February 15, 2013. KSFHP is accepting bills for Farmworker services on 12/1/2011 or after and TB services on 7/1/2011 or after. If you have questions, please contact your Regional Case Manager or the Program Director. Kansas Statewide Farmworker Health Program (KSFHP) recently presented the first annual Champion of Farmworker Health Award to Dr. Anita Murray-Clary, DDS of Pediatric Smiles Dental Clinic in Topeka. Dr. Murray-Clary has partnered with KSFHP to help children of farmworkers access needed dental services. Patricia Fernandez, a KSFHP case manager, nominated Dr. Murray-Clary for the award after seeing firsthand the excellent dental care that her clients were receiving. Finding providers that will work with our program to help uninsured Farmworkers can be a challenge. We are grateful to Dr. Murray-Clary for her support to KSFHP and farmworker families to ensure quality dental care. Pediatric Smiles is a Champion of Farmworker Health. KSFHP Staff Program Director Cyndi Treaster [email protected] Office: (785) 296-8113 Administrative Specialist Sarah Beery [email protected] Office: (785) 296-6028 Regional Case Managers Western: English/Low German Tina Guenther [email protected] Office: (620) 275-4970 Cell: (620) 952-1470 Fax: (620) 275-7026 Western: English/Spanish Mary Marquez [email protected] Office: (620) 225-1873 Cell: (620) 428-1762 Fax: (620) 225-2422 Central: English/Spanish Patricia Fernandez [email protected] Office: (785) 296-8983 Cell: (620) 617-7428 Fax: (785) 296-1231 Eastern: English/Spanish Kendra Baldridge [email protected] Office: (785) 296-2671 Cell: (816) 590-7577 Fax: (785) 296-1231 Website: www.ksfhp.org www.facebook.com/ksfhp KSFHP staff is in the process of distributing the 2013 calendars. This year's focus is program eligibility. If you would like calendars or brochures for your clinic or agency, please contact your Regional Case Manager (contact information is on the left hand side of this page). KSFHP staff and Advisory Council met in Wichita on November 27, 2012 for the annual Strategic Planning meeting. There was much discussion about plans for the coming year and beyond. It was a great time to catch up on the latest news and to brainstorm about the future of KSFHP. The work plan for 2013 was discussed and has since been finalized. KSFHP staff have developed a "Healthy Weight Curriculum" to present to farmworker families in their own language. This information can be shared with individuals or groups. The curriculum includes information from www.choosemyplate.gov , a bi-lingual comic book, as well as other resources. This is a flexible program that can be beneficial to a full range of individuals. If you know of a farmworker who would benefit from this information, please contact your Regional Case Manager to set up an appointment!	<urn:uuid:4200f635-47fd-4a85-9b22-28e90763c494>	CC-MAIN-2019-22	http://www.kdheks.gov/olrh/download/FW_Vol8Issue1_Feb2013.pdf	2019-05-25T23:54:49Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232258453.85/warc/CC-MAIN-20190525224929-20190526010929-00287.warc.gz	297,475,587	1,010	eng_Latn	eng_Latn	0.975629	eng_Latn	0.984516	[ "eng_Latn", "eng_Latn" ]	false	rolmOCR	[ 2241, 4143 ]
Appendix H WSliq User’s Manual This manual presents a description of how the WSliq program can be used to perform a variety of important liquefaction hazard analyses. The WSliq program was created as part of an extended research project supported by the Washington State Department of Transportation (WSDOT). The WSliq program is intended to allow WSDOT engineers to evaluate liquefaction hazards more accurately, reliably, and consistently, and to do so more efficiently than is possible even with the more limited procedures commonly used in contemporary geotechnical engineering practice. The WSliq program should only be used after reading the report within which this User’s Manual is contained. The report provides important information on the procedures used to perform the various liquefaction hazard analyses possible with WSliq, and it is essential that users be familiar with those procedures and the information required to complete them before using WSliq. WSliq is organized in a manner similar to that with which a liquefaction hazard evaluation would normally be conducted. In such an evaluation, an engineer would generally be required to answer three questions: 1. Is the soil susceptible to liquefaction? 2. If so, is the anticipated earthquake loading strong enough to initiate liquefaction? 3. If so, what will be the effects of liquefaction? The WSliq interface, therefore, is divided into three main tabs devoted to susceptibility, initiation, and effects. Along with tabs that facilitate entry of soil profile data and examination/documentation of results, these define the basic user interface. This User’s Manual is graphically oriented, i.e., it presents the required data by reference to the locations at which that data are entered on the various WSliq forms. Welcome Tab The Welcome tab provides two primary functions: a place for entry of global information—i.e., information potentially required for all desired analyses—and an introduction to the purpose of the WSlq program. The required global data consist of information required to identify the site and ground motion hazards at the site. A screen shot of the Welcome tab is shown in Figure H.1. Figure H.1 WSlq Welcome Tab. The global information requested on the Welcome form, and the purpose of the Data Process button found on that form, are described in Table H.1: Table H.1. Required Information and Buttons on Welcome Screen. \| Text Box Information \| Item \| Comments \| \|----------------------\|----------\|------------------------------------------------------------------------------------------------------------------------------------------\| \| \| Site: \| Enter alphanumeric description of site. This information will be written to the Report to help identify the site. \| \| \| Job No.: \| Enter alphanumeric description of job/project number. This information will be written to the Report to help identify the site. \| \| \| Latitude:\| Enter latitude in decimal degrees. All latitude values must exist within Washington State. \| \| \| Longitude:\| Enter longitude in decimal degrees. All longitude values must exist within Washington State. \| \| \| Analyst: \| Enter alphanumeric description (name) that describes person performing analyses. \| \| Buttons \| Item \| Comments \| \|----------------------\|----------\|------------------------------------------------------------------------------------------------------------------------------------------\| \| \| Data Process: \| Used to specify location (path) of ground motion hazard data files. Only needed if user wishes to store ground motion hazard databases in locations other than the default locations defined during program installation. \| Soil Profile Tab The Soil Profile tab (Figure H.2) allows entry of data that define the soil profile, for the purposes of liquefaction hazard evaluation, at the site of interest. The soil profile is defined by a series of sublayers, within which all properties are assumed to be constant, and information required for the various analyses is entered on a sublayer-by-sublayer basis. Figure H.2 WSliq Soil Profile Tab. Table H.2. Required Information and Buttons on Soil Profile Tab. \| Upper Level Text Box Information \| Comments \| \|----------------------------------\|----------\| \| Item \| Comments \| \| Number of Soil Layers: \| Enter integer number of soil layers used to define subsurface profile \| \| GWT at top of layer: \| Enter layer number corresponding to groundwater table. Note that sublayers much be arranged such that the groundwater table coincides with the top of some sublayer. \| \| SPT Energy Ratio: \| Enter SPT energy ratio, $E_R$, in percent. Value used to correct measured SPT resistance. \| \| Ground surface elevation \| Enter elevation of ground surface in appropriate units \| \| Infinite slope: \| For ground slope geometries (lateral spreading analysis), enter ground slope in percent. \| \| Free-face ratio: \| For free-face geometries (lateral spreading analysis), enter free-face ratio in percent. \| \| Soil Profile Data Text Box Information \| Comments \| \|----------------------------------------\|----------\| \| Item \| Comments \| \| Description: \| Enter alphanumeric soil description (up to 30 characters) \| \| Undr? \| Designate whether or not the layer is undrained (default condition for layers below water table). Soils not expected to maintain undrained conditions (e.g., \| Item \| Description \| \|-----------------------\|-----------------------------------------------------------------------------\| \| Buttons \| \| \| Item \| Comments \| \| +/− \| Allows insertion of new layer above or below layer for which button was clicked. \| \| Amp. Factor \| Opens new form on which PGA amplification factor (relative to NEHRP B/C boundary) can be entered. Amplification factor value can be entered directly, or in terms of a and b coefficients used in indicated Stewart-type relationship. \| \| Pore Pressure \| Opens window in which initial pore pressures can be entered. Window should open with hydrostatic pore pressure values shown; values can be changed, if necessary, to accommodate perched water table or other situations that can produce non-uniform initial pore pressure profile. \| \| Calculate \| Uses entered soil profile data to compute initial vertical effective stress and corrected SPT resistance \| \| Open Data File \| Allows an existing soil profile data file to be entered into WSliq \| \| Save Data File \| Allows entered soil profile data to be saved in data file \| \| Plot Soil Profile \| Produces plots of initial vertical effective stress, measured and corrected SPT resistance, fines content, and plasticity index with depth \| \| Batch \| Opens window allowing batch analysis to be specified. Susceptibility analysis must be performed before specifying parameters of batch analysis. User can decide in advance which analyses (liquefaction initiation, lateral spreading, post-liquefaction settlement, etc.) are to be performed. \| Susceptibility Tab The Susceptibility tab (Figures H.3) allows convenient computation of the Susceptibility Index ($SI$) and use of the $SI$ to evaluate the susceptibility of each layer in the soil profile. The $SI$ provides a quantitative measure of liquefaction susceptibility that allows a user to compare the relative susceptibilities of different layers. The $SI$ value is also used in subsequent calculations. to account for epistemic uncertainty in liquefaction susceptibility. In those calculations, the user can choose to consider only soil layers judged to be susceptible to liquefaction or to consider all layers with their contributions weighted by the $SI$ value; in that case, the $SI$ value is treated as a subjective probability, or degree of belief, of susceptibility. Figure H.3. Liquefaction Susceptibility Tab Table H.3. Required Information and Buttons on Soil Profile Tab. \| Text Box Information \| Comments \| \|----------------------\|----------\| \| Item \| Comments \| \| PI: \| Enter plasticity index for each layer. Note that the notation ‘N.P.’ (non-plastic) will appear in this box for all layers with zero fines. \| \| wc/LL: \| Enter ratio of water content to liquid limit in decimal form. Note that the notation ‘N.P.’ (non-plastic) will appear in this box for all layers with zero fines. \| \| Threshold SI: \| Enter threshold value of Susceptibility Index for judgment of soil as liquefiable. Entering a threshold value of 0.0 will cause all layers to be treated as susceptible to liquefaction in subsequent calculations. \| The results of the susceptibility evaluation are expressed in terms of $SI$ values for both the Boulanger-Idriss and Bray-Sancio procedures, as described in Chapter 4. A weighted average $SI$ value is then compared with the threshold $SI$ value selected by the user to judge whether or not the soil is susceptible to liquefaction. The user should note that many of the subsequent calculations (liquefaction potential, lateral spreading, etc.) do not include non-susceptible layers. All layers can be forced to be susceptible by setting the threshold SI value to zero; the results of any analyses performed in this manner should be reviewed and interpreted carefully. Initiation Tab The Initiation tab has a series of three sub-tabs that allow entry of data for single-scenario, multiple-scenario, and performance-based analyses of liquefaction potential. The required data are described below. Single-Scenario Analyses Single-scenario analyses can be performed in two basic ways: by inputting any desired combination of peak ground surface acceleration and magnitude, or by inputting peak ground surface acceleration values associated with a particular return period and the corresponding (mean or modal) magnitude values. In the latter case, the program determines the appropriate $a_{\text{max}}$ and $M$ values from the hazard database. Figure H.4 shows the single-scenario sub-tab, and Table H.4 describes the input required to perform single-scenario analyses. The results of single-scenario analyses are displayed graphically as plots of $F_{SL}$ and $N_{req}$ vs. depth and numerically in tabular form in the window below the plots. Clicking on either of the plots will produce a larger version of the plot. Right-clicking on any plot will allow various characteristics of the plot to be edited. The numerical data can be accessed within the single-scenario tab or on the Report tab; they can also be saved on the Report tab. Table H.4. Required Information and Buttons on Single-Scenario Liquefaction Initiation Tab. \| User-Defined Loading Parameter Information \| \| \|------------------------------------------\|----------------\| \| Item \| Comments \| \| Peak surface acceleration: \| Enter peak ground surface acceleration in g’s. Note that this acceleration value is assumed to account for local site conditions (e.g., amplification of rock acceleration values). \| \| Magnitude: \| Enter magnitude to be used in single-scenario analysis. Note that this magnitude value is not required to be related to the peak acceleration value (however results with inconsistent acceleration and magnitude values should be interpreted very carefully). \| \| PSHA-Defined Loading Parameter Information \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years. Loading data (peak acceleration and magnitude) is interpolated from ground motion hazard database. \| \| Magnitude: \| Select mean or modal magnitude to be used in magnitude scaling factor calculation. \| \| Additional Input \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Reference FS: \| Enter a factor of safety value of interest. This option plots a line at that factor of safety to allow easy comparison of calculated factors of safety with user-defined criteria. \| \| Cetin’s PL: \| The probability of liquefaction ($P_L$) to be used in Cetin et al. deterministic analysis. Value of 0.6 has been found to produce similar results to NCEER model at shallow depths. \| \| Liquefaction Models \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Select All \| Select to compute $FSL$ and $N_{req}$ using NCEER, Idriss-Boulanger, and Cetin et al. procedures. \| \| NCEER Idriss-Boulanger Cetin et al. \| Select individually as desired to compute $FSL$ and $N_{req}$ values. \| \| Buttons \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Update \| Plot the reference FS. \| \| Help \| Display brief description of $P_L$ for Cetin’s model. \| \| Compute \| Computes $FSL$ and $N_{req}$ using selected procedures. \| Multiple-Scenario Analyses Multiple-scenario analyses are easily performed with WSliq. The user is simply required to provide a return period of interest, and the program obtains the required data from the ground motion hazard database. Figure H.5 shows the multiple-scenario sub-tab, and Table H.5 describes the input required to perform multiple-scenario analyses. The results of multiple-scenario analyses are displayed graphically as plots $F_{SL}$ and $N_{req}$ vs. depth and numerically in tabular form in the window below the plots. Clicking on either of the plots will produce a larger version of the plot. The numerical data can be accessed within the multiple-scenario tab or on the Report tab; they can also be saved on the Report tab. Table H.5. Required Information and Buttons on Multiple-Scenario Liquefaction Initiation Tab. \| Loading Parameter Information \| \| \|-------------------------------\|-----------------------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years followed by carriage return to display corresponding peak ground acceleration. \| \| Additional Input \| \| \|-------------------------------\|-----------------------------\| \| Item \| Comments \| \| Reference FS: \| Enter a factor of safety value of interest. This option plots a line at that factor of safety to allow easy comparison of calculated factors of safety with user-defined criteria. \| \| Cetin’s PL: \| The probability of liquefaction ($P_L$) to be used in Cetin et al. deterministic analysis. Value of 0.6 has been found to produce similar results to NCEER model at shallow depths. \| \| Liquefaction Models \| \| \|-------------------------------\|-----------------------------\| \| Item \| Comments \| \| Select All \| Select to compute $FSL$ and $N_{req}$ using NCEER, Idriss-Boulanger, and Cetin et al. procedures. \| \| WSDOT Recommended \| Select to compute $FSL$ and $N_{req}$ as weighted average of values given by NCEER, Idriss-Boulanger, and Cetin et al. procedures. \| \| NCEER Idriss-Boulanger Cetin et al. \| Select individually as desired to compute $FSL$ and $N_{req}$ values. \| \| Buttons \| \| \|-------------------------------\|-----------------------------\| \| Item \| Comments \| \| Update \| Plot the $FS$ criterion, drawing a dashed line at the specified FS value. \| \| Help \| Display brief description of $P_L$ for Cetin’s model. \| \| Compute \| Computes $FSL$ and $N_{req}$ using selected procedures. \| \| FS Histogram \| Displays histogram of computed $FSL$ values reflecting variability in magnitudes contributing to $PGA$ ground motion hazard at selected return period. \| \| Mw Histogram \| Displays histogram of magnitudes contributing to $PGA$ ground motion hazard for selected return period. \| Performance-Based Analyses Performance-based analyses are also easily performed with WSliq. As discussed in Section 5.6.3, the Cetin et al. liquefaction potential model was used for performance-based analyses. The user is simply required to provide a return period for plotting purposes, and the program obtains the required data from the ground motion hazard database. Figure H.6 shows the performance-based analysis sub-tab, and Table H.6 describes the input required to perform performance-based analyses. Table H.6. Required Information and Buttons on Performance-Based Liquefaction Initiation Tab. \| Loading Parameter Information \| Comments \| \|-------------------------------\|----------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years. The return period does not influence the liquefaction hazard curves, but is used to produce the $F_{SL}$ and $N_{req}$ vs. depth profiles. \| \| Exceedance Probability Information \| Comments \| \|------------------------------------\|----------\| \| Item \| Comments \| \| Probability of Exceedance: \| Select a probability of exceedance and an exposure period of interest. WSliq will plot results for the corresponding return period. Note that the performance-based calculations are not repeated, rather the already computed curves are used to obtain the $F_{SL}$ and $N_{req}$ values at the indicated hazard level. \| \| Buttons \| Comments \| \|---------\|----------\| \| Item \| Comments \| \| Compute \| Computes $F_{SL}$ and $N_{req}$ hazard curves and profiles of $F_{SL}$ and $N_{req}$ corresponding to return period of interest. The performance-based calculations are voluminous, and will take a couple minutes to complete; a progress bar below the Compute button will display the progress of the calculations. Do not attempt to move to another tab while these calculations \| The results of performance-based analyses are displayed graphically as plots of $F_{SL}$ and $N_{req}$ hazard curves, and plots of $F_{SL}$ and $N_{req}$ vs. depth for the return period of interest. The results are presented numerically in tabular form in the window below the exceedance probability box. WSIiq also tabulates the return period of liquefaction (i.e., the return period corresponding to $F_{SL} = 1.0$) for each depth. Clicking on any of the plots will produce a larger version of the plot. The numerical data can be accessed within the performance-based tab or on the Report tab; they can also be saved on the Report tab. Effects Tab The Effects tab has a series of four sub-tabs that deal with the alteration of ground motions, lateral spreading, post-liquefaction settlement, and the residual strength of liquefied soil. The lateral spreading and post-liquefaction settlements tabs each have three sub-tabs that allow entry of data for single-scenario, multiple-scenario, and performance-based analyses of lateral spreading and settlement. Response Spectrum The occurrence of liquefaction is known to alter the temporal and frequency characteristics of ground surface motions. Research on the effects of liquefaction on ground surface motions (which was beyond the scope of work of the WSDOT-funded study) is continuing at the University of Washington. The preliminary results of that research have been implemented into a simple model for response spectrum modification. The response spectrum tab allows estimation of a response spectral ratio, defined as the ratio of spectral acceleration from an effective stress analysis (which accounts for pore pressure generation) to the spectral acceleration from a total stress analysis (which does not). The response spectrum produced by a total stress (e.g., SHAKE) analysis can be multiplied by the response spectral ratio to produce an improved estimate of the spectral accelerations that would be produced at a site underlain by potentially liquefiable soils. This tab provides some general guidance on the anticipated average relationship between the response spectrum with pore pressure effects and the response spectrum without pore pressure effects. It should be noted that the research on which it was based showed high levels of uncertainty in this relationship for specific input motions and soil profiles; interpretation of these results should be performed with that fact in mind. Figure H.7 WSLiq Response Spectrum Tab. Table H.7. Required Information and Buttons on Response Spectrum Tab. \| Input Information \| \|-----------------------\| \| Item \| Comments \| \| $F_{S_L,\text{min}}$: \| The minimum $FS$ against liquefaction, found from all soil layers. \| \| Buttons \| \|-------------\| \| Item \| Comments \| \| Compute \| Computes the median response spectral ratio at periods ranging from 0.01 to 1.0 sec. \| Lateral Spreading The Lateral Spreading tab has a series of three sub-tabs that allow entry of data for single-scenario, multiple-scenario, and performance-based analyses of lateral spreading. Prior to the performance of any lateral spreading analysis, however, it is important to make sure that the ground slope or free-face ratio has been entered on the Soil Profile tab (Figure H.2). The required data for each type of analysis are described below. Single-Scenario Analyses As in the case of Initiation, single-scenario lateral spreading analyses can be performed in two basic ways. Because the inputs to lateral spreading models consist of magnitude and distance, the scenarios are defined by magnitude and distance. Therefore, scenarios can be defined by the user inputting any desired combination of magnitude and distance, or by inputting a particular return period and selecting the corresponding (mean or modal) magnitude and distance values. Figure H.8 shows the single-scenario sub-tab and Table H.8 describes the input required to perform single-scenario analyses. ![WSliq Single-Scenario Lateral Spreading Tab](image) Figure H.8 WSliq Single-Scenario Lateral Spreading Tab. The results of single-scenario analyses are displayed graphically in a bar chart and numerically in tabular form in the window below the plots. The numerical data can be accessed within the single-scenario tab or on the Report tab; they can also be saved on the Report tab. Table H.8. Required Information and Buttons on Single-Scenario Lateral Spreading Tab. \| User-Defined Loading Parameter Information \| \| \|------------------------------------------\|----------------\| \| Item \| Comments \| \| Mag.: \| Enter magnitude to be used in single-scenario analysis. Note that this magnitude value does not have to be related to the distance value (however results based on inconsistent magnitude and distance values should be interpreted very carefully). \| \| Dist.: \| Enter distance to be used in single-scenario analysis in km. Note that this distance value does not have to be related to the magnitude value (however results based on inconsistent magnitude and distance values should be interpreted very carefully). \| \| PGA: \| Enter peak ground surface acceleration in g’s. Note that this acceleration value, which is used to compute the $FS_L$ value required by the Idriss and Boulanger model, should account for local site conditions (e.g., amplification of rock acceleration values). \| \| PSHA-Defined Loading Parameter Information \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years, followed by carriage return (to display corresponding mean and modal magnitudes and distances). Loading data is interpolated from ground motion hazard database. \| \| Magnitude: \| Select mean or modal magnitude. \| \| Distance: \| Select mean or modal distance. \| \| Lateral Spreading Models \| \| \|--------------------------\|----------------\| \| Item \| Comments \| \| Baska & Kramer \| Select individually as desired to compute lateral spreading displacements. Note that Idriss & Boulanger computes maximum potential displacements. \| \| Youd et al. \| \| \| Idriss & Boulanger \| \| \| Buttons \| \| \|---------\|----------------\| \| Item \| Comments \| \| Initiation Handling \| Allows consideration of potential for initiation of liquefaction in lateral spreading computations. User can specify a threshold factor of safety against liquefaction for inclusion/exclusion of individual soil layers, or can choose to have individual layer contributions weighted by probability of liquefaction. \| \| Compute \| Computes lateral spreading displacement using selected procedures. \| \| Deagg. \| Plots deaggregation of peak ground acceleration at selected return period by contributions from all magnitudes and distances. \| Multiple-Scenario Analyses Multiple-scenario analyses are easily performed with WSlqiq. The user is simply required to provide a return period of interest, and the program obtains the required data from the ground motion hazard database. Figure H.9 shows the multiple-scenario sub-tab, and Table H.9 describes the input required to perform multiple-scenario analyses. The results of multiple-scenario analyses are displayed graphically in a bar chart and numerically in tabular form in the window below the plots. The numerical data can be accessed within the multiple-scenario tab or on the Report tab; they can also be saved on the Report tab. Table H.9. Required Information and Buttons on Multiple-Scenario Lateral Spreading Tab. \| Loading Parameter Information \| \|-------------------------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years. \| \| Liquefaction Models \| \|---------------------\| \| Item \| Comments \| \| WSDOT Recommended \| Select to compute lateral spreading displacement as weighted average of values given by Baska-Kramer and Youd et al. procedures. \| \| Baska-Kramer Youd et al. Idriss & Boulanger \| Select individually as desired to compute lateral spreading displacements. Note that Idriss & Boulanger computes maximum potential displacements. \| \| Buttons \| \|---------\| \| Item \| Comments \| \| Initiation Handling \| Allows consideration of potential for initiation of liquefaction in lateral spreading computations. User can specify a threshold factor of safety against liquefaction for inclusion/exclusion of individual soil layers, or can choose to have individual layer contributions weighted by probability of liquefaction. \| \| Compute \| Computes lateral spreading displacement using selected procedures. \| \| Deagg. \| Plots deaggregation of peak ground acceleration at selected return period by contributions from all magnitudes and distances. \| Performance-Based Analyses Performance-based lateral spreading analyses are also easily performed with WSliq. As described in Section 6.6.3, the Kramer-Baska model is used in performance-based lateral spreading predictions. The program obtains the required data from the ground motion hazard database. Figure H.10 shows the performance-based analysis sub-tab, and Table H.10 describes the input required to perform performance-based analyses. The results of performance-based analyses are displayed graphically as a lateral displacement hazard curve. Numerical values of the hazard curve can be obtained by entering data in the text boxes above the hazard curve plot, followed by a carriage return. Table H.10. Required Information and Buttons on Performance-Based Lateral Spreading Tab. \| Loading Parameter Information \| Item \| Comments \| \|------------------------------\|------\|----------\| \| \| Data source selection \| Enter source of ground motion hazard data. For sites in Washington, built-in database should be used. \| \| Results \| Item \| Comments \| \|---------\|------\|----------\| \| \| Lateral displacement: \| Enter a lateral spreading displacement value, followed by a carriage return, to obtain the corresponding mean annual rate of exceedance and return period from the hazard curve. \| \| \| Mean Annual Rate of Exceedance: \| Enter a mean annual rate of exceedance value to obtain the corresponding lateral spreading displacement and return period from the hazard curve. \| \| \| Return Period: \| Enter a return period to obtain the corresponding lateral spreading displacement and mean annual rate of exceedance from the hazard curve. \| \| Buttons \| Item \| Comments \| \|---------\|------\|----------\| \| \| Compute \| Computes lateral displacement hazard curve. \| \| \| Plot Ground Motion Deaggregation \| Plots deaggregation of peak ground acceleration at selected return period by contributions from all magnitudes and distances. \| \| \| Plot Lateral Spreading Deaggregation \| Plots deaggregation of lateral spreading displacement at selected return period by contributions from all magnitudes and distances. \| Settlement The Settlement tab has a series of three sub-tabs that allow entry of data for single-scenario, multiple-scenario, and performance-based analyses of post-liquefaction settlement. The required data for each type of analysis are described below. Single-Scenario Analyses As in the case of Initiation, single-scenario settlement analyses can be performed in two basic ways. Because the loading-related input to lateral spreading models is in the form of cyclic stress ratio, the scenarios are defined by peak acceleration and magnitude. Therefore, scenarios can be defined by the user inputting any desired combination of peak acceleration and magnitude, or by inputting a particular return period and selecting the corresponding (mean or modal) magnitude value. Figure H.11 shows the single-scenario sub-tab, and Table H.11 describes the input required to perform single-scenario analyses. The results of single-scenario analyses are displayed graphically in a bar chart and numerically in tabular form in the window below the plots. The numerical data can be accessed within the single-scenario tab or on the Report tab; they can also be saved on the Report tab. Table H.11. Required Information and Buttons on Single-Scenario Settlement Tab. \| User-Defined Loading Parameter Information \| \| \|------------------------------------------\|----------------\| \| Item \| Comments \| \| Magnitude: \| Enter magnitude to be used in single-scenario analysis. Note that this magnitude value is not required to be related to the peak acceleration value (however results based on inconsistent magnitude and acceleration values should be interpreted very carefully). \| \| PGA: \| Enter peak ground surface acceleration in g’s. Note that this acceleration value should account for local site conditions (e.g., amplification of rock acceleration values). \| \| PSHA-Defined Loading Parameter Information \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years, followed by carriage return (to display corresponding mean and modal magnitudes and distances). Loading data is interpolated from ground motion hazard database. \| \| Magnitude: \| Select mean or modal magnitude. \| \| Settlement Models \| \| \|------------------------------------------\|----------------\| \| Item \| Comments \| \| Select All \| Select to compute post-liquefaction settlement using Tokimatsu-Seed, Ishihara-Yoshimine, Shamoto et al., and Wu-Seed procedures. \| \| Tokimatsu-Seed \| Select individually as desired to compute post-liquefaction settlements. \| \| Ishihara-Yoshimine \| \| \| Shamoto et al. \| \| \| Wu-Seed \| \| \| Buttons \| \| \|-------------------------------------------\|----------------\| \| Item \| Comments \| \| Initiation Handling \| Allows consideration of potential for initiation of liquefaction in settlement computations. User can specify a threshold factor of safety against liquefaction for inclusion/exclusion of individual soil layers, or can choose to have individual layer contributions weighted by probability of liquefaction. \| \| Compute \| Computes settlement using selected procedures. \| \| Deagg. \| Plots deaggregation of peak ground acceleration by contributions from all magnitudes and distances. \| Multiple-Scenario Analyses Multiple-scenario analyses are easily performed with WSliq. The user is simply required to provide a return period of interest, and the program obtains the required data from the ground motion hazard database. Figure H.12 shows the multiple-scenario sub-tab, and Table H.12 describes the input required to perform multiple-scenario settlement analyses. Figure H.12 WSliq Multiple-Scenario Settlement Tab. Table H.12. Required Information and Buttons on Multiple-Scenario Settlement Tab. \| Loading Parameter Information \| \| \|-------------------------------\|----------------\| \| Item \| Comments \| \| Return Period: \| Enter desired return period in years. \| \| Liquefaction Models \| \| \|------------------------------\|----------------\| \| Item \| Comments \| \| Tokimatsu-Seed \| Select individually as desired to compute post-liquefaction settlements. \| \| Ishihara-Yoshimine \| \| \| Shamoto et al. \| \| \| Wu-Seed \| \| \| Buttons \| \| \|------------------------------\|----------------\| \| Item \| Comments \| \| Initiation Handling \| Allows consideration of potential for initiation of liquefaction in settlement computations. User can specify a threshold factor of safety against liquefaction for inclusion/exclusion of individual soil layers, or can choose to have individual layer contributions weighted by probability of liquefaction. \| \|------------------------\|------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\| \| Compute \| Computes settlement using selected procedures. \| \| Deagg. \| Plots deaggregation of peak ground acceleration at selected return period by contributions from all magnitudes and distances. \| The results of multiple-scenario analyses are displayed graphically in a bar chart and numerically in tabular form in the window below the plots. The numerical data can be accessed within the multiple-scenario tab or on the Report tab; they can also be saved on the Report tab. Performance-Based Analyses Performance-based post-liquefaction settlement analyses are also easily performed with WSliq. As discussed in Section 7.6.3, the Wu and Seed model was used to develop the performance-based model. The program obtains the required data from the ground motion hazard database. Figure H.13 shows the performance-based analysis sub-tab, and Table H.13 describes the input required to perform performance-based analyses. The results of performance-based analyses are displayed graphically as a lateral displacement hazard curve. Numerical values of the hazard curve can be obtained by entering data in the text boxes above the hazard curve plot, followed by a carriage return. Table H.13. Required Information and Buttons on Performance-Based Settlement Tab. \| Loading Parameter Information \| Item \| Comments \| \|-------------------------------\|------\|----------\| \| Data source selection \| \| Enter source of ground motion hazard data. For sites in Washington, built-in database should be used. \| \| Results \| Item \| Comments \| \|-------------------------------\|------\|----------\| \| Settlement: \| \| Enter a settlement value, followed by a carriage return, to obtain the corresponding mean annual rate of exceedance and return period from the hazard curve. \| \| Mean Annual Rate of Exceedance: \| \| Enter a mean annual rate of exceedance value to obtain the corresponding settlement and return period from the hazard curve. \| \| Return Period: \| \| Enter a return period to obtain the corresponding settlement and mean annual rate of exceedance from the hazard curve. \| \| Buttons \| Item \| Comments \| \|-------------------------------\|------\|----------\| \| Compute \| \| Computes settlement hazard curve. Note that these calculations are voluminous (due to the requirement of integrating over the maximum volumetric strain distributions) and proceed relatively slowly. A progress bar is provided to indicate the progress of the calculations. If you move to another application while these calculations are being performed, the progress bar graphics may not display properly when you return to WSliq – the calculations are still being performed, however, and the final graphics will be displayed properly when the calculations are completed. \| \| Plot Deaggregation \| \| Plots deaggregation of settlement by contributions from all magnitudes and distances. \| Residual Strength WSliq allows estimation of residual strength by using a variety of residual strength models and allows the computation of a user-defined weighted average residual strength. Figure H.14 shows the residual strength tab, and Table H.14 describes the input required to estimate residual strength. The results of residual strength analyses are displayed graphically as plots of residual strength vs. depth and numerically in tabular form in the window below the plots. The residual strength plots use solid circles for strengths based on corrected SPT resistances that are within the range of each model, and open circles for strength values extrapolated to higher SPT resistances. Extrapolated strengths should be interpreted carefully. The numerical data can be accessed within the Residual Strength tab or on the Report tab; they can also be saved on the Report tab. Figure H.14 Residual strength tab. Table H.14. Required Information and Buttons on Residual Strength Tab. \| Input Information \| Comments \| \|-------------------\|----------\| \| Select Soil Layers \| Check boxes corresponding to layers for which estimated residual strengths are desired. Only layers for which liquefaction is expected to be initiated are available for residual strength calculation. \| \| Select Residual Strength Models \| Check boxes corresponding to models for which estimated residual strengths are desired. Checking WSDOT Recommended box will produce results for Idriss-Boulanger, Kramer-Wang hybrid, and Olson-Stark models, and weighted average of those results. \| \| Add Weighted Average \| Check to use user-defined weighting factors for residual strength estimation. \| \| Buttons \| Comments \| \|---------\|----------\| \| Compute \| Computes residual strength using selected procedures. \| \| Legend \| The legend immediately to the right of the residual strength plots is interactive \| – clicking on any of the boxes that indicate the color of each residual strength model will highlight the results of that model. Clicking on the blank box above and to the right of the legend will clear all highlighted curves Report Tab The Report tab provides the means for documenting the results of WSliq analyses in a simple text file. As shown in Figure H.15, the Report tab contains a series of check boxes for each of the various analyses that can be performed with WSliq. By selecting the desired check boxes, the user can write the results of the corresponding analyses to an RTF (rich text file) file. These data can then be further processed by using spreadsheets or other graphics programs. Copies of the plots generated by WSliq can also be written directly to the file, from which they can be copied and pasted into other documents. ![Figure H.15 Report Tab.](image) Table H.15. Required Information and Buttons on Report Tab. \| Buttons \| Item \| Comments \| \|---------\|------\|----------\| \| \| Generate Report \| Generates report file based on selected text, picture, and file format options. \| \| \| Preview \| Opens report in a small window (Figure H.16). \| Figure H.16 Report preview window. The seismic hazard database that comes with the WSliq program was created by downloading seismic hazard data on a grid across Washington State from the USGS website. When a user enters an arbitrary latitude and longitude, the program interpolates the seismic hazard data for the site of interest using an inverse distance weighting procedure (i.e., one in which the contributions of the nearby grid points are weighted in inverse proportion to their distance from the site). For particularly important projects, and for projects near faults where seismicity may change rapidly over relatively short distances, more accurate results may be possible by downloading data for the site latitude and longitude and adding it to the database. Also, the USGS hazard mapping procedures change periodically, for example when new attenuation relationships are developed or when new sources are added, so that it may be necessary to update the database. This appendix provides instructions for expanding and/or updating the seismic hazard database. Two procedures are required to update the seismic hazard database for WSLiq analysis program. The first procedure involves downloading the raw seismic hazard data from the USGS website, and the second one imports the downloaded files to the WSliq seismic hazard database. Downloading USGS Files 1. Go to the 2002 Interactive Deaggregations page at the USGS Seismic Hazard Mapping website. ([http://eqint.cr.usgs.gov/deaggint/2002/index.php](http://eqint.cr.usgs.gov/deaggint/2002/index.php)). As of the date of this report, the following page will appear. 2. Input the site info in the corresponding text boxes. The site latitude and longitude must be input in decimal format (two digits), and the longitude is a negative number for locations in America. A convenient latitude and longitude converter (from degree-minute-second to decimal degrees) can be found at http://www.fcc.gov/nmb/audio/bickel/DDDMMSS-decimal.html 3. Choose one Return Period of interest. There are six return periods from which to choose, and this process will be repeated for each. 4. Set the Frequency selection to ‘PGA.’ 5. Leave the last two options (Geographic Deaggs and Stochastic Seismograms) as their defaults. 6. Press the “Generate Output” button to produce the deaggregation file. 7. A new web page will appear. Click on the link for “Report,” and a text file will open in the web browser. Save this file (use File --> Save As) in a temporary folder on your hard drive with the specific filename determined using the following rules: a. The file has the name “Latitude_Longitude_xx.txt” (underscore characters required). b. The ‘Latitude’ and ‘Longitude’ in the filename should be replaced with the numerical coordinates corresponding to the site’s location, and ‘xx’ should be replaced by the 50-yr exceedance probability (to identify the return period). The table below indicates the required ‘xx’ values. \| Value of xx \| Return Period, yr \| \|------------\|---------------------------\| \| 01 \| 4975 (1% in 50 yrs) \| \| 02 \| 2475 (2% in 50 yrs) \| \| 05 \| 975 (5% in 50 yrs) \| \| 10 \| 475 (10% in 50 yrs) \| \| 20 \| 225 (25% in 50 yrs) \| \| 50 \| 108 (50% in 75 yrs) \| c. For example, if the site of Test #1 is located at (47.53N, 122.50W), and the deaggregation data corresponds to a return period of 4975 yrs, then the data should be saved in a file called: 47.53_122.50_01.txt. Save this file to a temporary folder (e.g., “NewGrid”) in the hard drive. 8. Repeat Step 3-8 for all other return periods. For each location, six deaggregation data files will be downloaded and saved to the hard drive. Importing and Processing USGS Files 1. Open the WSLiq program. The button labeled “Data Process” in the upper-right corner will do the work of importing the new deaggregation files created in last procedure. 2. If the button is not active (not shadowed), it means that the WA database has been installed in the default location (c:\WSDOT_LiqSys_Database) or the database is installed at the location given in the “DatabasePath.txt” file defined during installation (See the ReadMe file when downloading the WSLiq program). Simply move the database folder to a different hard drive, or change the folder’s name, then close WSLiq and re-open it. This will activate the “Data Process” button. 3. Click the “Data Process” button. A “Data Processing” window will pop up. This window provides the option to add the new grid points (downloaded in the previous procedure) to the database. 4. Select “Add Grids (USGS)” in the USGS/EZFRISK Data Processing window. 5. Assign the data folder of existing database under USGS Data Folder: in the Open Existing Database area of the window. This should be the folder you moved (or named) in Step 2. 6. In the “Add/Del Grids” panel, click on “New grid files”. A folder browser will pop up. Choose the folder in which you saved the downloaded USGS files (the temporary folder in Step 7 of the previous procedure). Note: just choose the folder, not the file itself. 7. Click the “Add” button and the program will process the USGS files and add the new grid points into WA database. If the database has the same grid points as the ones you try to add, a warning message will appear and ask if you want to overwrite the data with the new files. 8. When the “Adding grids is done” message pops up, the data processing job is finished. Click “OK” to close the message. 9. Click “Back to WSLiq” button to go back to the WSLiq program.	<urn:uuid:143febdd-3681-46c2-8d36-031f99e00d1e>	CC-MAIN-2019-13	http://faculty.washington.edu/kramer/WSliq/WSliq_User_Manual.pdf	2019-03-23T15:19:22Z	s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912202872.8/warc/CC-MAIN-20190323141433-20190323163433-00317.warc.gz	61,509,353	9,237	eng_Latn	eng_Latn	0.954218	eng_Latn	0.99403	[ "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn", "unknown", "eng_Latn", "eng_Latn", "eng_Latn", "eng_Latn" ]	true	docling	[ 1795, 2368, 4659, 6173, 8482, 9679, 11159, 11627, 14683, 15433, 18301, 19723, 21940, 22852, 23850, 27190, 27839, 29566, 29823, 32065, 32493, 35747, 36789, 38709, 38966, 41562, 42688, 43642, 43926, 45529, 46881, 48624, 49540 ]

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.